ID: 1139736212

View in Genome Browser
Species Human (GRCh38)
Location 16:68991113-68991135
Sequence TCCCTCTGTTGAGGCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139736212 Original CRISPR TCCCTCTGTTGAGGCTGTGT TGG Intronic
900217409 1:1489260-1489282 TCCCTCACTTGTTGCTGTGTTGG - Exonic
901002878 1:6157389-6157411 TGCCTCTGCTGTGGCAGTGTTGG - Intronic
901091534 1:6644892-6644914 TTCCTATTTTGAGGCTGTGGGGG - Intronic
901196614 1:7443828-7443850 ACCCCCTGTAGAGGCTGTCTTGG - Intronic
902212017 1:14911288-14911310 TCCCTCTGTTGAATGTTTGTAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903733459 1:25515006-25515028 TGGCTTTGTTGAAGCTGTGTGGG - Intergenic
904999507 1:34657350-34657372 TCCTTCTGTTGGGGCAGGGTTGG - Intergenic
905343511 1:37295535-37295557 CTCCTCTTTTGGGGCTGTGTGGG - Intergenic
905441073 1:37996941-37996963 CCCCGCGGTTGAGGCTGTGGGGG - Exonic
906936359 1:50217338-50217360 TCCCTCTCCTGAGGCTTTCTGGG - Intergenic
907790692 1:57660614-57660636 TCACTCTGCTGAGGCTGGGAGGG + Intronic
910762880 1:90752304-90752326 TGCCTCTGGTGAGCATGTGTTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912484948 1:110019100-110019122 TACCTGTGTTGTGGCTGTGATGG - Exonic
913706915 1:121434525-121434547 TCCCTCTGCTGTGGCTGTGCTGG - Intergenic
915123850 1:153649654-153649676 ACCCTCTGTAGAGCCTGGGTGGG - Intergenic
915322115 1:155061891-155061913 TCTCTCTGTTCAGGCTGAGCTGG + Exonic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915808571 1:158880877-158880899 TACCTCAGTTGAGGAAGTGTTGG - Intergenic
915813321 1:158939228-158939250 TACCTCAGTTGAGGAAGTGTTGG - Exonic
915979186 1:160409524-160409546 TCCGTCTGTGGAAGCTGTGTTGG + Intronic
918275325 1:182948554-182948576 TACCTTTATGGAGGCTGTGTGGG - Intronic
1063323387 10:5073481-5073503 TCCCACTGAGGAGTCTGTGTAGG - Intronic
1064483036 10:15758638-15758660 TCTCTCTCTTTAGGCTCTGTAGG + Intergenic
1067684351 10:48457912-48457934 ACCCTCTGTTGGGGGTGGGTAGG + Intronic
1070556730 10:77533726-77533748 TCCCCCTGCTTAGGCTTTGTGGG + Intronic
1070750086 10:78958899-78958921 TCTCTGTGTAGAGGCTGTGCTGG - Intergenic
1073193457 10:101668876-101668898 TCCCTCTGTTGCTGCTGTCTTGG - Intronic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1075559094 10:123455698-123455720 TCCCAATGATGAGGCTGTCTTGG + Intergenic
1076870146 10:133189008-133189030 TCACTGTGTTGAGAATGTGTGGG - Intronic
1077120834 11:907672-907694 TGCCTCTGCCCAGGCTGTGTGGG - Intronic
1077159397 11:1105843-1105865 TCCCTCTTCCTAGGCTGTGTGGG + Intergenic
1077262439 11:1629958-1629980 TCCGGCTGTGGAGGCTGTGGGGG + Exonic
1077529624 11:3089107-3089129 GCTCCCTGGTGAGGCTGTGTGGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082706026 11:56496409-56496431 TCCCTCTCATGAGACTGTCTTGG - Intergenic
1082873089 11:57961641-57961663 TCCCTCTATTGTGTCTGTGGTGG + Intergenic
