ID: 1139738836

View in Genome Browser
Species Human (GRCh38)
Location 16:69017307-69017329
Sequence TGCCACTGTGCTGGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1393
Summary {0: 1, 1: 1, 2: 19, 3: 178, 4: 1194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139738836 Original CRISPR TGCCACTGTGCTGGGCCCTG GGG (reversed) Intronic
900118110 1:1037100-1037122 TCCCAGTGGGCTGGGTCCTGGGG + Intronic
900138814 1:1130469-1130491 TGTCACTCTGCTGGGCGCCGGGG + Intergenic
900267056 1:1762928-1762950 AGCCTCAGTGCTGGACCCTGAGG - Intronic
900345737 1:2209527-2209549 GGCCAGGGGGCTGGGCCCTGAGG - Intronic
900439023 1:2644182-2644204 TGCCCCAGTGGTGGGCCCGGGGG + Intronic
900466268 1:2826984-2827006 TGGCACTGTGCATGGCCCAGGGG - Intergenic
900522492 1:3112519-3112541 GGCCACTGAGCGGGGCCCTGGGG - Intronic
900525702 1:3127645-3127667 TCCTACTGTCCTGGGCACTGGGG - Intronic
900965873 1:5958258-5958280 CGCCACTGTGCCTGGCCTTGAGG - Intronic
900969769 1:5985058-5985080 TGCCACTGTGGTAGGTACTGTGG - Intronic
901178012 1:7318808-7318830 AGGCACTGTGCTAGGCCCTAGGG - Intronic
901239767 1:7686146-7686168 AGGCACTGTTCTGGGCTCTGGGG + Intronic
901582662 1:10257960-10257982 AGCCACTGTGCCCTGCCCTGGGG + Intronic
901763975 1:11488351-11488373 GGCCTCTGTGCTGGTCCCAGGGG + Intronic
901873363 1:12151695-12151717 GGGCACTGTGCTTGGCGCTGGGG + Intergenic
901921958 1:12543212-12543234 AGCCACTGTGCTTGGCCATTTGG - Intergenic
901938970 1:12647382-12647404 AACCACTGTGCACGGCCCTGGGG + Intronic
902042041 1:13499666-13499688 TCCCACTGGCCTGAGCCCTGGGG - Intronic
902245025 1:15115059-15115081 TGCCAATGCACTGGGCGCTGGGG - Exonic
902294841 1:15460082-15460104 AGCCACTGTGCAGGGCTCTCAGG - Intronic
902364005 1:15958989-15959011 TCCCACTGGGCTGGACCCTTGGG + Intronic
902574365 1:17367897-17367919 GGTCACTGTGGTGGGCGCTGTGG - Intergenic
902650670 1:17835303-17835325 TGTCACTGTTCTAGGCACTGGGG - Intergenic
902728364 1:18352140-18352162 TGCCCCTCTGCTGAGGCCTGGGG + Intronic
902931554 1:19735039-19735061 GGGCACTGTGCTGGGCACTAGGG + Intronic
903178561 1:21594305-21594327 GGCACCTGTGCTGGGCCCAGTGG + Intergenic
903179998 1:21600404-21600426 TGCCTCTGTGTTGGGCTCTGTGG - Intronic
903371114 1:22836833-22836855 GGGCCCTGTGCTGGGCACTGGGG + Intronic
903497823 1:23782440-23782462 TACCACTGGGCTGGGCACAGTGG + Intronic
903590979 1:24455807-24455829 GGCCACAGTGCTGGGCACTCCGG + Intronic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
903818115 1:26079956-26079978 TGGCACTGCTCTTGGCCCTGGGG + Intergenic
903975725 1:27148800-27148822 GGGGACTCTGCTGGGCCCTGAGG + Intronic
904098642 1:28002833-28002855 AGCCACTGTGCTTGGCCAGGAGG - Intronic
904282699 1:29432544-29432566 AGGCACTGTGCTGGGAACTGGGG + Intergenic
904300644 1:29551272-29551294 AGGCCCTGTGCTGGGCACTGGGG - Intergenic
904308921 1:29612777-29612799 AGACACTGTGCTTGGCACTGTGG + Intergenic
904346800 1:29878023-29878045 TGGCACTGTGCTTGGCACTGTGG + Intergenic
904448547 1:30596005-30596027 GGACACTGTGCTTGGCACTGTGG - Intergenic
904457560 1:30656771-30656793 AGGCCCTGTGCTGGGCACTGGGG + Intergenic
904595132 1:31639418-31639440 AGGCACTGTGCTGGGCCCTGGGG - Intronic
904947911 1:34212836-34212858 TGACTTTGTGATGGGCCCTGCGG + Intronic
905030028 1:34876082-34876104 AAACACTGTGCTGGGCACTGAGG - Intronic
905143096 1:35864795-35864817 TGACACTGTTGTAGGCCCTGGGG + Intergenic
905225771 1:36478239-36478261 TGCCACAGGGCTGGGCGCGGTGG + Intronic
905279500 1:36840039-36840061 TCCCTCTGTCCTGGCCCCTGGGG + Intronic
905300570 1:36983873-36983895 TGGCAGTGTTCTGGGCACTGAGG + Intronic
905534380 1:38708858-38708880 TGCTCCTGTGCTGCGGCCTGTGG + Intergenic
905868138 1:41387479-41387501 AGCCTTTGTGCTGGGCACTGGGG + Intergenic
905918187 1:41700237-41700259 ATCCTCTGTGCTGGGCACTGAGG - Intronic
905922134 1:41726883-41726905 TGCCTCTGTGCTGGGCATGGGGG + Intronic
905942042 1:41871321-41871343 CGTCATTGTGCTGGGCACTGTGG - Intronic
