ID: 1139725147

View in Genome Browser
Species Human (GRCh38)
Location 16:68891764-68891786
Sequence CTGTAGCTACAGCTTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139725143_1139725147 30 Left 1139725143 16:68891711-68891733 CCATGGCTGAAGTTCTATGATTC 0: 1
1: 0
2: 1
3: 12
4: 240
Right 1139725147 16:68891764-68891786 CTGTAGCTACAGCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139725147 Original CRISPR CTGTAGCTACAGCTTAAGGA AGG Intronic
901185252 1:7368676-7368698 ATGGAGCTACAGCTTAGGGGAGG - Intronic
905560301 1:38921257-38921279 CTGTACTTCCAGCTGAAGGAAGG + Intronic
905688691 1:39927149-39927171 CTGGAACTACAGCTTGAGGCAGG - Intergenic
906255506 1:44346157-44346179 CTGTAGCTACAGGCCAAGGCAGG - Intronic
908284643 1:62582215-62582237 CTGTAGCTACTGCTAAATGAAGG + Intronic
912412506 1:109488553-109488575 CTGAAGGTCCAGCTTAAGGGAGG + Intronic
912752957 1:112300678-112300700 CTGTGGCTGCAGTTTAAGGAGGG + Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
917985176 1:180309462-180309484 CTGTTGCTACAGTTTCTGGAAGG + Intronic
918902997 1:190450141-190450163 CTGTGGCTACATCTCAAGGTAGG + Intronic
919663716 1:200272472-200272494 CAGTAGTTACAGCTAAAGGGGGG + Intergenic
922094715 1:222433502-222433524 CTGTACATACAGGTTAAGGGTGG - Intergenic
923214544 1:231836324-231836346 TTGAAGCTGCAGTTTAAGGAGGG + Intronic
923712236 1:236396556-236396578 CTGAAGCCACAATTTAAGGATGG - Intronic
923884663 1:238141096-238141118 CTGTAGCTGATGCTTATGGAAGG + Intergenic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
1063250951 10:4273973-4273995 CTGTGTCTCCAGCTTAAAGATGG + Intergenic
1064735265 10:18375745-18375767 CTGTGTCTACAGTTGAAGGATGG + Intronic
1065859859 10:29863463-29863485 CTGTAGTGCCAGCTGAAGGAGGG - Intergenic
1067776298 10:49167190-49167212 CAGTTTCTACAGCTGAAGGAGGG - Intronic
1067947110 10:50696557-50696579 CTGAAGCTGCAGCTGAATGAGGG - Intergenic
1069026763 10:63550728-63550750 CTAGAGCTCCAGGTTAAGGAAGG + Intronic
1070882422 10:79861547-79861569 CTGAAGCTGCAGCTGAATGAGGG - Intergenic
1071198619 10:83191425-83191447 CTGTAGCTACAGCATAGAGAAGG - Intergenic
1071648992 10:87377858-87377880 CTGAAGCTGCAGCTGAATGAGGG - Intergenic
1072801012 10:98392432-98392454 CTGTGGCGTCAGCTTCAGGAAGG + Exonic
1078249592 11:9606174-9606196 CTTTGGCTTCAGCTTTAGGAGGG - Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1081506097 11:43718708-43718730 CTTTGGCTTCAGCTTTAGGAGGG - Intronic
1085300041 11:75452624-75452646 CTCCAGCAGCAGCTTAAGGAAGG - Intronic
1085491589 11:76924095-76924117 CTCAAGCCACAGCATAAGGAGGG - Intronic
1085705061 11:78779597-78779619 CTATAACTACAGCCTAGGGAGGG - Intronic
1087650111 11:100856287-100856309 CTGTTGCTACTGCATAAGAAAGG - Intronic
1088904928 11:114148093-114148115 CTGCAGCAACTGCTCAAGGAGGG - Intronic