1083764022 11:64833612-64833634 ACCTTCTGTAGAGGCTGTGTTGG + Exonic
1084425054 11:69080027-69080049 TCCCACAGCAGAGGCTGTGTCGG + Intronic
1086845738 11:91747695-91747717 TTCCTCTGTGGAGGCTGTGGGGG + Intergenic
1087290699 11:96317173-96317195 TCCTTCTGTGGAAGCTCTGTTGG - Intronic
1088821975 11:113464265-113464287 GCCCTCAGTTGAGGCTGGGAGGG - Intronic
1089295357 11:117464121-117464143 TCGCTCTGTTGGGGCGGGGTGGG + Intronic
1091252119 11:134153029-134153051 TTCCACTGCTGAGGCTGTGGGGG + Exonic
1093169630 12:15845288-15845310 TCCCACTGTTACGGTTGTGTTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096107209 12:49003351-49003373 TCCCTCTGTTGAGGTTGGATGGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097540483 12:60936481-60936503 TCTCTCTGTGGAGGCTCTTTCGG - Intergenic
1099627226 12:85090307-85090329 TGCCTCAGTAGAGACTGTGTCGG - Intronic
1099760309 12:86912492-86912514 AACCTCTGTTAAGGCAGTGTGGG + Intergenic
1102451933 12:113048450-113048472 TCCCCATGTTGTAGCTGTGTCGG - Intergenic
1102952904 12:117042037-117042059 TCCCCCTGCGGAAGCTGTGTGGG - Intronic
1104035774 12:125096253-125096275 CCCCTCTCTTAAGGCTGTGAAGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1111856825 13:93648177-93648199 TCCCTCTCTTGAGACTATGATGG + Intronic
1112462453 13:99614639-99614661 TGGCTCTGTTGCAGCTGTGTGGG + Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116715179 14:48417729-48417751 ACCCTCTGGTGAGGCTTTGCTGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120833163 14:89016111-89016133 TCCCTCTGTGGAGGGTGACTAGG + Intergenic
1121614938 14:95307424-95307446 GTCCTAGGTTGAGGCTGTGTAGG - Intronic
1122177425 14:99931397-99931419 ACCCTCTGCTGAGGCGCTGTTGG + Intronic
1124187172 15:27541374-27541396 TCTCTCTGTGAAGCCTGTGTGGG + Exonic
1125784308 15:42301711-42301733 TGCCTCTGTTTAGACTGTGAGGG - Intronic
1127031263 15:54866437-54866459 TCCCTCTGCTGAATGTGTGTTGG - Intergenic
1128061687 15:64739418-64739440 TGCCTCTTGTGAGGCTGTGCTGG - Intergenic
1128309265 15:66620380-66620402 TCCCTCAGTTCAGGATGTGGGGG + Intronic
1129124377 15:73425804-73425826 TCCCTCTGTCCTGGCAGTGTTGG - Intergenic
1130409978 15:83639289-83639311 TCATTATGTTGAGGCTGTGAGGG + Intergenic
1134349563 16:13424090-13424112 CCCCTCTCTTGGGACTGTGTGGG - Intergenic
1139736212 16:68991113-68991135 TCCCTCTGTTGAGGCTGTGTTGG + Intronic
1140875717 16:79150975-79150997 TCCCTGATTTGAGGCTTTGTAGG + Intronic
1141741192 16:85894207-85894229 TGCCTCTGTTGAGGTTAAGTCGG - Intergenic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1148678031 17:49456362-49456384 TCCCACTGCTGAGGCCATGTTGG - Intronic
1149481325 17:57005613-57005635 TCCCCCTTTTGATGCTGTGTGGG + Intronic
1149535322 17:57429221-57429243 TGCCTATTTGGAGGCTGTGTGGG - Intronic
1150118602 17:62578889-62578911 TCCCTTTCTTAAGGCTCTGTAGG - Intronic