906033374 1:42736793-42736815 AGGCCCTGTGCTGGGTCCTGGGG - Intronic
906121668 1:43397105-43397127 TGGCACTGTGCTAGGCTCTAGGG + Intronic
906283791 1:44572299-44572321 AGGCACTGTGCTGGGTGCTGAGG - Intronic
906613693 1:47220781-47220803 AGGCACTGTGCTAGGCACTGAGG + Intronic
906680377 1:47722207-47722229 AGGCACTGTGCTGAGCACTGTGG - Intergenic
906727020 1:48051565-48051587 TGCCTCTGTGCTGGACCCTGAGG - Intergenic
906789589 1:48647019-48647041 AGGCCCTGTGCTGGGCCTTGGGG - Intronic
907149194 1:52266782-52266804 TCCCACTGTGATGGTACCTGTGG + Exonic
907189512 1:52636923-52636945 GGGCACTGTGCTGGCCCCTGGGG + Intronic
907264683 1:53250415-53250437 AGGCACTGTTCTAGGCCCTGGGG - Intronic
907333423 1:53685858-53685880 TGCCACTGTGCTGAGCCATCTGG + Intronic
907373087 1:54015602-54015624 TGGCTCTGGGCTGGGCCCTGGGG - Intronic
907464718 1:54627505-54627527 AGGCACTGTGCTAGGCTCTGGGG + Intronic
907709067 1:56861164-56861186 AGGTACTGTTCTGGGCCCTGGGG + Intronic
907764699 1:57397522-57397544 TGGCCCAGTGCTGGGCTCTGAGG + Intronic
907917194 1:58881958-58881980 TGCCAGTGTGCTGGGGACAGAGG + Intergenic
907983236 1:59505525-59505547 TTCCTCTGTGCTTGGCACTGGGG - Intronic
908167464 1:61472584-61472606 TGCCACTGTACTCTGGCCTGGGG - Intergenic
908405995 1:63814870-63814892 GGCCACTGTCCTGGTCCCTTAGG - Intronic
909061631 1:70885655-70885677 AGGCACTGTGCTAGGCTCTGAGG + Intronic
909323413 1:74318792-74318814 AACCACTGTGCTAGGCACTGGGG - Intronic
909565106 1:77045031-77045053 CATCACTGTGCTTGGCCCTGGGG + Intronic
909606797 1:77516026-77516048 TGCCACTGTGCTCCAGCCTGGGG + Intronic
909609323 1:77536173-77536195 AGCCACTGTGCTGGGCCTTTTGG - Intronic
909745378 1:79089337-79089359 AGCCACTGTGCCTGGCCTTGAGG + Intergenic
909800123 1:79796622-79796644 TGCCACTGAGGTGGGCCTGGAGG + Intergenic
910225464 1:84931738-84931760 AGCCACTGTGCCTGGCCCAGAGG - Intronic
910265174 1:85330807-85330829 TGCCATTGTGCTGAGCCCGAAGG - Intronic
910674945 1:89807305-89807327 TGCCACTGTGCCTGGCCTTCTGG - Intronic
911172553 1:94784568-94784590 TGGAACTGAGCTTGGCCCTGAGG + Intergenic
911924627 1:103814145-103814167 TGGCACTGTGCTGGGCATTGAGG + Intergenic
912159619 1:106966031-106966053 AGGCACTGTGCTGGGTGCTGAGG - Intergenic
912471348 1:109909291-109909313 AGGCACCGTGCTGGGCCCTGGGG - Intergenic
912515679 1:110215263-110215285 CTCCACTGTGCTGGGCCCATGGG + Intronic
912745581 1:112243039-112243061 TACCACTGTGCCAGACCCTGAGG - Intergenic
912766538 1:112417238-112417260 TGGCACTATGCTGGGTGCTGAGG - Intronic
913390326 1:118303612-118303634 TGCCATTGAGCTGGCCCTTGAGG - Intergenic
914218491 1:145656074-145656096 TACCACTGTGCTGTGCTGTGGGG + Intronic
914333939 1:146698214-146698236 GGGGACTGTGCTGGGCTCTGGGG - Intergenic
914393410 1:147242333-147242355 AGACACTCCGCTGGGCCCTGGGG - Intronic
914459650 1:147871574-147871596 TTGCACTGTGCTGGGCTTTGTGG - Intergenic
914471050 1:147978765-147978787 TACCACTGTGCTGTGCTGTGGGG + Intronic
914953500 1:152140581-152140603 GGACACTGTGCTGGGCACTAGGG - Intergenic
915001783 1:152600798-152600820 AGACACTGTGCTGGGCTCTTTGG - Exonic
915320014 1:155051394-155051416 TGGCGCTGCTCTGGGCCCTGGGG + Exonic
915483581 1:156204356-156204378 TGCCACTTTCCTGGGGCTTGGGG - Intronic
915551654 1:156638742-156638764 TCCCAGTCTCCTGGGCCCTGGGG - Intergenic
915668568 1:157467176-157467198 TGCCACTGTGCTCCAGCCTGGGG + Intergenic
915674972 1:157521038-157521060 TCTCACTGCGCTGGGCCCCGAGG + Exonic
915675660 1:157527638-157527660 TGTCACTGTGCTGGGCCACTAGG + Exonic
915715538 1:157941279-157941301 CCTCACTGTGCTGGGTCCTGGGG - Intergenic
915738701 1:158101560-158101582 TGGCCCTGTGCTGGGGTCTGGGG - Intergenic
915899487 1:159836037-159836059 GGCCACTGTGCTGGAGCGTGAGG - Exonic
916196289 1:162226316-162226338 TGCTATGGTGCTAGGCCCTGGGG + Intronic
916478271 1:165191043-165191065 AGGCACTGTGCTAGGCACTGGGG + Intergenic
916801807 1:168222969-168222991 AGGCACTGTGCTTGGCACTGGGG + Intergenic
916887886 1:169087747-169087769 AGGCACTGTGCTAGGCCCTGTGG - Intergenic
917171497 1:172181008-172181030 CGCCACTCCGCTGGGCTCTGGGG + Intronic
917178613 1:172267221-172267243 AGGCACTGTGTTAGGCCCTGGGG - Intronic
917485618 1:175452251-175452273 AGGCACTGTTCTGGGCTCTGAGG + Intronic
917734511 1:177908224-177908246 TGGCACAGTGCTGGGCTTTGGGG - Intergenic
917838440 1:178958923-178958945 AAGCACTGTGCTGGGCCCTGAGG + Intergenic
917845465 1:179016420-179016442 AGCCACAGTGCTGGGCCCTGAGG - Intergenic
918081660 1:181212422-181212444 AGGCACTGTGCTAGGCACTGGGG - Intergenic
919490616 1:198200834-198200856 AGCCACTGTGCCAGGCCCTTTGG + Intronic
919621995 1:199873407-199873429 TGCCACAGGGCTGGGCACGGTGG + Intergenic
919909384 1:202101435-202101457 AGGCACTGGGCTAGGCCCTGGGG - Intergenic
920343087 1:205287898-205287920 TGACATTGTGCCAGGCCCTGAGG - Intergenic
920370816 1:205478097-205478119 AGGCACTGTGCCAGGCCCTGGGG + Intergenic
920379111 1:205525691-205525713 TGTCACTGTGCAGAGGCCTGGGG + Intronic
920388913 1:205586646-205586668 TGCCTCTGGGCTGGGGCCTGGGG + Intronic
920700555 1:208215320-208215342 TGGCACTGTACTAGGCACTGGGG - Intronic
920849560 1:209619371-209619393 AGGCACTGTGCTGGGGTCTGGGG - Intronic
922246873 1:223808235-223808257 AGCCACCGTGCCCGGCCCTGAGG - Intronic
922727964 1:227933732-227933754 CTCCACTGTGCTTGGCTCTGTGG - Intronic
922856094 1:228775847-228775869 AGCCACCGTGCCGGGCCCTATGG - Intergenic
922963028 1:229664257-229664279 TGAAAGTGTGCTGGGGCCTGGGG + Intergenic
923150274 1:231226972-231226994 TGCCATTATGCTGGGCGCTAAGG - Exonic
924871969 1:248056933-248056955 AGCCACTGTGCCTGGCCTTGAGG + Intronic
1063130545 10:3173375-3173397 TGCAAGTGAGCTGGGCCTTGGGG + Intergenic
1063388795 10:5634961-5634983 TTCCACTGTGCTGGGGACAGAGG - Intergenic
1063448311 10:6134225-6134247 TGACACTGTCCTGGGCTCAGCGG + Intergenic
1064486121 10:15792296-15792318 AACCACTGTGCTAGGCCCTGGGG - Intronic
1064633756 10:17343093-17343115 TTGCACTGTGCTAGGCTCTGGGG + Intronic
1064798850 10:19045594-19045616 TGCTACTATGCTGGCACCTGGGG + Intergenic
1065371297 10:24989329-24989351 GGGCACTGTGCTAGGCACTGGGG + Intronic
1065789838 10:29250584-29250606 TGTCACTGTGCTGTGCTGTGTGG - Intergenic
1065824088 10:29553958-29553980 AGATCCTGTGCTGGGCCCTGAGG + Intronic
1065842607 10:29715636-29715658 TCCCACTGTGCTAGGCCATTAGG - Intronic
1066080205 10:31923087-31923109 TGCCACTGTACTGCAGCCTGGGG + Intronic
1066421440 10:35268178-35268200 AGCCACTGTGCAGGGCCCCTTGG + Intronic
1067054868 10:43044614-43044636 TGGCCCTGTGCAGGGCTCTGAGG - Intergenic
1067328466 10:45292341-45292363 TGCTCCTGTGCTGCTCCCTGTGG - Intergenic
1067458232 10:46438976-46438998 TGGCTCTGGTCTGGGCCCTGAGG - Intergenic
1067628964 10:47945658-47945680 TGGCTCTGGTCTGGGCCCTGAGG + Intergenic
1067813762 10:49454623-49454645 TGGCAATGTGAAGGGCCCTGTGG - Intergenic
1068652642 10:59539448-59539470 TAGCACTGTGCTGGGCGCTGGGG - Intergenic
1068984121 10:63091294-63091316 TGACACTGTTCTTGGCACTGAGG + Intergenic
1069192984 10:65513096-65513118 TGTAACTGAGCTGGGCACTGTGG - Intergenic
1069694259 10:70375284-70375306 TGACACTGCGCTGGGCTCTGGGG + Intronic
1069826321 10:71257162-71257184 TGGGGCTCTGCTGGGCCCTGAGG + Intronic
1069866546 10:71507114-71507136 TCCACCTGGGCTGGGCCCTGAGG + Intronic
1069873406 10:71547042-71547064 GGGCACTGGGCCGGGCCCTGGGG + Intronic
1069885836 10:71623041-71623063 TGCCACTGTGCTAGGTCCTGGGG + Intronic
1070097976 10:73356920-73356942 TGGCACTGTGATGGGTGCTGAGG + Intronic
1070241674 10:74688387-74688409 AGGCACTGTGCTGGGTCCCGGGG - Intronic
1070311515 10:75276733-75276755 AGCAACTGTGCTGGGTTCTGAGG + Intergenic
1070423782 10:76265099-76265121 TGCCCCTGTGCAGGCCCCAGAGG - Intronic
1070670696 10:78375363-78375385 AGACACTGTGCCAGGCCCTGGGG + Intergenic
1070675477 10:78408821-78408843 TGGGACTGTGCAGGGCTCTGGGG - Intergenic