1089213353 11:116820930-116820952 CTGTTGCTCCAGCTCAGGGAGGG + Exonic
1091703935 12:2681098-2681120 ATGAAGCTTCTGCTTAAGGAGGG + Intronic
1091710614 12:2737574-2737596 ATGAAGCTTCTGCTTAAGGAGGG + Intergenic
1091713460 12:2759636-2759658 ATGAAGCTTCTGCTTAAGGAGGG + Intergenic
1093011528 12:14112061-14112083 ATGTAGCACCAGCTTAAGAAAGG - Intergenic
1093025858 12:14244618-14244640 CTGCAGCCACAGCATAAGCATGG - Intergenic
1093101147 12:15030679-15030701 CTGTAGACAAAACTTAAGGATGG + Intergenic
1094650727 12:32373514-32373536 GTGTAGCTATAGCTTAAATATGG - Intronic
1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG + Intronic
1095768129 12:45919268-45919290 CTGAAGCTACATCTTTTGGATGG + Exonic
1099435345 12:82635480-82635502 CTGTGGATACAGCTCATGGAGGG - Intergenic
1100456924 12:94760619-94760641 CTGAAGCTGCAGCTTAAAGTGGG - Intergenic
1101798989 12:108003999-108004021 CTGTAGCTCCAGCTTATTGACGG + Intergenic
1106197964 13:27510175-27510197 CTGTTTCTAAAGCTTCAGGATGG - Intergenic
1107722839 13:43267135-43267157 CTGGAGCTGCAGCTCGAGGAAGG - Intronic
1108412328 13:50162280-50162302 GTGTACCTACAGCATAAGGTGGG - Intronic
1108471794 13:50774257-50774279 CAGTGGGTACAGCCTAAGGAGGG - Intronic
1110074924 13:71228213-71228235 CTGTAGCAACAGCTTTATGTGGG - Intergenic
1110839886 13:80129845-80129867 CTGTAGCTACTGTTTACTGAGGG - Intergenic
1111550773 13:89808862-89808884 CAGTTGCTAGAGCTTAAAGAAGG + Intergenic
1112784635 13:102938360-102938382 CTGTGGCTGCAGCATAAGGGAGG + Intergenic
1112798380 13:103082993-103083015 ATGTAGTAAGAGCTTAAGGAGGG + Intergenic
1113989188 13:114346199-114346221 CTTTGGCTTCAGCTTTAGGACGG - Intergenic
1116023488 14:39488694-39488716 ATGATGTTACAGCTTAAGGAAGG + Intergenic
1120360883 14:83500540-83500562 CTGTAGCTACAGTTCCAGGCTGG - Intergenic
1121904118 14:97724060-97724082 ATGTAGCCACAGCTCGAGGAAGG - Intergenic
1123131469 14:105988957-105988979 CTGTCTCTACAGCTTTTGGAGGG + Intergenic
1202867813 14_GL000225v1_random:134536-134558 CTGTAGATAGAGCTTAAACAAGG - Intergenic
1124898828 15:33803635-33803657 CTGTAGCTCCAGCTTTTGGGAGG - Intronic
1131401914 15:92131949-92131971 CTGTCCCTGCAGCTTAATGAGGG - Intronic
1134884677 16:17779598-17779620 CTGTAGCTACACCAGAAGGCGGG + Intergenic
1139725147 16:68891764-68891786 CTGTAGCTACAGCTTAAGGAAGG + Intronic
1142162069 16:88562819-88562841 CTGTTGCTATAGCTTAAGAGTGG + Intergenic
1143596138 17:7915489-7915511 CGGAAGCTACAGCCGAAGGAAGG - Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145937089 17:28720714-28720736 CTTTGGCTTCAGCTTTAGGAGGG - Exonic
1146693442 17:34892272-34892294 CTCAAGCTACAGCTTTAGAAAGG - Intergenic
1149080632 17:52652225-52652247 CAGTAGGTACAGTTTAAGGAGGG + Intergenic
1149475631 17:56959029-56959051 CTGTAGCTGAAGCTTAAAGGGGG + Intronic
1156812077 18:41264751-41264773 CTGTAGCTGCTGCTGAAGCAGGG + Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1163655806 19:18544004-18544026 CTGTAACTAAGGCTTCAGGATGG - Intronic
1168724339 19:58572572-58572594 CTGCAGCTGCGGCTTTAGGAAGG + Intronic
931636762 2:64347685-64347707 CTTTGGCTTCAGCTTTAGGAGGG + Intergenic
937927014 2:127175259-127175281 CTGTAGCAACTGATTACGGAGGG + Intergenic
939816866 2:146907313-146907335 CTCTGGCTACAGGTTTAGGAGGG - Intergenic
940106664 2:150108849-150108871 CTGTATCTTCAGTTGAAGGATGG + Intergenic
940839969 2:158568524-158568546 ATGTAGCTACACCTAAATGATGG - Intronic
944151398 2:196562459-196562481 CAGTAGCTAAAGCTGAAAGAGGG + Intronic
944365304 2:198912387-198912409 CTGTATCTACAGCTTAGAGGTGG - Intergenic
947620296 2:231585896-231585918 CTTTGGCTTCAGCTTTAGGAGGG - Intergenic
948118208 2:235509599-235509621 CTGTAGCTACAACTGAGGTATGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1172379674 20:34477985-34478007 CTGTAGCTACAGCATAATAAAGG - Intronic
1172641322 20:36442096-36442118 CTGGAGATACAGATTAGGGATGG - Intronic
1172969754 20:38864872-38864894 CTGCAGCTCCAGCTCCAGGAGGG - Intronic
1174187077 20:48713613-48713635 CTGTAGTTCCAGCTTTTGGAAGG + Intronic
1175705121 20:61171084-61171106 CTGGAGTTACAGCTAGAGGAAGG - Intergenic
1177120556 21:17132577-17132599 CTGTGGCTAGAGCTTGAGCAGGG + Intergenic
1177997098 21:28114600-28114622 CTGTACCTACACTTTAAGAAAGG + Intergenic
1182835512 22:33338306-33338328 ATGTAGCTGCTGCTAAAGGAAGG - Intronic
1184177664 22:42798286-42798308 CTCTAGCTGCAGTTCAAGGAGGG - Intronic
1184398843 22:44261947-44261969 CTATAGTTCCAGCTTATGGAAGG - Intronic
949615759 3:5752164-5752186 CTGGATCTCCAGCTTGAGGACGG + Intergenic
950767128 3:15281166-15281188 CTATAGCTATAGCTTAGGGGAGG - Intronic
952314635 3:32221938-32221960 CTGAAGCCTCAGCTTCAGGAAGG + Intergenic
954236656 3:49262211-49262233 CTCTGGCTACAGCCCAAGGATGG + Intergenic
955967866 3:64407413-64407435 CTAGAGCTACAGCTTAGGTAGGG + Intronic
958906379 3:99946523-99946545 ATGTAGCTGCAGCTAAAGAATGG + Intronic
959050584 3:101520966-101520988 CTGTAGGTAGAGCTTAAAGCGGG - Intergenic
960357316 3:116669603-116669625 TTATAGAGACAGCTTAAGGAGGG + Intronic
964881603 3:161429543-161429565 CTTTGGCTTCAGCTTTAGGAGGG + Intergenic
964925425 3:161950615-161950637 CTATAGTTACAGTTTTAGGATGG + Intergenic
964984160 3:162718576-162718598 ATGAAGCTAGGGCTTAAGGAGGG - Intergenic
966583557 3:181596008-181596030 ATGTGGCCACAGCCTAAGGAAGG + Intergenic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
969981923 4:11166468-11166490 CAGCAGCTACATCTGAAGGAGGG + Intergenic
974121255 4:57641641-57641663 CAGTAGCTAAAGGTGAAGGAGGG - Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
977492394 4:97731785-97731807 CTGTAGATGCAGCTTAAGTGGGG - Intronic
978649698 4:110985709-110985731 GGGTAGCTACAGCTCAATGAGGG + Intergenic
983365419 4:166780742-166780764 GTTAAGCTACAGCTTTAGGAAGG - Intronic
994737926 5:103579403-103579425 CTGTACCTACTGCATAATGAAGG - Intergenic
995480271 5:112586162-112586184 CAGTGGCTACAGCCCAAGGAGGG + Intergenic
997012885 5:129900093-129900115 CAGTAGCTACAGCTCAGAGAAGG + Intergenic
997363965 5:133313515-133313537 CTGTAGCTCCAGCTGAGTGAGGG - Intronic
998755967 5:145379725-145379747 GGGAAGCTACAGCATAAGGAGGG + Intergenic
1000047792 5:157535827-157535849 CTGTACCCACAGCTCAAGAATGG - Intronic
1000765591 5:165285294-165285316 CTCTAGCTTCTGCTTAGGGATGG - Intergenic
1003065303 6:2900018-2900040 CTGTACCAACAGCTCAGGGAGGG - Intronic
1003616241 6:7657688-7657710 CGGCAGCTACAGCCTAAGAAAGG - Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010752002 6:79626327-79626349 CTGTAGATAAACCTTAATGAAGG + Intergenic
1011113835 6:83867853-83867875 CTGTATGTACAGCGTAAGCAGGG - Intronic
1014809816 6:125872339-125872361 ATCTAGCTACAGCTTATGGAAGG + Intronic
1015697087 6:135992634-135992656 CTGTAGCTAGAGTTTGTGGATGG + Intronic
1015864575 6:137714813-137714835 CTGTAGCAACAACTTAAAGTAGG + Intergenic
1015974278 6:138773635-138773657 CCGGAGTTACAGCTAAAGGAAGG + Exonic
1016953253 6:149601689-149601711 CTGTAGCTACTGCTTTAGCAAGG + Exonic
1018663963 6:166116571-166116593 CTGTAGTTTCAGCTACAGGAAGG + Intergenic
1021203370 7:17751741-17751763 CTGTGGCTTTAGCTTCAGGATGG + Intergenic
1036483582 8:9159707-9159729 CTGGAGCTACTGCTCAAGGCAGG + Intronic
1039770923 8:40685991-40686013 CTGGAGCAACAGCGTAGGGATGG + Intronic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044892948 8:96856500-96856522 CTGTACCTACAGCCTGATGAGGG - Intronic
1045566818 8:103325669-103325691 CTGAAGCTAAAGCTTGAGGAAGG - Intronic
1047945174 8:129869826-129869848 CTGTACTTCCAGCTTGAGGAAGG - Intronic
1048026797 8:130594713-130594735 CTGTAGCTGCAGCCTATGGAAGG - Intergenic
1049249899 8:141582706-141582728 CGGAAGCTGCAGCTTCAGGAGGG + Intergenic
1053618244 9:39791837-39791859 TTGGACCTACAGCTTAAGGTCGG + Intergenic
1054265912 9:62915592-62915614 TTGGACCTACAGCTTAAGGTCGG - Intergenic
1058500789 9:105613603-105613625 CTGTATCTACAGGTTTAGAATGG - Intronic
1061345071 9:130017225-130017247 CTTTGGCAACAGCTTAGGGAAGG - Intronic
1061749108 9:132763164-132763186 CGGTAGCTCCAGCTTCAAGATGG - Intronic
1203736957 Un_GL000216v2:145731-145753 CTGTAGATAGAGCTTAAACAAGG + Intergenic
1187780340 X:22815281-22815303 GTGTAGCTGCAGCATAATGAAGG + Intergenic
1196757078 X:119167450-119167472 GTGTAGCTACAGCAAGAGGATGG + Intergenic
1198572313 X:137971104-137971126 CAGTGGGTACAGCTTATGGAGGG + Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1201400874 Y:13602583-13602605 CTGTAGCAACAGTTTCAGGGGGG + Intergenic