1150478187 17:65489558-65489580 GCCCTCAGTTGAGGCCCTGTGGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152209539 17:78995728-78995750 TGCCACAGTTCAGGCTGTGTGGG + Intronic
1152338815 17:79713311-79713333 GCCCACTGTGGAGGGTGTGTGGG - Intergenic
1152577735 17:81150303-81150325 TCCCTCTGTCAACGCTGGGTGGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153419773 18:4892523-4892545 TCCCCCTGTTGAGTCTCTCTTGG + Intergenic
1155722148 18:29028878-29028900 CCTCACTGTTGAGGCAGTGTAGG - Intergenic
1160134570 18:76261601-76261623 CCCCTCTGCTGAGCCTGTGTGGG + Intergenic
1160298851 18:77660695-77660717 TCCCTCCGTTGATGCTTTATGGG + Intergenic
1160575209 18:79849198-79849220 CCCCTCTGGGGAGGCTGTGGAGG - Intergenic
1160933170 19:1580318-1580340 TCCATCTGTTCACCCTGTGTGGG + Intronic
1161221932 19:3121929-3121951 TCCCTCTGCAGAGGCTGGGAAGG + Exonic
1162528333 19:11220330-11220352 TCCCTCTGTTGAGACTTTTTAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
925090272 2:1149635-1149657 TCAATCTGTTGAGGGTGGGTAGG - Intronic
926364599 2:12121633-12121655 ATCCTCTGCTGAGGCAGTGTTGG - Intergenic
926750558 2:16195702-16195724 TCCTTCTGAAGAGGATGTGTTGG + Intergenic
927213498 2:20652815-20652837 ACCCTCTGATGGCGCTGTGTTGG - Intergenic
928057612 2:28073644-28073666 TCCATCAGTTGAGGCTGTTTTGG + Intronic
930879386 2:56254287-56254309 TTTCTCTGGTGATGCTGTGTCGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
936499116 2:113051686-113051708 CCCCTCTGATGTGGCTGGGTTGG + Intronic
937826187 2:126370982-126371004 TCACTCTGTTGATGGTGTCTTGG - Intergenic
940984210 2:160036645-160036667 TGCCTCTGCTGAGGCTGGGATGG + Intronic
941016611 2:160364547-160364569 TCCCTCTTTCGAGTCTGGGTGGG + Intronic
941306473 2:163875173-163875195 TCCCTCTGGAGTGGCTGTATGGG + Intergenic
942849581 2:180468033-180468055 TCCCTTTGCTGAGCCTGTGGGGG - Intergenic
943652099 2:190468401-190468423 TCCCTTTGTTGATTCAGTGTTGG + Intronic
946907344 2:224429638-224429660 TCCACCTCCTGAGGCTGTGTAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1169135096 20:3192434-3192456 TCTCTCAGTAGAGGCTGTGGGGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174881379 20:54283032-54283054 TCCCTCTCCTGAGATTGTGTGGG - Intergenic
1174988093 20:55478487-55478509 TCCCTTTTATGAGGCTATGTCGG - Intergenic
1176035026 20:63031971-63031993 TCCCTCTGATGGGGCTGCCTGGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1179261569 21:39762783-39762805 CCCCTCTGATGAGGGTTTGTAGG + Intronic
1179634006 21:42696030-42696052 TCCCTCTGTTGCTGATGTGATGG + Intronic
1180836509 22:18932339-18932361 TTCCTGTGTTGGGGCTGAGTCGG - Intronic
1181958397 22:26604981-26605003 TCCCTCTGCTGCAGCTTTGTTGG + Intronic
1183565991 22:38615792-38615814 TCACTATGTGGAGGCTGGGTTGG + Intronic
1183637685 22:39074688-39074710 CCCCTCTGATGAGGATGTATGGG + Intronic
