ID: 1139733440

View in Genome Browser
Species Human (GRCh38)
Location 16:68967447-68967469
Sequence CCGGTAACAGTCTGCAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139733429_1139733440 14 Left 1139733429 16:68967410-68967432 CCTCCTGCTGTGTGGTCCCGTTC 0: 1
1: 27
2: 325
3: 854
4: 1311
Right 1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 123
1139733433_1139733440 -3 Left 1139733433 16:68967427-68967449 CCGTTCCTAACAGGCCATGCCCG 0: 1
1: 0
2: 2
3: 33
4: 108
Right 1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 123
1139733432_1139733440 -2 Left 1139733432 16:68967426-68967448 CCCGTTCCTAACAGGCCATGCCC 0: 1
1: 13
2: 277
3: 539
4: 1002
Right 1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 123
1139733435_1139733440 -8 Left 1139733435 16:68967432-68967454 CCTAACAGGCCATGCCCGGTAAC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 123
1139733430_1139733440 11 Left 1139733430 16:68967413-68967435 CCTGCTGTGTGGTCCCGTTCCTA 0: 1
1: 30
2: 355
3: 836
4: 1288
Right 1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 123
1139733427_1139733440 26 Left 1139733427 16:68967398-68967420 CCTTGCTGCTCACCTCCTGCTGT 0: 12
1: 30
2: 53
3: 106
4: 516
Right 1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 123
1139733426_1139733440 27 Left 1139733426 16:68967397-68967419 CCCTTGCTGCTCACCTCCTGCTG 0: 2
1: 8
2: 32
3: 88
4: 470
Right 1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139733440 Original CRISPR CCGGTAACAGTCTGCAACCT GGG Intronic
904705089 1:32384031-32384053 CCGGGAACAGGCTGCAATCTGGG + Exonic
905688912 1:39928392-39928414 CCGGTACCAGTCTGCAGGCCAGG - Intergenic
907228063 1:52968014-52968036 CCTGTAACACTCTGCCTCCTGGG + Intronic
909660511 1:78076676-78076698 CTGGTACCAGTCTGCAGCCTAGG + Intronic
910687240 1:89929820-89929842 CAGGTACCAGTCTGCAGCCTGGG - Intronic
911037637 1:93567304-93567326 CCGGTAGCTGTCTGCAGCCTCGG + Exonic
913230362 1:116735983-116736005 CCGGTACCAGTCTGCAGCCAGGG - Intergenic
916960475 1:169883350-169883372 CCAGTACCAGTCTGCAGCCTAGG + Intronic
917205860 1:172571451-172571473 CCGGGCACAGGCTGCAATCTTGG - Intronic
917543712 1:175940226-175940248 CTGGTACCAGTCTGCAGCCTGGG + Intergenic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
923704423 1:236332507-236332529 CTGGTACCAGTCTGCAGCCCGGG - Intergenic
1063182402 10:3616359-3616381 AAGGTAACAGTCTTCAGCCTTGG - Intergenic
1063860915 10:10307052-10307074 TAGGCAACAGTCTGCAACATGGG - Intergenic
1064636503 10:17373525-17373547 GCAGTATCAGTCTGCAAACTGGG - Intronic
1068367419 10:56068665-56068687 GCGGTCCCAGTCTGCAGCCTGGG + Intergenic
1069319995 10:67158008-67158030 GCCGAGACAGTCTGCAACCTTGG - Intronic
1073083536 10:100874244-100874266 CTGGCACCAGCCTGCAACCTGGG + Intergenic
1075291432 10:121234421-121234443 CCGGTACTCGTCTGCAACCCAGG + Intergenic
1083056674 11:59828077-59828099 CTGGTAACAGTCTGGCTCCTAGG - Intergenic
1083282066 11:61633097-61633119 CCAGTACCAGTCTGCAACCTGGG - Intergenic
