ID: 1139738112

View in Genome Browser
Species Human (GRCh38)
Location 16:69010553-69010575
Sequence CTGTGACAGCAGAGGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139738112 Original CRISPR CTGTGACAGCAGAGGCAAGG TGG (reversed) Intronic
900106555 1:983934-983956 TTGGGACAGGAGAGGCAGGGAGG + Intergenic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900397242 1:2458132-2458154 CTCTGACAGCACAGGGAAGGTGG + Intronic
901219821 1:7577169-7577191 CTGTGAGATCAGAGGCCTGGAGG + Intronic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902279825 1:15366336-15366358 CTGCGACAGCACAGGGAAGCAGG - Intronic
903767224 1:25742567-25742589 CAGTGCCAGTAGGGGCAAGGAGG + Intronic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
904814612 1:33186206-33186228 CTATGACAGCTGAGACAAGAAGG - Intergenic
905974667 1:42165700-42165722 CTGTATCTGCAGGGGCAAGGGGG - Intergenic
906117460 1:43366202-43366224 GTGTCCCAGCACAGGCAAGGAGG - Intronic
906541527 1:46590253-46590275 ATGTGACAGAGGAGGCAATGAGG + Intronic
906879460 1:49574752-49574774 CATGGACAGCAGAGGCAAAGTGG + Intronic
907280805 1:53346046-53346068 CTGGGGCTGCTGAGGCAAGGAGG + Intergenic
907367760 1:53976731-53976753 CTTTGAGAGCTGAGGCCAGGAGG - Intergenic
907774106 1:57496224-57496246 GTGTGAGTGCAGAGGCAGGGTGG - Intronic
908268583 1:62401713-62401735 CTCTGACAGCAGACACAAGGTGG + Intergenic
908616468 1:65928437-65928459 ATTGGACAGCAGAGGCAAAGTGG - Intronic
909065523 1:70931273-70931295 CTGTGACAGCAGCCAGAAGGGGG - Intronic
911762044 1:101627543-101627565 TGGTGAAAGCAGAAGCAAGGGGG - Intergenic
911853058 1:102842688-102842710 CTGTGGCAGCAGTGGCTAAGGGG + Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912519464 1:110235238-110235260 CTGGGCCAGCCGAGGCAAGGGGG + Intronic
914430439 1:147615944-147615966 CAGTGACTGCAAAGGAAAGGAGG + Intronic
914676363 1:149909963-149909985 CTGTGACTACAGAAGCCAGGTGG - Intronic
915073355 1:153290267-153290289 CTGTGACTGCTGAGGGAAAGAGG - Intergenic
915962217 1:160276403-160276425 CTGACATAGCAGAGGCCAGGTGG - Intergenic
916907870 1:169308301-169308323 CTGTGAGAGCAGGGACAATGGGG - Intronic
916932303 1:169591167-169591189 CTGTGCCAGTAGATGCAATGAGG - Intronic
917172057 1:172187637-172187659 ATGTGACAGCAGATGCATGGAGG + Intronic
917722965 1:177803516-177803538 CTGTGAGGCCAGAAGCAAGGTGG - Intergenic
917979741 1:180261358-180261380 TAATGACAGCAGAGGCAAAGGGG + Intronic
918077980 1:181184814-181184836 CTGGGAGTGCAGAGGCAATGCGG + Intergenic
918524534 1:185451182-185451204 CTGTGAAGGGAGAGGCTAGGGGG + Intergenic
919803332 1:201366445-201366467 CCGTGCCAGCATAGGCATGGCGG - Intronic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
920296473 1:204960378-204960400 CTGTTACAGCATAGGCAGAGTGG - Intronic
920339697 1:205268079-205268101 AGGTGTCAGCAGAGGCAGGGTGG + Intronic
923280231 1:232436576-232436598 CTGGGACAGGAGAGGAAAGCAGG + Intronic
923678474 1:236100259-236100281 CTGGGCCAGCAGAGGACAGGAGG - Intergenic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
1062816713 10:506354-506376 TTGGGACAGCAGCAGCAAGGGGG + Intronic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1065666977 10:28073268-28073290 TTGTGGCAGCAGTGGCAATGGGG - Intronic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1067066277 10:43105845-43105867 GGGTGACAGCAGAGGCCTGGTGG + Intronic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1067350024 10:45467032-45467054 CAGTGACAGCGGACCCAAGGAGG + Intronic
1067478950 10:46583306-46583328 CTCTGACAGCAGAGACAGGCCGG + Intronic
1067615788 10:47758495-47758517 CTCTGACAGCAGAGACAGGCCGG - Intergenic
1068671628 10:59729234-59729256 CTCTGATACCAGAAGCAAGGTGG + Intronic