1184916017 22:47569570-47569592 TGCCTCTGTTGAGGCTGCAGTGG + Intergenic
1203286601 22_KI270734v1_random:157638-157660 TTCCTGTGTTGGGGCTGAGTCGG - Intergenic
949814088 3:8040144-8040166 TCCCACTGGGGAGTCTGTGTTGG - Intergenic
950356715 3:12416829-12416851 TCGCTCCGTGGAGGCTGTGCAGG + Exonic
950545203 3:13634249-13634271 TGTCTCTGATGAGGCTGTGATGG + Intronic
951538476 3:23760975-23760997 TCCCTCTGCTCAGGCTGAGAGGG + Intergenic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
953172634 3:40521843-40521865 TGCTTCTGTTGAGGCTGTTCTGG + Intergenic
954573808 3:51663621-51663643 TCCCGCTATTGCTGCTGTGTTGG - Exonic
956086510 3:65616774-65616796 TACCTGTGTTCAGGTTGTGTTGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
962980799 3:140487719-140487741 TCCCTCTGTTTAGGCTGCCCTGG + Intronic
964415322 3:156442273-156442295 TTGCTCTCTAGAGGCTGTGTGGG - Intronic
964559137 3:157974174-157974196 TCACTCTGTGGAGGATGTGAAGG + Intergenic
965955396 3:174362868-174362890 TCCCTTTATTGAGGTTGTCTGGG + Intergenic
968873430 4:3253128-3253150 CCCCTCTGCTGAGGCTGGGCAGG + Intronic
969073263 4:4556941-4556963 TCCCTCTGTTGACCCTGTGTGGG - Intergenic
970561410 4:17285190-17285212 TCCCCCCATTGAGGCTGGGTGGG + Intergenic
972310149 4:37873920-37873942 TCTCTCTGTTGAGTGTGTGTGGG + Intergenic
973155908 4:46952035-46952057 TCTCTCTTTTGAGGGTGGGTTGG - Intronic
975333841 4:73152464-73152486 TCCTTCTGGTGAGGTTTTGTAGG - Intronic
975715426 4:77201081-77201103 TCAACCTGTAGAGGCTGTGTTGG - Intronic
977631890 4:99252293-99252315 TCCCTCCATGGAGGCTGTGAAGG - Intergenic
979837549 4:125390607-125390629 TGCCTCAGTTTATGCTGTGTAGG - Intronic
984821355 4:183885516-183885538 TCCATCTGTGGAGGCTGTGCAGG + Intronic
985940679 5:3133423-3133445 TCCCTCCGTTGAGGTTTTCTTGG + Intergenic
986333688 5:6736921-6736943 TCTCTCTGCTGAGACTGTGGCGG + Intronic
986518148 5:8584530-8584552 TCCCTCTCTTGAGGCTGAGTCGG + Intergenic
986618707 5:9647333-9647355 TGCTTCTGTGGAGGCTGTGCTGG - Intronic
987023110 5:13895368-13895390 TCTCCCTTTTTAGGCTGTGTAGG - Intronic
991426951 5:66501981-66502003 TCTTTCAGTTGAGGCTATGTGGG + Intergenic
1000994547 5:167945784-167945806 GCCCTCTGTTCAGGCTGAGCGGG + Intronic
1001137580 5:169115277-169115299 TCCCTGTGTTGAGTCTAGGTGGG - Intronic
1001274278 5:170339047-170339069 TCCCTCTAGTGAGGCAGTGGGGG + Intergenic
1001548277 5:172584114-172584136 TCCCTCTGTCCTGGCAGTGTTGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007187874 6:39987889-39987911 TCTCTCTGTTGAGGCTGGACAGG - Intergenic
1007782739 6:44263705-44263727 TCCCTCTGTTGGAGGTGTCTGGG - Intronic
1012245523 6:96922182-96922204 TCCCTCAGTTGTGGTAGTGTGGG - Intergenic
1013324002 6:109026248-109026270 TCCTTCAGTTGAGGATCTGTTGG - Intronic
1015014662 6:128397536-128397558 TCACTCTGTTTAGTCAGTGTTGG - Intronic
