ID: 1139719731

View in Genome Browser
Species Human (GRCh38)
Location 16:68842909-68842931
Sequence GCGTGTGTACGTCTGTACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139719728_1139719731 21 Left 1139719728 16:68842865-68842887 CCCATAACAACATTTGTAGCTTT No data
Right 1139719731 16:68842909-68842931 GCGTGTGTACGTCTGTACTTAGG No data
1139719729_1139719731 20 Left 1139719729 16:68842866-68842888 CCATAACAACATTTGTAGCTTTA No data
Right 1139719731 16:68842909-68842931 GCGTGTGTACGTCTGTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139719731 Original CRISPR GCGTGTGTACGTCTGTACTT AGG Intergenic
No off target data available for this crispr