1085443432 11:76582909-76582931 CCGGTCAGAGGCTGCAATCTCGG + Intergenic
1096016645 12:48282270-48282292 CCAGTACCAGTCTGTGACCTGGG - Intergenic
1097032126 12:56097333-56097355 CTGGTACCAGTCTGCAGCCCGGG - Intronic
1100282809 12:93134368-93134390 CCAGTACCAGTCTGCTGCCTGGG + Intergenic
1102203832 12:111076666-111076688 CTGGAAACAGACTGGAACCTGGG - Intronic
1107797221 13:44065104-44065126 CTGGTACCAGTCTGCAGGCTTGG + Intergenic
1110751907 13:79124459-79124481 CAGGTACCAGTCAGCAAACTGGG - Intergenic
1110763037 13:79251691-79251713 CCGGTACGTGTCTGCAGCCTGGG + Intergenic
1117930878 14:60839127-60839149 CCAGGAACAGTCTGAAGCCTGGG + Intronic
1123498306 15:20853514-20853536 CTGGTACCAGTCTGTGACCTGGG - Intronic
1123555537 15:21427142-21427164 CTGGTACCAGTCTGTGACCTGGG - Intronic
1123591781 15:21864473-21864495 CTGGTACCAGTCTGTGACCTGGG - Intergenic
1123996882 15:25725002-25725024 CCAGTACCAGTCTGCAGCCTGGG - Intronic
1125249057 15:37678363-37678385 CTGGCACCAGTCTGCAGCCTGGG + Intergenic
1126038014 15:44565560-44565582 CCAGTACCAGTCTGCAGCCTGGG + Intronic
1127094574 15:55499492-55499514 CAGGGAACAGTTTGCAAACTGGG - Intronic
1130629627 15:85553695-85553717 CCAGTACCAGTCTGTAGCCTAGG - Intronic
1130989766 15:88869392-88869414 CCTCTACCAGTCTGTAACCTTGG - Intronic
1202963881 15_KI270727v1_random:154352-154374 CTGGTACCAGTCTGTGACCTGGG - Intergenic
1133680321 16:8114806-8114828 CCGGGAAAAGGCTGCAATCTTGG - Intergenic
1135694620 16:24575366-24575388 CCGGGCACAGGCTGCAATCTCGG + Intergenic
1137275431 16:46930147-46930169 CAGGTCAGAGTCTGCAGCCTGGG - Exonic
1139733440 16:68967447-68967469 CCGGTAACAGTCTGCAACCTGGG + Intronic
1143644549 17:8221837-8221859 CCGGGAACAGTAGGCAACCCCGG - Intergenic
1146421979 17:32695390-32695412 CCAGTACCAGTCTGCCACTTGGG + Intronic
1148830898 17:50430288-50430310 CCGGTTGCAGTCTGCAAACATGG - Intronic
1149314676 17:55427873-55427895 CCGGTACCAGTCCACAGCCTGGG - Intergenic
1149391759 17:56198533-56198555 CAGGTACCAGTCTGCAGCCTGGG + Intronic
1149951914 17:60997257-60997279 CCGGTACCAGTCCACCACCTGGG + Intronic
1155285268 18:24281815-24281837 CCAGTACCAGTCTGCAGCCCGGG - Intronic
1156774698 18:40772623-40772645 CCAGTACCAGTCTGCAGCCTGGG + Intergenic
1158689103 18:59644298-59644320 CCAGTACCAGTCTGCAGCCCAGG + Intronic
1160216968 18:76940798-76940820 CAGGTACCAGTCCACAACCTGGG - Intronic
1162039507 19:7961511-7961533 CCGAGAGCAGTCTGCATCCTGGG - Exonic
1166988790 19:46678288-46678310 CCGGAAACAGCCTGGCACCTTGG - Intronic
1168568718 19:57446113-57446135 CTGGTACCAGTTTGCAGCCTGGG - Intronic
928252369 2:29692711-29692733 CAGGTACCAGTCTTCAGCCTGGG + Intronic
929184604 2:39080433-39080455 CCAGTATCAGTCTGTAGCCTGGG + Intronic
932718841 2:74123649-74123671 CCGGGCAGAGGCTGCAACCTCGG - Intergenic
933072110 2:77871736-77871758 CTGGTACCAGTCTGCCACCTGGG + Intergenic
933889305 2:86752028-86752050 CAGGTAACAGTGTGCCAACTGGG + Exonic
941075969 2:161007147-161007169 CTGGTACCAGTCTGCAGCCCTGG + Intergenic
943776535 2:191772680-191772702 CCAGTACCAGTCTGTGACCTGGG - Intergenic