1015251715 6:131134719-131134741 GCCAGCTGTTGTGGCTGTGTAGG + Intergenic
1017080802 6:150666426-150666448 TCCCTCTGCTTCGGCTGTGTTGG + Intronic
1019134416 6:169899292-169899314 TCGCTCTGCTGAGGCCCTGTGGG + Intergenic
1019291566 7:253010-253032 CCCTTCTGTCCAGGCTGTGTCGG - Intronic
1019523259 7:1469861-1469883 TCCCTCTGTGGGAGCTGAGTTGG - Intergenic
1020796197 7:12681275-12681297 TCCCCCTATTGAGGCCCTGTTGG + Intergenic
1022576136 7:31498638-31498660 TCCCTCTGTAGGGGCCTTGTGGG + Intergenic
1023713663 7:43021448-43021470 TCCCACTCTGGAGGCTGAGTTGG + Intergenic
1024325995 7:48109648-48109670 TCCCTTTGTTGAAGCTGTCCAGG + Intergenic
1025992148 7:66504402-66504424 TCCCTCTGCAGAGGCTGGGAAGG - Intergenic
1027809108 7:82870297-82870319 TGCCTTTGTTGAAACTGTGTTGG - Intronic
1028684429 7:93575774-93575796 TAACTCTGTTTAGGCGGTGTTGG + Intergenic
1029062355 7:97811222-97811244 TCCCTCAGTTGTAGGTGTGTTGG - Intergenic
1032366556 7:131305543-131305565 TCTTTCTGTTCAGGCTTTGTGGG + Intronic
1034466739 7:151234131-151234153 TCCCTGTGTCGAGGCTGTAGGGG + Exonic
1034555878 7:151850088-151850110 CCCCTCGGTTTAGGCGGTGTGGG - Intronic
1036809415 8:11857399-11857421 TCACAGTGTGGAGGCTGTGTGGG - Intronic
1038035580 8:23683239-23683261 TCTCTCTGTTGCGGGTGGGTTGG - Intergenic
1038782552 8:30580589-30580611 CCCCACTGTCGGGGCTGTGTGGG - Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041944741 8:63428257-63428279 GCCCTCAGTTGAGGCTCTGCAGG + Intergenic
1042212130 8:66391522-66391544 TCCCCCTGTTCAGGATGTATTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047192807 8:122693666-122693688 TCTCTATGTTCAGGCTGAGTGGG - Intergenic
1049143705 8:140981468-140981490 TCCCACTGTTGAAGCTGGGCAGG + Intronic
1049620491 8:143596273-143596295 TGCCTCTGTAGAGGCTTTCTGGG - Intronic
1053186037 9:36017248-36017270 TTCCTCTGTGGGGGCTGTGATGG + Intergenic
1053791845 9:41692073-41692095 TCCCTCTGTTGTTACTGAGTTGG - Intergenic
1054153308 9:61622692-61622714 TCCCTCTGTTGTTACTGAGTTGG + Intergenic
1054180250 9:61904092-61904114 TCCCTCTGTTGTTACTGAGTTGG - Intergenic
1054473105 9:65553896-65553918 TCCCTCTGTTGTTACTGAGTTGG + Intergenic
1054657342 9:67677050-67677072 TCCCTCTGTTGTTACTGAGTTGG + Intergenic
1055145107 9:72924016-72924038 TACCTCTGTTGATCCTGTGAAGG + Exonic
1061008962 9:127944138-127944160 GCCATCTGTGGATGCTGTGTAGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186858287 X:13646739-13646761 TCCCTCTGCTGGGTCTGTTTTGG - Intergenic
1188207555 X:27379148-27379170 TCCATTTGCTGAGGCTGTCTGGG + Intergenic
1189554881 X:42132024-42132046 TTCATCTGTTGTGGGTGTGTAGG + Intergenic
1192081277 X:68050202-68050224 TCCCTATGTGGATGCTGAGTGGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195855128 X:109323285-109323307 TCACTCTGTTGAGGATCAGTTGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic