ID: 1139738232

View in Genome Browser
Species Human (GRCh38)
Location 16:69011911-69011933
Sequence CACAATGCCAGAATTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139738231_1139738232 7 Left 1139738231 16:69011881-69011903 CCAAATTCTAATTTGTTAAAAGA 0: 1
1: 0
2: 3
3: 55
4: 658
Right 1139738232 16:69011911-69011933 CACAATGCCAGAATTGATATAGG 0: 1
1: 0
2: 1
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139738232 Original CRISPR CACAATGCCAGAATTGATAT AGG Intronic
902851221 1:19158783-19158805 TAAAATGCCAGAATATATATGGG + Intronic
903006582 1:20302829-20302851 CACAGTGCCAGAAGAGATAGCGG + Intronic
908706128 1:66956925-66956947 CACATTGCTACAATGGATATGGG - Intronic
909917470 1:81337529-81337551 CATAATGCTAGAATTGAAACAGG - Intronic
917043933 1:170835671-170835693 CTCAATTTCAGAATTGTTATTGG - Intergenic
917233390 1:172862883-172862905 CAAAATGTCAGAAGTTATATAGG + Intergenic
918150480 1:181794304-181794326 CAAAATGCCAGAATTTAAAACGG + Intronic
921262720 1:213397978-213398000 CACAATGACAAAATTGACAGGGG + Intergenic
923357467 1:233173788-233173810 CAAAATGTCTGAATTGATAATGG - Intronic
924883994 1:248192426-248192448 CTCAATTTCAGAATTGTTATTGG - Intergenic
1063147642 10:3310445-3310467 GACAAGGCCAGAATTGTTAAAGG + Intergenic
1066700476 10:38122334-38122356 CACAATCCTAAAATTTATATGGG + Exonic
1071303235 10:84273604-84273626 CACAATGCCAAAATATAAATTGG - Intergenic
1071930278 10:90461993-90462015 CACAAAGCCAGACTTCAAATTGG + Intergenic
1074949936 10:118323359-118323381 CACATTTCCAGAATTGTTAAAGG + Intronic
1079452284 11:20607285-20607307 AACAATGCCAGAGGTGATCTTGG - Intronic
1081059536 11:38456309-38456331 CAGAAAGCCAGAATTGAGTTTGG - Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1081292234 11:41340860-41340882 AAAAATCCCAGAATTGAAATAGG - Intronic
1085224612 11:74908174-74908196 CACAATGCCAGAAATGCATTAGG - Intronic
1087469217 11:98550171-98550193 AACAATCCTAGAATTCATATGGG + Intergenic
1088904935 11:114148131-114148153 CACAATGTCAGAAATGACAAAGG - Intronic
1098706448 12:73696867-73696889 TATAATGCCACAATTAATATTGG - Intergenic
1099834079 12:87885433-87885455 GACAATCCCAGAATTCATATAGG + Intergenic
1101729029 12:107411489-107411511 AACATTGCCAGAATTAATGTGGG + Intronic
1102743470 12:115229125-115229147 CAGAATCCCAGAATGGAAATGGG + Intergenic
1106754465 13:32809109-32809131 CACAATGGAAGTATTGATACAGG - Intergenic
1108185398 13:47883745-47883767 CAAAATGACATAATAGATATTGG - Intergenic
1108406988 13:50114405-50114427 CACATTGGTAGATTTGATATGGG - Intronic
1111354795 13:87084423-87084445 CACAATGTCAGAAGAGGTATAGG - Intergenic
1114057278 14:18982507-18982529 CACAATGCCATAATGCAGATTGG + Intronic
1114105268 14:19419239-19419261 CACAATGCCATAATGCAGATTGG - Intronic
1115312920 14:31997218-31997240 CAGAATTGCAGAATTGAAATGGG + Intergenic
1115820737 14:37210203-37210225 CACAGTGTCAGAATTGAATTGGG - Intronic
1118533591 14:66733020-66733042 CACAATTCAAGATGTGATATGGG - Intronic
1121167804 14:91824085-91824107 CCCAATGCCAGAAATGATATGGG + Intronic
1124390122 15:29247629-29247651 AACACTGGCAGAGTTGATATTGG + Intronic
1126354508 15:47780993-47781015 CCCTATGCCAGAATTGATGGTGG + Intergenic
1128602547 15:69010052-69010074 TACAAAGCCAGAATTGAACTAGG - Intronic
1128819853 15:70642110-70642132 CCCAAGGCCAGAATTGGTGTTGG - Intergenic
1130929595 15:88413934-88413956 CACAAAGCCGGAATTGACACAGG - Intergenic
1135836892 16:25834369-25834391 CTCAATGCCAGAATTTCTCTAGG - Intronic
1136038661 16:27560717-27560739 CACAATGCCTGACTAGCTATGGG - Intronic
1139268369 16:65660280-65660302 CACAATCCCAGAATTGAAGCGGG - Intergenic
1139738232 16:69011911-69011933 CACAATGCCAGAATTGATATAGG + Intronic
1140156523 16:72433923-72433945 GACAATGCTAGAACTGAAATTGG + Intergenic
1142718180 17:1758935-1758957 CACAAGTCTAGAATTGAAATGGG + Intergenic
1147027385 17:37599346-37599368 GATAAAGCTAGAATTGATATTGG + Intronic
1150194804 17:63286260-63286282 CACAATGCAAGAAATGTTAAAGG - Intronic
1153047284 18:868222-868244 CGTAATATCAGAATTGATATTGG + Intergenic
1153502371 18:5762395-5762417 TACAATGCCAGACTTGATGTGGG + Intergenic
1156303714 18:35857552-35857574 CCCAGTGCCAGAATGCATATTGG + Intergenic
1156778152 18:40818966-40818988 CACACTACCACATTTGATATAGG - Intergenic
1156803600 18:41148987-41149009 CACAATGAAAGAATTGTTTTGGG + Intergenic
1156981721 18:43297572-43297594 TACAATGCCAGAAATGAGCTTGG - Intergenic
1160348549 18:78154342-78154364 CACAATATTAGAATGGATATTGG + Intergenic
1160484808 18:79280503-79280525 CATAAAGCAAGAATTGATACAGG + Intronic
926584060 2:14665945-14665967 CAAAATGCCAGAATTGACAATGG - Intergenic
927283489 2:21332687-21332709 AAGAAGGCCAGAAATGATATGGG + Intergenic
940131808 2:150390168-150390190 GATAATGCCATAATTGACATAGG - Intergenic
940381829 2:153024027-153024049 CAAAATGCCTGAAATGATTTAGG + Intergenic
941198315 2:162477710-162477732 CCAAATGCCATAATTGATTTAGG + Intronic
941815723 2:169794051-169794073 CACAATGACAAAATTGGTTTAGG + Intronic
942238621 2:173938136-173938158 CACAATTACAGAATTGGTAGAGG + Intronic
1168843957 20:929364-929386 CACCACCCCAGCATTGATATGGG - Intergenic
1170903972 20:20494743-20494765 CAAAATGCTAGATGTGATATGGG + Intronic
1172919523 20:38469486-38469508 CACCATGCCAGTATTGTTTTAGG + Intergenic
1173178236 20:40781618-40781640 GACAATGCCAGAGTGGATAATGG + Intergenic
1174559500 20:51420141-51420163 AACAATGATAGAATTCATATAGG - Intronic
1176980663 21:15377210-15377232 CCCAAAGCCAGAAATGATAACGG + Intergenic
1177288806 21:19083902-19083924 AACAATTCCAGAATTGATTCAGG - Intergenic
1180475768 22:15705119-15705141 CACAATGCCATAATGCAGATTGG + Intronic
1182790683 22:32950337-32950359 CACAATGCCACATTTGCTAGTGG + Intronic
950786806 3:15443856-15443878 AACAATGCCAGAATTGGGAGGGG - Intronic
951491584 3:23275444-23275466 CACAATGCAGGATTTGATCTAGG - Intronic
953317831 3:41945005-41945027 CATAATTCCAGAATTGATTATGG + Intronic
955987931 3:64594514-64594536 CCCAATGCCATAATTGAGTTTGG - Intronic
957640209 3:82843967-82843989 CACAATGAAAAAAATGATATAGG + Intergenic
958456058 3:94332784-94332806 AACAATCTCAGAATTGATTTAGG - Intergenic
958931557 3:100213104-100213126 AACAATGCTAGAACTTATATTGG + Intergenic
962148333 3:132865444-132865466 CAGAATGACAGAACTGATAAAGG - Intergenic
963052713 3:141155844-141155866 AACAAGGTCAGAATTAATATGGG - Intergenic
968858117 4:3144166-3144188 CACAATCCCAAAATTTATCTTGG - Intronic
970286997 4:14528928-14528950 CATAATGACAGATTTGAAATTGG + Intergenic
971022495 4:22551398-22551420 CACAAAGCCAGTTTTGCTATAGG + Intergenic
973156419 4:46959894-46959916 CTCAATGCCAGGATTGCTGTAGG - Intronic
974573467 4:63686644-63686666 CACAATTCCATCATTGACATGGG + Intergenic
976070929 4:81238924-81238946 GAGATTTCCAGAATTGATATTGG + Intergenic
976510728 4:85906448-85906470 CAAAATGTCAGAATTAAGATGGG - Intronic
978258103 4:106717386-106717408 TTCAGTGCCAGAATTGATGTTGG - Intergenic
978763108 4:112376819-112376841 GACATTGCCAGAATAGATAGTGG - Intronic
979215016 4:118152932-118152954 CAGAAGGCCAGGACTGATATGGG - Intronic
979736701 4:124095139-124095161 CAAAATCCCAGAATAGAAATAGG + Intergenic
979796918 4:124857506-124857528 CACAGGGTCAAAATTGATATTGG - Intergenic
980555835 4:134403050-134403072 CACAATTCCAGTAGTGTTATCGG + Intergenic
982735164 4:158998537-158998559 CACAAAGGCAGAAATGATATGGG - Intronic
983465937 4:168089924-168089946 GACAATGCCAGAATGAACATGGG - Intergenic
983860108 4:172695277-172695299 AACAATGACAGAAATGATGTAGG + Intronic
985240994 4:187930553-187930575 CACAATGCCACCATTAAAATGGG + Intergenic
986001268 5:3632910-3632932 CACAATGCCTGGAATGAAATTGG + Intergenic
986463169 5:7994110-7994132 CACCATGCCAAAAGTGATTTAGG - Intergenic
988136659 5:27180477-27180499 ATAAATGCCAGAACTGATATTGG + Intergenic
989350273 5:40478178-40478200 CACAATTCAAGAATAAATATGGG + Intergenic
990207885 5:53449794-53449816 GACAAAGCCAGAATCAATATGGG - Intergenic
994953792 5:106500196-106500218 GACAATCCTAAAATTGATATGGG - Intergenic
997419438 5:133754460-133754482 CACAATGGCAGAAGTTATAATGG + Intergenic
998488972 5:142529301-142529323 CACAGTGGCACAATTCATATAGG + Intergenic
1000397336 5:160789735-160789757 CACATTGGCAGAATAGATAGTGG + Intronic
1001803993 5:174567801-174567823 AACAAGGGCAGAATGGATATTGG + Intergenic
1002997139 6:2297492-2297514 CAAAGTGCAAGAATTGATACTGG + Intergenic
1005679910 6:28196497-28196519 CAGAATGGCAGAATTGAGAGGGG - Intergenic
1012779798 6:103543667-103543689 CTGAATGCCAAAATTGATATAGG - Intergenic
1013576862 6:111492230-111492252 TACATATCCAGAATTGATATTGG + Intergenic
1013943368 6:115692546-115692568 CACTATGTAAGTATTGATATTGG - Intergenic
1015688908 6:135898149-135898171 CAAAATGCCAGTTTTGATCTGGG - Intronic
1021133267 7:16936333-16936355 CCCAATGCCAGAATGGAGAGGGG - Intergenic
1021366354 7:19784217-19784239 TACAATGGCTGAAATGATATAGG + Intergenic
1021378868 7:19941855-19941877 CACATTGTCAGTATTGAAATTGG - Intergenic
1022592909 7:31683163-31683185 CTCAAAGACAGTATTGATATTGG - Intergenic
1024801215 7:53082167-53082189 CAAAATCAGAGAATTGATATTGG - Intergenic
1026574063 7:71557223-71557245 CATAGTGCCTGCATTGATATAGG + Intronic
1027990864 7:85359689-85359711 TACAATTCAAGAATTGATTTGGG - Intergenic
1029055585 7:97737919-97737941 TCCATTTCCAGAATTGATATAGG + Intronic
1030772417 7:113490705-113490727 GACAATGCCAGCAGTGATAAGGG - Intergenic
1031194295 7:118592022-118592044 TACAATGCCAGATGAGATATGGG - Intergenic
1032773144 7:135080118-135080140 CACAATACCATAAATCATATAGG + Intronic
1032907790 7:136391613-136391635 AACAATGCCAGAACTGATAAGGG - Intergenic
1035768888 8:2130593-2130615 CACTATGTCAAAATTGAAATAGG - Intronic
1036224036 8:6943327-6943349 CACAATGCCCGTATAGACATAGG - Intergenic
1038610213 8:29054052-29054074 CAAAATGGCAGAATTGAACTTGG - Intronic
1040911096 8:52519946-52519968 CCCAATTCCAGAATCCATATTGG - Intergenic
1043496106 8:80802149-80802171 CTCAATTTCAGAATTGTTATTGG - Intronic
1046205342 8:110987494-110987516 GACAATGCCTTAATTGCTATGGG + Intergenic
1047104016 8:121713304-121713326 GAAAAGGGCAGAATTGATATAGG + Intergenic
1050800574 9:9607655-9607677 CACAATGTCAGGAATGATAAGGG - Intronic
1051195594 9:14560194-14560216 TACAATGGCAGAGTTCATATGGG - Intergenic
1052438007 9:28455420-28455442 CACCATGCCAGTATTTAGATAGG - Intronic
1056083005 9:83116398-83116420 CACAATGCAAGAAATAATTTGGG - Intergenic
1057692463 9:97297339-97297361 CATGATGCCAGGATTGATTTTGG - Intergenic
1059509301 9:114829134-114829156 GACAATACCAGCAATGATATAGG + Intergenic
1186162059 X:6787880-6787902 CAAAATGTCAGAAATTATATGGG - Intergenic
1186917610 X:14240349-14240371 TACAATTCCAGATGTGATATAGG - Intergenic
1188255605 X:27959209-27959231 CAAAATGCCAAAACTGAGATGGG - Intergenic
1191599593 X:62988099-62988121 TACAATTCCAGAATAGATTTGGG + Intergenic
1194970582 X:100338750-100338772 CACACTGCCAAAATTTCTATGGG - Intronic