1070268744 10:74931234-74931256 CAGGGACAGGAGAGGAAAGGAGG - Intronic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1072718751 10:97768139-97768161 CTGAGACACCAAAGGCAGGGTGG + Intronic
1073829427 10:107364529-107364551 CTGGAGTAGCAGAGGCAAGGTGG + Intergenic
1075071137 10:119320691-119320713 CCCTGAGAGCAGAGGCAGGGAGG + Intronic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1075747051 10:124735274-124735296 CGGTGGCAGCAGAGCCAAGACGG + Intronic
1076021436 10:127076944-127076966 CTTTGAGAACAGAGGCAGGGAGG + Intronic
1076220855 10:128732009-128732031 TTGGGAGAGCAGAGCCAAGGGGG + Intergenic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1076431657 10:130408002-130408024 ATGTGACAAGAGAGTCAAGGGGG - Intergenic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076628960 10:131841436-131841458 AGGTGACAGCAGAGGGGAGGGGG - Intergenic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077753270 11:4997730-4997752 CTGGTTCAGCACAGGCAAGGAGG + Intergenic
1077915668 11:6610097-6610119 CAGAGACAGGACAGGCAAGGGGG + Intronic
1079360719 11:19768185-19768207 TTGAGAAAGCAGAGGCAGGGAGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1080599362 11:33807551-33807573 CTGAGACAGCAAAGCCAAGCAGG - Intergenic
1080720977 11:34848339-34848361 CTGGAATAGCAGAGGCCAGGTGG + Intergenic
1081000476 11:37664234-37664256 AGGAGGCAGCAGAGGCAAGGTGG + Intergenic
1081625569 11:44653340-44653362 CTGGAAAAGCAGTGGCAAGGAGG - Intergenic
1081866248 11:46362114-46362136 CTGTGGGAGCAGAGCCGAGGGGG + Intronic
1082665104 11:55966370-55966392 CTGAATCAGCTGAGGCAAGGTGG + Intergenic
1084116323 11:67044937-67044959 CTGTGAGGGCAGAGTGAAGGGGG + Intronic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084811484 11:71614401-71614423 CTCTGACAGCGGGAGCAAGGTGG - Intergenic
1084934942 11:72581819-72581841 ATGTGACAGTAGAGGAAAGAGGG + Intronic
1085338732 11:75717725-75717747 CTGCCTCAGCAGGGGCAAGGAGG + Intergenic
1085527156 11:77170891-77170913 ATGTGACAGAAGAGGCACTGAGG + Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1086160769 11:83719565-83719587 CAGTGAGAAAAGAGGCAAGGTGG + Intronic
1090022675 11:123141528-123141550 CTGTCACAGCACAAGGAAGGAGG - Intronic
1090588158 11:128236568-128236590 CAGGGATAGCAGAGGCAAAGTGG + Intergenic
1090763012 11:129853695-129853717 CTGTGACAGCAGCGGCTGTGTGG - Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1090960163 11:131549200-131549222 GTTTGACAGCAGAAGCATGGAGG + Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1093445307 12:19250228-19250250 CAGTGACTACAGAGACAAGGTGG + Intronic
1093782645 12:23154872-23154894 CTGTGGCTGCTGAGGCCAGGTGG + Intergenic
1094101917 12:26773768-26773790 CTTTGACAGGAGAGGCAAAGAGG + Intronic
1094473382 12:30823354-30823376 CTGTGACAGCACAGGAGACGAGG - Intergenic
1094760877 12:33531303-33531325 CTGGAACAGCGGAGGCAAGGTGG - Intergenic
1095765722 12:45893239-45893261 CTGTGACAGCCTAGGCAAAGGGG - Intronic
1096089695 12:48890787-48890809 CAGTGAAAGCAGGGGCGAGGTGG + Intergenic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1100025344 12:90121740-90121762 CTGTGACAGTAGTGGCAGGTTGG + Intergenic
1102145006 12:110648462-110648484 TTGAAGCAGCAGAGGCAAGGGGG + Intronic
1102473984 12:113176778-113176800 CTGGGAAAGCAGAGGCAGAGAGG - Intronic
1104205519 12:126634819-126634841 CTGTAAGAGCAGAGGCCAGCTGG - Intergenic
1104275539 12:127323678-127323700 CCCTGAGAGCAGAGGCATGGTGG + Intergenic
1105415640 13:20209049-20209071 CTGTGGCTGAAGGGGCAAGGGGG - Intergenic
1108214898 13:48174552-48174574 CTGTTCCAGCAGAGGGAAGTGGG - Intergenic
1108286757 13:48916335-48916357 AAGTGACAGCAGAGGTAATGGGG + Intergenic
1108461641 13:50673044-50673066 GTGTGACAGAAGAGCCCAGGAGG - Intronic
1109057134 13:57565001-57565023 TGGTGACAGAAGAAGCAAGGGGG - Intergenic
1109460022 13:62644294-62644316 CTGGGGCAGCAGGGGCCAGGTGG + Intergenic
1109940058 13:69349987-69350009 ATGTGACAGGAGTGGCAATGAGG + Intergenic
1110291560 13:73813622-73813644 CTCTGGCAGCAGAAGCAAGGAGG - Intronic
1110394242 13:75011506-75011528 CTGTTTCACCAGAGGCATGGGGG + Intergenic
1110653545 13:77971167-77971189 CTCTGATACCAGAAGCAAGGTGG + Intergenic
1110687808 13:78395881-78395903 ATGTGAAATCAGAGCCAAGGTGG + Intergenic
1112099009 13:96166723-96166745 CTTTCAAAGAAGAGGCAAGGGGG + Intronic
1112994486 13:105556395-105556417 CTGTCACAAGAGAAGCAAGGTGG - Intergenic
1113160363 13:107373512-107373534 CTCCTACAGCAGATGCAAGGTGG + Intronic
1113368325 13:109699445-109699467 CTCTGAGAGCAAAGTCAAGGAGG + Intergenic
1113929904 13:113962695-113962717 CTGGGATAGCTGAGTCAAGGGGG + Intergenic
1114074243 14:19146331-19146353 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1114088025 14:19253644-19253666 CTGTCACAGAAGGAGCAAGGGGG - Intergenic
1117473900 14:56074319-56074341 CTGGGACAGCAGGGTGAAGGAGG - Intergenic
1117675638 14:58152284-58152306 CAGTGCCAGCAGAGCCAGGGCGG - Intronic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118093666 14:62511995-62512017 AGGTGATAGCAGAGGCTAGGGGG + Intergenic
1118247244 14:64123237-64123259 CTGTGACGGCAGTGATAAGGAGG - Intronic
1119318881 14:73717908-73717930 AGGTCAGAGCAGAGGCAAGGAGG + Exonic
1121618860 14:95332360-95332382 CTGAGCCAGCAGAGGAAAGAGGG + Intergenic
1122922871 14:104887163-104887185 CTGTGCCCGCAGAGGCTGGGGGG - Exonic
1124045499 15:26146337-26146359 TGGTGACAGCAGAAGGAAGGTGG - Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1126317437 15:47385489-47385511 CAGGGAAAGCAGAGGCCAGGTGG - Intronic
1126317980 15:47391204-47391226 CTCAGAGAGCAGAGGAAAGGAGG - Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1126705832 15:51404051-51404073 CTGTGCTAGCAGAGGCAACAGGG - Intronic
1127009549 15:54607804-54607826 CTGTCACAAGAAAGGCAAGGGGG + Intronic
1127382493 15:58442118-58442140 CTGAGAGATCAGAGGTAAGGAGG - Intronic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128063239 15:64748326-64748348 CTGGGACAGCAGCGGCCAAGTGG + Intronic
1128252770 15:66174487-66174509 ATGTTACAGGAGAGGCCAGGAGG - Intronic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1129966828 15:79743450-79743472 CTGTTAGAACAGAGGCAAGTGGG - Intergenic
1130028348 15:80289480-80289502 CTGTGACAGCAGAAATGAGGAGG + Intergenic
1130048348 15:80463365-80463387 CTGAGACTGTAGAGGCAGGGAGG - Intronic
1130966590 15:88701743-88701765 CTGTACCATCAAAGGCAAGGGGG - Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132590181 16:723162-723184 CTGTGAGGGGAGAGGAAAGGAGG + Intronic
1132638532 16:966130-966152 CTGGGAAGGCAGAGGCCAGGTGG + Intronic
1133172906 16:3992768-3992790 CTGTCAGGGCACAGGCAAGGTGG + Intronic
1134739371 16:16529150-16529172 CTGTTCCAGGAGGGGCAAGGTGG + Intergenic
1134804730 16:17114546-17114568 GTGTGAGAGCAGAGGAAAAGTGG + Intronic
1134822649 16:17259111-17259133 GTGTGACATCTCAGGCAAGGAGG - Exonic
1134928129 16:18183001-18183023 CTGTTCCAGGAGGGGCAAGGTGG - Intergenic
1135048974 16:19177135-19177157 TTGTGTAAGCAGGGGCAAGGGGG + Intronic
1135620151 16:23948878-23948900 CTCTGACAGGAGATGCATGGTGG - Intronic
1136286860 16:29249212-29249234 ATGGGACAGCAGAGGCAGAGTGG - Intergenic
1137390052 16:48073870-48073892 GTGTGACAGCAGATGAAAAGTGG - Intergenic
1138104556 16:54280896-54280918 AGGTGACAGCAGAGGTTAGGTGG - Intergenic
1138349228 16:56337718-56337740 CTGGGACAGCAGCGCCAAGCTGG + Intronic
1139339655 16:66259676-66259698 CTGTGCCAGCAGAGGCGAGAGGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1139923065 16:70471562-70471584 CTGGCAGAGCAGATGCAAGGAGG - Intronic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1140472046 16:75221248-75221270 CTGACATAGCAGAGGCATGGTGG + Intronic
1141172956 16:81702613-81702635 CTGTTGCAGCAAAGGAAAGGCGG + Exonic
1141873314 16:86804541-86804563 CTGGCAAGGCAGAGGCAAGGTGG + Intergenic
1142971934 17:3618025-3618047 CTCTGCCAGGAGAGGCAAGAGGG - Intronic
1143178904 17:4972372-4972394 CTGGGACACCAGAGGAAAGCTGG + Exonic
1144406601 17:14957997-14958019 TTGTGACAGCAGTGGGAAGAAGG - Intergenic
1145042035 17:19584173-19584195 TTGTGACAGCAGAAGCCACGGGG + Intergenic
1145357184 17:22169553-22169575 CTGTCAAAGGAGAGACAAGGTGG - Intergenic
1147685383 17:42283913-42283935 CTGTCCAAGCAGAGGCAAGGTGG + Intergenic
1147773995 17:42887587-42887609 CTGCGTAAGCAGAGGCAATGCGG + Intergenic
1147938710 17:44029734-44029756 CAGTGGCAGCGGAAGCAAGGAGG - Intergenic
1148695409 17:49555545-49555567 CTGGGACGGCAGAGCCAATGGGG + Intergenic
1149591161 17:57830932-57830954 GTGTGACATCAGGGACAAGGGGG - Intergenic
1150150707 17:62807280-62807302 CTGTGACTGCAGAGAAAAAGGGG + Intronic
1152701628 17:81822594-81822616 CTGTGACCGCAGACACCAGGAGG + Exonic
1153626048 18:7023299-7023321 CTGTGACTGCAGCGGCAACGTGG - Exonic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1156476822 18:37410747-37410769 CCGTCACCGCAGATGCAAGGAGG + Intronic
1157198685 18:45640951-45640973 CTGGGTGAGAAGAGGCAAGGAGG - Intronic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1160089193 18:75810009-75810031 CAGTCAAAGCAGAGGAAAGGCGG - Intergenic
1160360140 18:78268319-78268341 CGGTGACAGCAGTGGATAGGAGG - Intergenic
1160385830 18:78495701-78495723 CTGGGACTGCAGAGCCCAGGCGG + Intergenic
1160385851 18:78495785-78495807 CTGGGACTGCAGAGCCCAGGTGG + Intergenic
1161010088 19:1955726-1955748 CGGTGACAGCAGTGGCACGGGGG - Intronic
1161041614 19:2113472-2113494 CGGGGACAGCAGGGCCAAGGAGG + Intronic
1163327613 19:16615200-16615222 CTGAGACCAGAGAGGCAAGGAGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164961417 19:32434267-32434289 GTGTGAGAGCCGAGACAAGGAGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165339522 19:35200788-35200810 CTGTGACCACAGAGGGCAGGAGG - Intergenic
1166089898 19:40502105-40502127 CTGACACAGCAGAGGAAGGGGGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167098521 19:47389564-47389586 CTGTGACATCAGAGACAAATAGG + Intergenic
1168451132 19:56467397-56467419 GTGTGACAGCAGAGGAAAAATGG - Intronic
925202414 2:1979288-1979310 CCGTGGCAGCAGAGAGAAGGAGG + Intronic
925591063 2:5510545-5510567 CTGTGACAGAAGAGGAAGAGAGG + Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927138057 2:20111739-20111761 CCCTGACTGCACAGGCAAGGTGG - Intergenic
927484041 2:23476906-23476928 ATGTGCCTGCAGAGGCAAGGAGG + Intronic
927953569 2:27191215-27191237 GTGTGTCAGCAGAGGCTAGTGGG + Intergenic
927954714 2:27200507-27200529 GGGGGACAGCAGAGACAAGGAGG - Exonic
928628757 2:33168983-33169005 CTGTGGCAGCAGAGTTAGGGGGG + Intronic
928669408 2:33585350-33585372 CCGTGGCAGAAGAGGCAAGATGG - Exonic
929419690 2:41777986-41778008 CTATGCCAGCAGGGGCAAGGAGG + Intergenic
929946534 2:46376623-46376645 CTTTGATAGCAGTGGCAAGGGGG + Exonic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930760317 2:55027809-55027831 CGGTGACAGCATAGGAAAGAAGG + Intronic
930884986 2:56315047-56315069 CTGTGACAGATGAAGCAAAGGGG - Intronic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
931171615 2:59809374-59809396 TTCTGACAGCAGAGTCCAGGTGG - Intergenic
932499881 2:72174047-72174069 CTGTGAGAAAAGGGGCAAGGTGG + Intergenic
933390758 2:81663673-81663695 CTGTGAAAGCAGAAACAAGGGGG + Intergenic
933937386 2:87217534-87217556 CTGTGACAGCTTAGGCCTGGTGG + Intergenic
935221056 2:101013193-101013215 CTGTGACGGCAGAGGTTGGGAGG - Intronic
935237749 2:101152192-101152214 TTGTGGAAGCAGAGACAAGGTGG + Intronic
936055775 2:109260897-109260919 CTCTCACAGCAGAGGCAGGATGG - Intronic
936355754 2:111748268-111748290 CTGTGACAGCTTAGGCCTGGTGG - Intergenic
936876234 2:117193048-117193070 CTGTGGCAGCAGGGACTAGGGGG - Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
938488570 2:131742829-131742851 CTGTCACAGAAGGAGCAAGGGGG + Intronic
939463098 2:142522921-142522943 CTGTGAAAACAGATTCAAGGTGG - Intergenic
940596574 2:155801198-155801220 CTCTGACAGCTGATGCAAGCTGG + Intergenic
940843080 2:158607505-158607527 CTAGGACTGCAGAGGCAAAGGGG + Intronic
941145685 2:161841363-161841385 CTGTGTCAGCAGGGGCATGGTGG - Intronic
941162711 2:162053618-162053640 TGCTGACAGCAGAGACAAGGAGG - Intronic
947011912 2:225575267-225575289 CAGTGACAGCAGAGGCCTGAAGG - Intronic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
948674338 2:239588259-239588281 CTGTCACAGCAAAGGCCAGGGGG - Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170269465 20:14508019-14508041 CTGGGAAAGAAGAGGCATGGAGG + Intronic
1170892351 20:20386912-20386934 CTATGACAGCAGGGTCAGGGTGG + Intergenic
1171142299 20:22753815-22753837 GTGGGACTGCAGAGGGAAGGAGG + Intergenic
1171157469 20:22889639-22889661 CTGTGACTTCAGTGGGAAGGTGG - Intergenic
1171300837 20:24059095-24059117 CTGTTAATGCAGAGTCAAGGAGG + Intergenic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172798628 20:37560774-37560796 CTCTGACAGCTGGGGCAGGGAGG - Intergenic
1172978874 20:38926438-38926460 CTCGGACAGCAGAGCCATGGCGG - Exonic
1173397650 20:42695187-42695209 CTGTGAAAGCTCAGGCAAGGAGG - Intronic
1173476846 20:43365633-43365655 CAATGTCAGTAGAGGCAAGGTGG - Intergenic
1174303756 20:49600692-49600714 CTCTGAGAGCAGAGGGGAGGGGG - Intergenic
1174705831 20:52655157-52655179 ATGTGACAGTGGAGGCAAAGAGG - Intergenic
1175419454 20:58822177-58822199 ATGTCACAGCAAAGGCAAGGAGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179366773 21:40765981-40766003 CTGTGATAGCAGGGGTAAGAGGG - Intronic
1179403065 21:41102321-41102343 CTGTGACAGCTGCTGGAAGGTGG + Intergenic
1179409367 21:41150257-41150279 GTGTGAGAGCAGATGCAATGCGG + Intergenic
1180289887 22:10839271-10839293 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1180492684 22:15868693-15868715 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1180661710 22:17473234-17473256 CTGGGACAGAAGAGGAAGGGGGG - Intronic
1181273316 22:21673427-21673449 CTGGGACAGCAGGGGCCATGAGG - Intronic
1181600668 22:23949913-23949935 CTGGGACAGCAGACCCATGGCGG - Intergenic
1181607844 22:23991409-23991431 CTGGGACAGCAGACCCATGGCGG + Intergenic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182509181 22:30806813-30806835 CTGTGCCAGCAGGGGCCAGATGG - Intronic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1183316769 22:37141368-37141390 CTGAGCCTGCGGAGGCAAGGGGG - Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184334252 22:43844134-43844156 GTGTGAGAGCAGAGGAAAAGCGG + Intronic
1185297290 22:50060690-50060712 CTGTCACAGCAGCGGCCACGTGG + Exonic
1185355568 22:50367535-50367557 CTGTGACAGCATAGGAGAGACGG - Intronic
949249370 3:1964289-1964311 ATGTGCCTGCAGAAGCAAGGTGG - Intergenic
949875127 3:8621495-8621517 CTGTCAGAGGAGAGGCCAGGGGG + Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
950972313 3:17201590-17201612 GTGTTACAGCAGAGGCAGGATGG + Intronic
952815332 3:37442554-37442576 TTCTGACTGCAAAGGCAAGGTGG - Intergenic
956127778 3:66027458-66027480 CCTTGACAGCAGGGGCATGGTGG - Intronic
957223920 3:77417995-77418017 CTCTGACAGCAGATAAAAGGAGG + Intronic
957247761 3:77735074-77735096 AAGGGACAGCAGAGGCAAAGTGG - Intergenic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
960033915 3:113083983-113084005 CTGTGACAGGCCAGGCAAGGTGG - Intergenic
961141843 3:124562727-124562749 GTGTGAGAGCAGAGGTAAGGAGG - Intronic
961186333 3:124918331-124918353 CTGTGAGCTCAGAGGCATGGAGG - Intronic
961382634 3:126505692-126505714 GTGTGATAGCAGAGGTAAGCTGG - Exonic
961489111 3:127240236-127240258 CTGTGAAATAAGAGGTAAGGTGG - Intergenic
961667113 3:128499323-128499345 GTGTGACAGCTCAGGCCAGGGGG + Intergenic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
963852776 3:150224684-150224706 CTGAACCATCAGAGGCAAGGTGG + Intergenic
967072171 3:185971722-185971744 CTTTGACAGCAAGGGCGAGGTGG + Intergenic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
968563902 4:1299308-1299330 CTGTGACAACAGAGGCATCAAGG - Intronic
968726611 4:2250823-2250845 CTGGGGCAGCAGACGCCAGGAGG + Intronic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969197943 4:5577967-5577989 CTGTGTCATCAGAGGAACGGTGG + Intronic
969734167 4:8975849-8975871 CTCTGACAGCGGGAGCAAGGTGG - Intergenic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
977623469 4:99163955-99163977 ATGAAACAGCAGAGGCCAGGAGG - Intergenic
978309965 4:107376612-107376634 CTGAAACAGCAGGGGTAAGGAGG - Intergenic
978991294 4:115085006-115085028 CTGTGAAAGCAGATGTGAGGGGG + Intronic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
982301252 4:153881375-153881397 CTGTGAAAGCAGAGAATAGGTGG + Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985354449 4:189102766-189102788 CTGTGGGAGGAGAGCCAAGGAGG - Intergenic
986380795 5:7183586-7183608 CTGGAACACCAGAGGCCAGGAGG + Intergenic
987059225 5:14226104-14226126 CTCACACAGGAGAGGCAAGGAGG + Intronic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990335507 5:54768447-54768469 CTGTCACAGCAGCTGCAAGTGGG - Intergenic
990471976 5:56123901-56123923 CTGTGACAGCTGAGGCAGATTGG - Intronic
991230789 5:64330944-64330966 CTGAGCCTGCAGGGGCAAGGGGG - Intronic
991489303 5:67166759-67166781 GTGTGACTCCAGAGGCAGGGTGG - Exonic
992640443 5:78764260-78764282 CTGTGAAAGCAGGAGCCAGGTGG - Intronic
993068146 5:83126763-83126785 CTGTGCCAGCAAAGCCATGGGGG + Intronic
995658084 5:114449637-114449659 CTCTGAGACAAGAGGCAAGGAGG - Intronic
996421296 5:123265853-123265875 CTGAGACAGCAGACGTAAGTTGG - Intergenic
997942223 5:138168512-138168534 CTCTGACAGCAGAGGGGAGGGGG + Intronic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998728054 5:145041734-145041756 CTGTGACAGCAGAGACCTTGTGG - Intergenic
999030726 5:148288211-148288233 CCGAGTCAGCAGGGGCAAGGAGG - Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999462688 5:151771026-151771048 TTGTGGCAGCTGAGGCACGGTGG - Intronic
999957549 5:156718986-156719008 CTGTGACATCAAGGGTAAGGAGG - Intronic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001109689 5:168885410-168885432 CGATGACAGCAGAGGTCAGGCGG + Intronic
1001940738 5:175737699-175737721 CTGTGACGGCAGGGGAGAGGAGG + Intergenic
1002297724 5:178240613-178240635 CGGGGACAGCAGGGGCAGGGTGG - Intronic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1003945306 6:11070127-11070149 ATGAGAGAGCAGAGGAAAGGGGG + Intergenic
1004291547 6:14372140-14372162 CAGCGAGGGCAGAGGCAAGGAGG + Intergenic
1004602016 6:17159289-17159311 CTGTGTCCTCAGAGCCAAGGAGG + Intergenic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1006361311 6:33588853-33588875 CTGTGCCAGCCGAGGGGAGGTGG + Intergenic
1006419837 6:33925985-33926007 CTGAGATAGCAGAGGCAGGGAGG - Intergenic
1006573325 6:35023504-35023526 CTGTGGCAGTAGAGTCATGGCGG + Intronic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1008467454 6:51846688-51846710 CTGTGACTGCAGAGTCACAGAGG - Intronic
1009492196 6:64304861-64304883 CAGTGAAAGCAGTGGTAAGGGGG + Intronic
1009890283 6:69672356-69672378 TTGTAACAGCAGATGCAAGAAGG - Intergenic
1009991306 6:70846244-70846266 TGGTGACAGCAGAGCCATGGCGG - Intronic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1011217301 6:85018599-85018621 CTGAGACCGCAGAGGCAGAGTGG - Intergenic
1011577522 6:88819323-88819345 CAGTAACAGGAAAGGCAAGGCGG + Intronic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1013158661 6:107520357-107520379 CTTTTACAGCAGAGGAAATGAGG + Intronic
1013866379 6:114701939-114701961 ATGGGACAGCAGAGGAAAGCTGG - Intergenic
1014796462 6:125730532-125730554 CTGTAACAGCAAAGTCATGGAGG + Intergenic
1015890771 6:137967813-137967835 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1015890788 6:137967883-137967905 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1016378722 6:143450869-143450891 CTGTCACCGGAGCGGCAAGGGGG - Intronic
1017115039 6:150968136-150968158 CAATGACAGCAGAGGGACGGGGG - Intronic
1017513261 6:155132940-155132962 ACTTGACAGGAGAGGCAAGGAGG - Intronic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1017872969 6:158502333-158502355 CTTCGACAGCAGTGGCAACGTGG + Exonic
1017977347 6:159369844-159369866 CTGAAACATCACAGGCAAGGTGG - Intergenic
1018055428 6:160048147-160048169 CTGTCAGTGCAGAGGCACGGGGG + Intronic
1018309314 6:162491960-162491982 CAGAGACAGCAGAGGCACCGAGG - Intronic
1018441232 6:163815278-163815300 CAGTCACTGCAGAGGCAATGAGG + Intergenic
1018875342 6:167817596-167817618 CTGTGACAACTGAAGCCAGGTGG + Intergenic
1018931269 6:168241905-168241927 CTGTGACAACAGACCCAAGACGG - Intergenic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019426568 7:980230-980252 CCCTGACATCAGAGGCAGGGTGG - Intergenic
1020290367 7:6718281-6718303 CTGGGACAGCAGAGGAAGGTGGG - Intergenic
1022598863 7:31738031-31738053 GGGTGACAGCAGCGGAAAGGTGG - Intergenic
1022817635 7:33928782-33928804 ACGTGCCAGCAGAGGCAATGGGG - Intronic
1022844737 7:34198608-34198630 CAGTCACAGCAGTGGCAAAGCGG + Intergenic
1023656295 7:42424855-42424877 CAGTGATGGCAGAGTCAAGGGGG - Intergenic
1023932062 7:44712137-44712159 CTGTGACAAATGAGGCAATGCGG - Intergenic
1024342417 7:48280863-48280885 GTTTGACATCAGAAGCAAGGAGG - Intronic
1024868334 7:53930943-53930965 CCCTTACAGCATAGGCAAGGTGG - Intergenic
1027344691 7:77245791-77245813 ATGTGACAGAAGAGGCATGTAGG + Intronic
1030625639 7:111842830-111842852 CTTTGACAGCTGAGGCAAGAGGG - Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031294350 7:119983336-119983358 CACTGACAGCAGTGGCATGGTGG - Intergenic
1031362768 7:120866903-120866925 CGGTGAAAGCAGGAGCAAGGAGG - Intergenic
1032491605 7:132328368-132328390 ATGTCACAGCAGAGACATGGTGG - Intronic
1032689177 7:134265677-134265699 CTGTCCCAGCAGAGAGAAGGAGG - Intergenic
1033615892 7:143013724-143013746 CTAGAACAGCAGAGGCCAGGTGG - Intergenic
1033653167 7:143356897-143356919 CTGTGGCCGGAGAGGCAATGAGG + Exonic
1034561925 7:151885881-151885903 CTGGGACGGCAGGGGCAGGGAGG + Intergenic
1035795636 8:2354149-2354171 CTGGGACAGCAGAGGCTAGATGG + Intergenic
1036583697 8:10102745-10102767 CTGTGCTAGCAGGGGAAAGGGGG + Intronic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1037360726 8:18070731-18070753 AAGTGACAGCAGAGGAAAAGAGG - Intronic
1038779020 8:30555385-30555407 CTGTGACATCTAAGGCAACGTGG - Intronic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1040106292 8:43544186-43544208 CTGAGAGAGGAGAGGAAAGGAGG - Intergenic
1040478423 8:47801840-47801862 CTGTCACATCATGGGCAAGGAGG - Intronic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1041113154 8:54506689-54506711 CCTGGACAGCAGAGGCAGGGCGG - Intergenic
1041193056 8:55372905-55372927 CTGTCAGAGCAGATGCAAGGGGG + Intronic
1042968184 8:74378632-74378654 CTGAGCTAGCAGAGGCCAGGTGG + Intronic
1043012809 8:74901429-74901451 CTGTGAAAGAACAGACAAGGAGG - Intergenic
1043400888 8:79883128-79883150 GTGTGGAAGGAGAGGCAAGGAGG - Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044966506 8:97579126-97579148 ATGTGGCATCAGAGGCCAGGTGG - Intergenic
1045272107 8:100670826-100670848 CTCTGCCAGCAGAGGCCAGGAGG - Intergenic
1046110038 8:109711873-109711895 CTGTCACAGCAGTGGCCAGATGG - Intergenic
1048160320 8:132014585-132014607 ATGAAAAAGCAGAGGCAAGGTGG + Intergenic
1048278360 8:133084782-133084804 CTGTGCCTCCACAGGCAAGGGGG + Intronic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1048852303 8:138656779-138656801 CCCAGGCAGCAGAGGCAAGGTGG + Intronic
1049215211 8:141404661-141404683 CTGAGTCAGCAGAGGCTTGGGGG + Intronic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049325506 8:142019516-142019538 CTGGGACACCAAGGGCAAGGGGG - Intergenic
1049378238 8:142299183-142299205 TTGCCACAGCAGAGGCAGGGAGG + Intronic
1049558172 8:143294007-143294029 CTGTGGCAGCAGAGGAGAAGCGG - Intronic
1050221623 9:3397445-3397467 CTGTGACAACAGATGCCAAGAGG - Intronic
1051123015 9:13773022-13773044 CTTTGCCAGCAGACGCAAGCAGG - Intergenic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1056365111 9:85897126-85897148 ATGTGCCAGCAGAGTCAAGTTGG - Intergenic
1057125188 9:92611152-92611174 GTGTGACAGCAAGGGCAAGAGGG + Intronic
1057216632 9:93232244-93232266 ATGTGACATCTGGGGCAAGGTGG + Intronic
1057767577 9:97935503-97935525 CAGTGTCAGCAGTGCCAAGGTGG + Intronic
1057927954 9:99169761-99169783 GTGTGAGAGCAGAGGCTAAGTGG + Intergenic
1059984878 9:119812172-119812194 GTGTGAGGGCAGAGGCAGGGAGG + Intergenic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060348388 9:122836746-122836768 TGGTGAGAGCAGAAGCAAGGTGG + Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061593414 9:131613463-131613485 CTCTGACTGCAGAGGCAGGAAGG + Intronic
1061715434 9:132515666-132515688 GGGTGCCAGGAGAGGCAAGGAGG - Intronic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1062514677 9:136926682-136926704 CTGTGAGAGGAGAGGCCAGGAGG - Intronic
1185673161 X:1827307-1827329 CTGTTACAGGTGAGGCCAGGTGG - Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1188629315 X:32332592-32332614 CTGTGAAAGCAGCAGCAAAGGGG + Intronic
1188962256 X:36507142-36507164 CTGTGACAACAGCACCAAGGAGG + Intergenic
1190550025 X:51570417-51570439 CTGTTAGAGCAGAGGAAAGATGG + Intergenic
1191024066 X:55894632-55894654 CTGTCACAGCACCAGCAAGGTGG - Intergenic
1192469999 X:71390257-71390279 CAGTGACAGGAGATGAAAGGAGG - Intronic
1193497816 X:82236362-82236384 CTCTGAAACCAGAGACAAGGAGG - Intergenic
1196174641 X:112627449-112627471 CTCTGAGAGCAGAGGTAATGAGG + Intergenic
1197202055 X:123756869-123756891 CTGAAAGAGCAGAGGCCAGGTGG + Intergenic
1197609631 X:128623617-128623639 CTGAGCCTGCAGAGGCAGGGTGG + Intergenic
1197873853 X:131084046-131084068 CTGTGCCCTCAGAGGCAGGGGGG + Intronic
1197971370 X:132118707-132118729 CTGAGACAGGAGAGACAAGCAGG - Intronic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198186560 X:134259112-134259134 CCAAGACAGCAGAGGCCAGGTGG - Intergenic
1200067884 X:153513220-153513242 ATGTGATTGCAGAGGCAAAGTGG - Intergenic
1200153928 X:153965270-153965292 GTGTGGCAGCAGGGGCAGGGAGG - Intronic
1201578123 Y:15482066-15482088 TTGTGACATCAGAAGCAAGATGG + Intergenic