944260394 2:197669765-197669787 CCAGTACCAGTCTGCAGCCTGGG + Intronic
946779304 2:223176548-223176570 CCGGTACCAGTCTACAGCCCGGG - Intronic
1170442846 20:16396138-16396160 CTGGTACCAGTCCGCAGCCTGGG - Intronic
1170453352 20:16508697-16508719 CCAGTACCAGTCTGCAGCCCGGG + Intronic
1170662712 20:18358610-18358632 CAAGAAACAGTCTTCAACCTAGG + Intergenic
1172720879 20:36999884-36999906 CCGGGCAGAGTCTGCAATCTCGG - Intronic
1173477120 20:43367970-43367992 CCGGTACCAGTCTGTCACCCAGG - Intergenic
1176085197 20:63292719-63292741 CCGGCACCAGTCTGCAAAGTGGG + Intergenic
1176714460 21:10338375-10338397 CAGGTAACTCTCTTCAACCTAGG - Intergenic
1181624105 22:24111296-24111318 CTGGTACCAGTCTGTGACCTGGG - Intronic
1182972387 22:34590424-34590446 ATGGTGACAGTCTGCAACATGGG - Intergenic
1183185684 22:36290539-36290561 CCGGGAAGAGGCTGCAATCTTGG - Intronic
954513171 3:51146069-51146091 CCCGTAGCAGTCTGCAGCCCAGG + Intronic
957679170 3:83409181-83409203 CAGGTAACTGTCCTCAACCTTGG + Intergenic
962280315 3:134047251-134047273 CAGGGAACAGTTTGCAAACTGGG - Intronic
967127331 3:186435804-186435826 CCGGGCAGAGTCTGCAATCTCGG + Intergenic
968855734 4:3120431-3120453 CCAGTACCACTCTGCAGCCTGGG - Intronic
969674424 4:8607157-8607179 CCGTTAATAGTCTGCACCATTGG + Intronic
976705635 4:88016195-88016217 CCAGTACCCGTCTGCAGCCTGGG + Intronic
977817510 4:101431904-101431926 CCAGTACCGGTCTGCAGCCTAGG + Intronic
978360067 4:107921976-107921998 CTGGTACCAGTCTGCAGCCTGGG + Intergenic
978479669 4:109174817-109174839 CCAGTAGTAGTCTGCAGCCTTGG - Intronic
978876648 4:113647691-113647713 AAGGTAACAGTTTTCAACCTGGG - Intronic
979566294 4:122157643-122157665 CCAGTACCAGTCTGCGGCCTGGG + Intronic
979920815 4:126493624-126493646 CTGGTACTAGTCTGCGACCTGGG + Intergenic
981691053 4:147509494-147509516 CTGGTACTAGTCTGCAGCCTGGG - Intronic
981728091 4:147868906-147868928 CCGGTACCTGTCGGCAGCCTGGG + Intronic
981747055 4:148062166-148062188 ACGGTGACACTCAGCAACCTAGG - Intronic
982079862 4:151778730-151778752 CTGGTACCAGTCTGCGGCCTGGG - Intergenic
985849997 5:2381878-2381900 CCGGGAACATGCTTCAACCTTGG - Intergenic
986418846 5:7556622-7556644 CCAGTACCAGTCTGCAGCCCTGG - Intronic
986529804 5:8724617-8724639 CAGGTAGCAGTCTGCAAGCCAGG - Intergenic
990972179 5:61520083-61520105 CTGGTACCAGTCTGCAGCCTGGG + Intronic
991286494 5:64982804-64982826 CCAGTACCAGTCTGCAGTCTGGG - Intronic
992151184 5:73905048-73905070 CAGGTAACACTCTGCACCCTGGG - Intronic
995403278 5:111765352-111765374 CCAGTACCAGTCTGCACCTTGGG + Intronic
996557685 5:124796099-124796121 ACAGTACCAGTCTGCAGCCTGGG - Intergenic
996877413 5:128254603-128254625 CCAGTAACAATCTGCAAACTGGG + Intergenic
997898423 5:137740934-137740956 CCAGTACCAGTCTGTGACCTAGG + Intergenic
1000794780 5:165651267-165651289 CCCTTCACAGGCTGCAACCTCGG + Intergenic
1005860444 6:29896152-29896174 CCGGGAAGAGGCTGCAATCTTGG + Intergenic
1006135584 6:31894269-31894291 CCTGTAACAGTCCGCTACTTGGG - Intronic
1006527093 6:34615843-34615865 CAGTTAACAGTCTTCAAACTAGG + Intronic
1006606520 6:35261039-35261061 CCAGAATCAGTCTGGAACCTAGG - Intronic
1012100824 6:95084009-95084031 CCAGCAACAGTCTGAAGCCTGGG + Intergenic
1012281760 6:97336075-97336097 CTGCTACCAGTCTGCAGCCTGGG + Intergenic
1013562082 6:111315698-111315720 CTGGTATCAGTCTGTAGCCTTGG - Intronic
1013800057 6:113931978-113932000 CCGGTCAGAGGCTGCAATCTCGG - Intergenic
1014098730 6:117486794-117486816 CAGGTACCAGTCTGCAGCCCAGG - Intronic
1015001289 6:128219563-128219585 CCAGTACCAGTTTGCAGCCTGGG + Intronic
1017230664 6:152069828-152069850 CTGGTACCAGTTTGCAACCCAGG + Intronic
1017464516 6:154682102-154682124 CAGGTACCAGTCTGCAGCCTGGG - Intergenic
1017631262 6:156398105-156398127 CAGATAACAGACTGCAATCTGGG - Intergenic
1018112201 6:160546583-160546605 CAGGTCACAGCCTGCAACTTGGG + Intronic
1018669041 6:166164615-166164637 CCGGAGACAGCCAGCAACCTGGG - Exonic
1021652628 7:22846593-22846615 CTGATACCAGTCTGCAGCCTGGG + Intergenic
1021749976 7:23787429-23787451 CTGGTACCAGTCTGCGACCTGGG - Intronic
1028570302 7:92279247-92279269 CAGGTACCAGGCTACAACCTGGG + Intronic
1030740027 7:113097984-113098006 ACGGTATCACTCTGCAGCCTAGG - Intergenic
1038898807 8:31818716-31818738 CCGGTACCAGTCAGTAAGCTGGG + Intronic
1044539752 8:93395329-93395351 CAGGTACCAGTCTGCAGCCTGGG + Intergenic
1046735986 8:117777497-117777519 CCGGGAAGAGGCTGCAATCTCGG - Intergenic
1047459296 8:125047036-125047058 CCGGTATCAGTCTGCAGCGCAGG + Intronic
1048234737 8:132678492-132678514 CAGGTTTCAGTCTTCAACCTTGG + Intergenic
1049394948 8:142395623-142395645 CCGGTCACAGCCTCCAGCCTGGG - Intronic
1050164147 9:2746797-2746819 CCAGTACCAGTCCGCAATCTGGG - Intronic
1051281142 9:15442774-15442796 CCGGGTACAGGCTGCAATCTCGG + Intronic
1051967156 9:22843200-22843222 CCAGTACCAGTCTGCAGCCTGGG + Intergenic
1052387726 9:27841765-27841787 CCGGAAACAGTGTCAAACCTTGG - Intergenic
1053572360 9:39322243-39322265 CAGGGAACACTCTACAACCTGGG + Intergenic
1054093921 9:60880955-60880977 CAGGGAACACTCTACAACCTGGG + Intergenic
1054115395 9:61156875-61156897 CAGGGAACACTCTACAACCTGGG + Intergenic
1054124785 9:61296768-61296790 CAGGGAACACTCTACAACCTGGG - Intergenic
1054592361 9:67025667-67025689 CAGGGAACACTCTACAACCTGGG - Intergenic
1055417509 9:76099442-76099464 CCTGTAGCTTTCTGCAACCTGGG + Intronic
1058588429 9:106534826-106534848 CCGGGAACAGTTTGCAAACTGGG - Intergenic
1059730814 9:117055100-117055122 CCAGTACCAGTCTGCAGCCTGGG + Intronic
1203562535 Un_KI270744v1:71167-71189 CCGGGCAGAGTCTGCAATCTCGG - Intergenic
1186668660 X:11746128-11746150 CTGGTACCAGTCTGCAGCCCAGG + Intergenic
1187972524 X:24673425-24673447 GAGGTAACAGTCTGCAGCCAAGG - Intergenic
1189681932 X:43526003-43526025 AGGGTTACAGTCTGCAAGCTGGG + Intergenic
1190951591 X:55150536-55150558 CCAGTACCAGTCTGCAGCCCAGG + Intronic
1194786265 X:98087579-98087601 CCGGTACCAGTCTGCACCCGGGG + Intergenic
1197840842 X:130744782-130744804 CCGGTACCAGTCTGCAGCCTAGG - Intronic
1198271082 X:135056435-135056457 CTGGTACCGGTCTGCAGCCTGGG + Intergenic
1200386447 X:155895769-155895791 CCTGTACCGGTCTGCAGCCTGGG - Intronic