1070967734 10:80539778-80539800 CACCTCTGTGCTGGGCCCAGGGG - Intronic
1071486098 10:86103697-86103719 TGCCACAGTGGGGGGCCCTTAGG + Intronic
1071676224 10:87658950-87658972 TTCCACTGGAATGGGCCCTGAGG - Intergenic
1071817795 10:89250959-89250981 TGGCACTTTGCTTGGTCCTGGGG - Intronic
1072152557 10:92695708-92695730 TGGCGCGGTGCTGGGCTCTGGGG + Intergenic
1072263616 10:93706036-93706058 TGGCACTGTGCTGAGCACTGGGG - Intergenic
1072440579 10:95450785-95450807 AGCCACTGTGCCCGGCTCTGTGG + Intronic
1072449234 10:95526272-95526294 TCCCTCCGGGCTGGGCCCTGTGG + Intronic
1072459677 10:95607573-95607595 AGGCACTGTGTTGAGCCCTGGGG + Intronic
1072765000 10:98088081-98088103 AGGCACTGTGCTGGGCTCTGAGG - Intergenic
1072791328 10:98320414-98320436 AGACACTGGGCTAGGCCCTGCGG + Intergenic
1073475007 10:103747039-103747061 CGTCCTTGTGCTGGGCCCTGAGG - Intronic
1073609910 10:104933014-104933036 AGCCACTGTGCTGGCCCCCTTGG + Intronic
1073693651 10:105840291-105840313 TGTCACTGTGCTAGGCACGGAGG - Intergenic
1074184726 10:111090572-111090594 TGTCACTGTGCTAAGTCCTGAGG + Intergenic
1074185476 10:111096844-111096866 TGCCAATGTGCTGGGGCATATGG - Intergenic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1074338990 10:112607494-112607516 AGGCACTGTGCTAGGCACTGAGG - Intronic
1074386127 10:113018037-113018059 TGGCACAGTGCTGGGTGCTGGGG + Intronic
1074413688 10:113248967-113248989 CAGCACTGTGCTGGGCACTGAGG + Intergenic
1074998811 10:118779954-118779976 AGTCACTGTACTGGGCCTTGTGG - Intergenic
1075045027 10:119139910-119139932 TGCCACACTGCTGGGCACTCAGG - Intergenic
1075087604 10:119423944-119423966 TGGCACTGTGCTGGGTGCTGGGG + Intronic
1075230415 10:120671583-120671605 AGCCACTGTGCTGCGCTGTGGGG - Intergenic
1075654628 10:124152879-124152901 GGCCCCTGGGCTGGGCACTGAGG + Intergenic
1075695702 10:124433616-124433638 TGGCACTGTGCTAGGCCCTGGGG - Intergenic
1075695990 10:124435748-124435770 AGGCACTGTGCTAGGCCCTGGGG - Intergenic
1075754189 10:124798064-124798086 TGCCACTGGGCTGGGTGCAGTGG - Intergenic
1075840064 10:125493977-125493999 GGCCCCTGTGCTGGGCCTTATGG - Intergenic
1075959837 10:126558840-126558862 GGGCACTGAGCTGGGCCCTGGGG - Intronic
1075995193 10:126871388-126871410 AGGCACTGTGCTTGGCACTGGGG + Intergenic
1075998941 10:126900185-126900207 TGGCACTGTCCTGGACCCAGAGG + Intergenic
1076020913 10:127072283-127072305 AGGCACTGTGCTAGGCACTGAGG + Intronic
1076027449 10:127127663-127127685 TGCCTCTGGGTTGGCCCCTGGGG - Exonic
1076307815 10:129477058-129477080 TGCATCTGTGCTCTGCCCTGAGG + Intronic
1076404576 10:130203304-130203326 TGCTGCTGTGCAGTGCCCTGAGG + Intergenic
1076563379 10:131381833-131381855 TGACTCTGGGGTGGGCCCTGGGG - Intergenic
1076662681 10:132065785-132065807 TGCCTCTGTGCTTGGCCTTAAGG + Intergenic
1076675763 10:132146841-132146863 CAGCACTGTGCTGAGCCCTGTGG - Intronic
1076724310 10:132406354-132406376 TGCCTCTGCTCCGGGCCCTGAGG + Intronic
1076908847 10:133377596-133377618 GGGCAGTGAGCTGGGCCCTGCGG + Intergenic
1077089080 11:770193-770215 GGCCACTGTGCAAGGCCGTGGGG + Exonic
1077223602 11:1428005-1428027 CGCCTCTATGCTGGGCTCTGAGG + Intronic
1077279442 11:1735513-1735535 TGGTACTGTGCTGAGCACTGTGG - Intronic
1077541578 11:3149049-3149071 TGGCTCTGTGGTGGGCCCAGTGG - Intronic
1078360419 11:10663507-10663529 AGGTACTGTGCTGGGCACTGGGG + Intronic
1078571390 11:12461081-12461103 TGGCACTGTGCTGGGCTCCGAGG + Intronic
1078700785 11:13680376-13680398 TGCCACTGTGCCTGGCTCAGAGG + Intronic
1078966517 11:16350831-16350853 GTGCACTGTGCTGGGCACTGGGG - Intronic
1079022262 11:16918923-16918945 AGCCACCGTGCTGGGCCTAGGGG - Intronic
1079141297 11:17811660-17811682 AGGCACTGTGCTGGGCGCTCCGG + Intronic
1079321198 11:19453214-19453236 AGCCACAGTGCTGAGCACTGGGG - Intronic
1080022095 11:27572846-27572868 AGGCACTGTGCTAGGCTCTGGGG + Intergenic
1080036627 11:27718955-27718977 TGCCACCGGGCTTGGCTCTGTGG + Intronic
1080423907 11:32138796-32138818 GGCCACTGTTCTGGGCCCTTGGG - Intergenic
1080573825 11:33580284-33580306 TGCCACTTGGCTGGGCGCAGTGG + Intronic
1080612378 11:33915663-33915685 AGACACTGTGCTGGGCGCTGGGG - Intergenic
1080897283 11:36457085-36457107 TCCCAGTGGGCTGGGACCTGCGG + Intronic
1081394147 11:42565067-42565089 TGCTACTGTTCTAGGCACTGGGG + Intergenic
1081580804 11:44350339-44350361 AGTCACTGTTCTGGACCCTGGGG - Intergenic
1081700826 11:45151557-45151579 AGGCACTGTGCTGGGCCTAGGGG + Intronic
1081890809 11:46540876-46540898 TAACACTGTGCTAGGCACTGTGG - Intronic
1081893158 11:46561969-46561991 TGGCACTGTTCTAGGCACTGAGG + Intronic
1082055661 11:47813782-47813804 TGCCACTGGGCCGGGCGCAGTGG + Intronic
1082993949 11:59233956-59233978 AGCCACTGTGCTGTGCTGTGGGG - Intergenic
1083035101 11:59629380-59629402 TGACTCTGTGCTGGGCTTTGTGG + Intergenic
1083174730 11:60942414-60942436 TTACCCTGTGCTGGGCCCTGGGG - Intronic
1083320974 11:61846458-61846480 TGCCAGTTTCCAGGGCCCTGAGG + Intronic
1083623974 11:64062592-64062614 AGGCACTGTCCTGGGCGCTGGGG + Intronic
1083641489 11:64148153-64148175 TGCCACTCAGCAGGGCCCTGGGG - Intronic
1083738878 11:64697301-64697323 TGCCACTGTGCAGGGCTCAGGGG - Intronic
1083755220 11:64788580-64788602 TGCCTCAGTGCCAGGCCCTGGGG - Intergenic
1083920491 11:65779599-65779621 GGCTGCTGGGCTGGGCCCTGCGG - Exonic
1083951245 11:65957676-65957698 AGCGATTGTGCTGGGCCCGGTGG - Intronic
1084009276 11:66338664-66338686 TGCCAGGGTGGGGGGCCCTGAGG + Intronic
1084070656 11:66731820-66731842 AGGCACTGTGCTGGGATCTGGGG + Intergenic
1084078954 11:66805738-66805760 AGCCACTGTGCTCGGCCTGGAGG + Intronic
1084143487 11:67250262-67250284 TGGCACTGTGGTGGTCGCTGGGG - Exonic
1084425238 11:69080748-69080770 TGCCACTGTGCTGTGCCGTGGGG + Intronic
1084536681 11:69761422-69761444 AGCCACTGTGCCTGGCCATGGGG - Intergenic
1084591752 11:70094385-70094407 TGCCAGTGCCCAGGGCCCTGTGG - Intronic
1084903058 11:72324669-72324691 TGGCTCTGTACTTGGCCCTGTGG - Intronic
1084961840 11:72720983-72721005 TGGCCCTGTGCTGGCTCCTGAGG + Intronic
1085325313 11:75602009-75602031 AGGCACTGTGCTGGGCACTAGGG - Intronic
1085533109 11:77203225-77203247 TGCCACTGGGCTGTGCCCAGGGG + Intronic
1085621485 11:78041135-78041157 ACCCAGTGTGCTGGCCCCTGGGG - Intronic
1085698470 11:78725895-78725917 TGTCACTGTGCTAGGCACTGGGG - Intronic
1085701771 11:78752188-78752210 CAGCACTGTGCGGGGCCCTGGGG + Intronic
1085753071 11:79178753-79178775 TGTGACTGTGCTGGACCCTGTGG - Intronic
1086404520 11:86488445-86488467 TCACATTGTGCTGGGCCCTGGGG + Intronic
1086595065 11:88560820-88560842 CACCACTGTGCTAGGCCCTCGGG - Intronic
1086994220 11:93338357-93338379 AGGCACTGTGCTTGTCCCTGTGG - Intronic
1087045869 11:93843410-93843432 AGGCACTGTGCTAGGCCCTGGGG - Intronic
1087747300 11:101964018-101964040 AGCCACTGTGCTTGGCCTGGAGG - Intronic
1088058089 11:105610057-105610079 TGCCACTGGGCTGCGCGCGGGGG - Exonic
1088086078 11:105982029-105982051 AGGCACTGTGCTGGGTGCTGGGG - Exonic
1088320887 11:108553667-108553689 TGGGACTATGCTAGGCCCTGGGG - Intronic
1088488984 11:110368733-110368755 AGCCACCGTGCCCGGCCCTGGGG + Intergenic
1088668629 11:112119608-112119630 AGGCACTGTGCTGGGTCCTGGGG + Intronic
1088691447 11:112331976-112331998 AGCCACTGTGGTGGGCCCAGTGG + Intergenic
1088712076 11:112517714-112517736 AGCCACTGTGCCCGGCCCTGAGG - Intergenic
1088741317 11:112769667-112769689 AGACACTATGCTGGGCACTGTGG + Intergenic
1088892151 11:114053365-114053387 TGACAGTGTGCTAGGCTCTGGGG + Intergenic
1088975967 11:114816765-114816787 TGGCACTGTGCTAGACCCTGGGG - Intergenic
1089096266 11:115922566-115922588 TGGCACTTTACTGGGCACTGGGG - Intergenic
1089133966 11:116234725-116234747 TGCAAGGGTGCTGGGCCCAGGGG + Intergenic
1089326264 11:117659614-117659636 AGCCACTGGGCTTGGCTCTGTGG + Intronic
1089401016 11:118164768-118164790 AGGCACTGTGCCGGGCACTGGGG - Exonic
1089543307 11:119204210-119204232 AGCCACTGTGCTGGGCCGAATGG + Intergenic
1089735389 11:120547153-120547175 GGCCACTGAGCTGGCTCCTGAGG - Intronic
1089750829 11:120649988-120650010 GGCCACCAGGCTGGGCCCTGGGG - Intronic
1089751837 11:120657177-120657199 AGGCACTGTTCTAGGCCCTGGGG + Intronic
1089765315 11:120758896-120758918 AGGCACTGTGCTAGGCACTGGGG + Intronic
1090023193 11:123145747-123145769 AGCCACTGTGCCCGGCCTTGCGG + Intronic
1090095755 11:123740942-123740964 TGCCACTGTGACAGACCCTGAGG - Intronic
1090267961 11:125365905-125365927 AGGCACCGTGCTGGGCACTGGGG - Intronic
1090351796 11:126112669-126112691 AGCCTGTTTGCTGGGCCCTGGGG - Intergenic
1090405682 11:126474708-126474730 GGGCTCTGTGCTGGGCACTGCGG - Intronic
1090854314 11:130598556-130598578 GGCCTCCCTGCTGGGCCCTGCGG + Intergenic
1091187856 11:133662621-133662643 AGGCACTGTGCTGGGTGCTGTGG + Intergenic
1091218403 11:133917387-133917409 GGACACAGTGCTGGTCCCTGGGG + Intronic
1091520747 12:1239339-1239361 AGCCACTGTGCCTGGCCCTATGG + Intronic
1092782759 12:12002636-12002658 AGGCACTGAACTGGGCCCTGGGG + Intergenic
1094107524 12:26830189-26830211 TGCCATTGGGCTGGGCACAGTGG - Intronic
1094284301 12:28775381-28775403 AGGCATTGTGCTGGACCCTGGGG - Intergenic
1094819167 12:34211406-34211428 AGCCCCTGCGCTGGGCCCGGGGG - Intergenic
1094830515 12:34298053-34298075 AGCCCCTGCACTGGGCCCTGGGG + Intergenic
1094831555 12:34302591-34302613 AGCCACTGTGCGGTGCCCCGGGG + Intergenic
1094831884 12:34304078-34304100 AGCCACTGCGCGGGTCCCTGGGG + Intergenic
1094831937 12:34304291-34304313 AGCCCCTGCGGTGGGCCCTGGGG + Intergenic
1094832892 12:34308514-34308536 AGCCCCTGTGCTGGGCCCCGGGG + Intergenic
1094834141 12:34314366-34314388 AGCCCCTGTGCAGGGCCCTGGGG - Intergenic
1094834797 12:34317293-34317315 AGCCCCTGTGCGGGGCCCGGGGG - Intergenic
1094836509 12:34324630-34324652 AGCCACTGCGCAGGGCCCCGGGG - Intergenic
1095097638 12:38156821-38156843 AGCCCCTGCGCTGGGCCCGGTGG + Intergenic
1095234582 12:39781449-39781471 TGTCACTGTACTAGCCCCTGGGG - Intronic
1096361502 12:50991891-50991913 GGACACTGTGCTAGGTCCTGTGG - Intronic
1096580830 12:52583894-52583916 TGCCACTATGCTAGGCCCAAGGG + Intergenic
1096667479 12:53175653-53175675 TGCCTCTGTGCAAGTCCCTGGGG - Intronic
1096816289 12:54203852-54203874 TGTCCCTGCTCTGGGCCCTGTGG - Intergenic
1097024079 12:56041469-56041491 TGGCACAGTGCCTGGCCCTGTGG - Intergenic
1097141688 12:56908078-56908100 TGCCACTGTGCTGGCTACAGCGG + Intergenic
1097367387 12:58732124-58732146 AGGCACTGTGCTCGGCACTGGGG + Intronic
1097504535 12:60448839-60448861 TGCCACAGGGCTGGGCGCGGTGG - Intergenic
1098292512 12:68970210-68970232 GGCCACTGTACTGAGCCTTGGGG - Intronic
1098292539 12:68970637-68970659 AGGCACTGTTCTAGGCCCTGAGG - Intronic
1098626588 12:72678523-72678545 TGTCACTGTGCTGGGCTCCCTGG + Intergenic
1099122300 12:78706389-78706411 AGCCACTGTTCTAGGCACTGGGG + Intergenic
1099200853 12:79675090-79675112 AGCCACCGTGCCTGGCCCTGTGG - Intronic
1099467122 12:83001350-83001372 ACCCACCGTGCTGGGCCCTAAGG - Intronic
1100387441 12:94116935-94116957 AGCCACTGTGCCCGGCCCTGAGG - Intergenic
1100433751 12:94553034-94553056 TGCCACTGTGCTCCAACCTGGGG - Intergenic
1100503000 12:95192529-95192551 AGGCACTGTTCTGGGCACTGAGG + Intronic
1100772526 12:97939294-97939316 TACCATTGTGCTAGGCACTGTGG - Intergenic
1100772582 12:97939721-97939743 AGCCACTGTGCCTGGCCCAGTGG + Intergenic
1100827235 12:98486279-98486301 GGGCACTGTTCTGGGCTCTGGGG + Exonic
1101404431 12:104415511-104415533 AGTCACTGTGCTAGGCGCTGGGG + Intergenic
1101409485 12:104457036-104457058 TGCCGCTGCGCTGGCCGCTGTGG - Exonic
1101591108 12:106126279-106126301 TAGCACTGTGCTAGGCACTGGGG - Intronic
1101649863 12:106667611-106667633 TACCACAGTACTGGGTCCTGAGG + Intronic
1101811569 12:108112318-108112340 AGACACTGTGCAGGGCTCTGGGG - Intergenic
1102015794 12:109647119-109647141 AGGCACTGTTCTGGGCACTGAGG - Intergenic
1102024191 12:109704112-109704134 AGCCGCTGTGCCTGGCCCTGGGG - Intergenic
1102051951 12:109869012-109869034 AGCCACTGTGCCTGGCCCGGGGG - Intronic
1102053264 12:109878778-109878800 AGGCACTGTTCTGGGCACTGAGG + Intronic
1102124066 12:110466291-110466313 AGGCACTGTTTTGGGCCCTGGGG - Intronic
1102230914 12:111261613-111261635 AGCCACTGCGCCTGGCCCTGTGG - Intronic
1102350198 12:112186273-112186295 TGCCATTGTGCCTGGCCATGAGG + Intronic
1102470779 12:113158774-113158796 TGGCCCTGTGCTGGGCACTGGGG - Exonic
1102726963 12:115074260-115074282 AGCCACTATGCTAGGCCCTGAGG - Intergenic
1102892875 12:116574602-116574624 TGCCACTGTGCTCCAGCCTGGGG + Intergenic
1103150524 12:118634694-118634716 TGGGACTGTGATAGGCCCTGAGG + Intergenic
1103173110 12:118838963-118838985 AGACACTGTGCTAGGCCCTGGGG - Intergenic
1103286656 12:119807553-119807575 TGGCACTGTGCTGTGTACTGAGG - Intronic
1103567090 12:121822321-121822343 TGACACTGGGTTGGGCGCTGAGG + Intronic
1103712686 12:122924575-122924597 AGCCACTGTTCTAGGCACTGGGG + Intronic
1103903523 12:124315694-124315716 TGCCACAGTGCTGGCTTCTGGGG - Exonic
1103944966 12:124520921-124520943 GCCCACTGTCCTGGCCCCTGTGG - Intronic
1103947551 12:124535045-124535067 TACTTCTGTGCTGGGCACTGGGG - Intronic
1104457410 12:128926656-128926678 TTCCACTGTCCTGTGCCCTCAGG + Intronic
1104592711 12:130097607-130097629 AGGAACTGTGCTAGGCCCTGGGG + Intergenic
1104869507 12:131984738-131984760 TGCCACTGCGCTCCACCCTGAGG - Intronic
1104987191 12:132603785-132603807 TCCCGCTCTGCTGAGCCCTGGGG - Intronic
1105277478 13:18944280-18944302 TGCCCCTGCGCCGGGCCCGGGGG - Intergenic
1105432924 13:20353512-20353534 TGCCACTGTGCAAGGCCCTATGG - Intergenic
1105755238 13:23457722-23457744 TCCCACTGTGGTGGGCCCAGTGG + Intergenic
1105818241 13:24056589-24056611 AGACACTGTGCTGGGCTCTGTGG - Intronic
1105879707 13:24593400-24593422 AGCCACTGTGCCTGGCCATGAGG - Intergenic
1106159576 13:27188662-27188684 AGCCACTGTGCCTGGCCATGTGG - Intergenic
1106201047 13:27537640-27537662 TGCCATTGTGATGGGCTCTGGGG - Intergenic
1106218189 13:27721746-27721768 TCAAACTGTGATGGGCCCTGAGG + Intergenic
1106218700 13:27726159-27726181 TAGCACAGTGCTGGGCACTGGGG - Intergenic
1106424451 13:29612343-29612365 TGCCACTGTGCTCCAGCCTGGGG - Intergenic
1106677894 13:31980919-31980941 AGGCACAGTGCTGGGCCCTGGGG + Intergenic
1106684974 13:32049091-32049113 AGGCATTGTGCTGGGACCTGGGG + Intronic
1106807693 13:33327654-33327676 AGCCATTGTGCTGGTCCCTTTGG + Intronic
1107324563 13:39227153-39227175 AGCCACTATACTGAGCCCTGAGG - Intergenic
1107579079 13:41762815-41762837 AGGCACTGTGCTGAGCTCTGGGG - Intronic
1107740732 13:43447226-43447248 AGGCACTGTGCTGGGCCCTTGGG - Intronic
1108045436 13:46379418-46379440 TGCCACTGGTCTGGGTTCTGGGG - Intronic
1108056640 13:46491792-46491814 TGCTACTCTGCTGGGCCCATGGG + Intergenic
1108211591 13:48144932-48144954 AGCCACTGTGCCTGGCCATGGGG - Intergenic
1108361101 13:49668530-49668552 TGCCACTGTGCTCCAGCCTGGGG + Intronic
1109072514 13:57787368-57787390 AGCCACTGTGCTGCGCTGTGGGG + Intergenic
1110231650 13:73173440-73173462 AGGAACTGTGCTAGGCCCTGGGG - Intergenic
1110591082 13:77259989-77260011 AGACACTGTGCTGGGCACTGGGG + Intronic
1111979692 13:95003106-95003128 TGCCACAGAGCTGGGCCTGGCGG - Intergenic
1112528871 13:100181314-100181336 TCCCATTGTGCTAGGCACTGAGG + Intronic
1113537028 13:111076251-111076273 GAACACTGTGCTGGGGCCTGGGG - Intergenic
1113610237 13:111639501-111639523 TGCCACAGGCCTGGGCTCTGAGG - Intronic
1113728468 13:112623235-112623257 TGCATCCCTGCTGGGCCCTGCGG + Intergenic
1113778083 13:112960372-112960394 TGCCGCCGTGCTGGGACATGGGG - Intronic
1113896293 13:113766425-113766447 TGCCACTGTCCCAGGTCCTGGGG - Intronic
1114075018 14:19157263-19157285 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1114075118 14:19157710-19157732 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1114075432 14:19158957-19158979 AGCCCCTGAGCTGGGCCCAGGGG + Intergenic
1114075487 14:19159177-19159199 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1114086781 14:19240802-19240824 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
1114086837 14:19241023-19241045 AGCCCCTGAGCTGGGCCCAGGGG - Intergenic
1114087151 14:19242272-19242294 AACCCCTGCGCTGGGCCCTGTGG - Intergenic
1114087250 14:19242713-19242735 AGCCCCTGCGCTGGGCCCCGTGG - Intergenic
1114197218 14:20489503-20489525 TGCCACTGAAGTGGGACCTGAGG + Intergenic
1115263736 14:31478963-31478985 TGGCACTGTGATAGGCACTGGGG - Intergenic
1116505319 14:45670624-45670646 AGGCACTGTGCTGAGCACTGCGG + Intergenic
1116631243 14:47336875-47336897 GGGCACTGTGCTGGGTACTGTGG - Intronic
1116819348 14:49612912-49612934 AGCCACTGCGCTGGGCCTTGAGG - Intronic
1117206114 14:53445439-53445461 AGGTACTGTGCTGGGCTCTGGGG + Intergenic
1117578821 14:57130091-57130113 AGCCACTGTGCCTGGCCCAGAGG - Intergenic
1117674235 14:58139982-58140004 AGCCACTGTGCCTGGCTCTGGGG - Intronic
1118890822 14:69907202-69907224 TGCCACAGTGCTGCTTCCTGTGG - Intronic
1118966691 14:70593876-70593898 TGCCCCAGTGCTGGGTCCTAAGG + Intronic
1119156867 14:72419617-72419639 GGCCACTGAGCTGGACCCTGTGG + Intronic
1119257329 14:73209522-73209544 TGACTATGTGCTAGGCCCTGGGG + Intronic
1119267200 14:73270002-73270024 AAGCACTGAGCTGGGCCCTGGGG - Intronic
1119442765 14:74639650-74639672 AGCCACTGTGCCTGGCCATGAGG - Intergenic
1119494976 14:75070354-75070376 AGACACTGTGTTAGGCCCTGAGG - Intronic
1120219677 14:81718241-81718263 AGGCACTGTGCTAGGCTCTGGGG - Intergenic
1120767397 14:88341929-88341951 TGTCAGTGGGCTGGGCACTGTGG - Intergenic
1121031985 14:90666082-90666104 TGCCACTGTGTGCAGCCCTGGGG - Intronic
1121142401 14:91554993-91555015 AGCCACTGTGCTGCGCTGTGGGG - Intergenic
1121148455 14:91607149-91607171 TGTCACTGTTCTGGGCACTGGGG + Intronic
1121210337 14:92203751-92203773 AGACACTGTGCCAGGCCCTGAGG - Intergenic
1121290226 14:92768404-92768426 TTCCACTCTGCTGAGCCTTGGGG + Intergenic
1121291040 14:92775503-92775525 TTCCACTCTGCTGAGCCTTGGGG - Intergenic
1121336154 14:93078651-93078673 TGTCACTGTGCTGTGGGCTGTGG - Intronic
1121504581 14:94467075-94467097 TGTCAATCTCCTGGGCCCTGAGG - Intronic
1122094187 14:99359379-99359401 TAACACTCTGCTGGGCACTGGGG + Intergenic
1122436971 14:101706951-101706973 AGGCACTGTGCTGGGTGCTGGGG - Intergenic
1122517814 14:102320675-102320697 AGGCACTGTGCTGGGTACTGCGG - Intronic
1122549493 14:102542284-102542306 AGCCACTGTGCTGGGCCATGTGG + Intergenic
1122593308 14:102871058-102871080 TGGCATTGTGCTGGGTGCTGGGG + Intronic
1122633857 14:103121320-103121342 TGCCCCTGGCCTGTGCCCTGGGG + Intergenic
1122898602 14:104772708-104772730 CGCCACTCTGCTTGGGCCTGAGG + Intronic
1122962109 14:105099165-105099187 TGCCACTGTGCTGGGGGCTTTGG + Intergenic
1123031886 14:105455869-105455891 GGCCTCTGTGCTGAGGCCTGTGG + Intronic
1123031908 14:105455950-105455972 AGTCACTGTGCTGAGGCCTGTGG + Intronic
1123031914 14:105455988-105456010 GGCCGCTGTGCTGAGGCCTGTGG + Intronic
1123136701 14:106034132-106034154 GGCCAATGTCCTGGCCCCTGGGG - Intergenic
1202898367 14_GL000194v1_random:22617-22639 AGCCCCTGAGCTGGGCCCAGGGG - Intergenic
1202898526 14_GL000194v1_random:23224-23246 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1202899072 14_GL000194v1_random:25443-25465 AGCCACTGCGCTTGGCCCCGTGG - Intergenic
1202899267 14_GL000194v1_random:26243-26265 AGTCCCTGCGCTGGGCCCTGTGG - Intergenic
1202899631 14_GL000194v1_random:27747-27769 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
1123458782 15:20449043-20449065 CGCCACTGTACTTGGGCCTGAGG + Intergenic
1123459261 15:20454253-20454275 AGAAACAGTGCTGGGCCCTGTGG - Intergenic
1123578146 15:21693667-21693689 GGCCAACGTACTGGGCCCTGGGG - Intergenic
1123614771 15:22136149-22136171 GGCCAACGTACTGGGCCCTGGGG - Intergenic
1123658800 15:22546165-22546187 AGAAACAGTGCTGGGCCCTGTGG + Intergenic
1123659280 15:22551373-22551395 CGCCACTGTACTTGGGCCTGAGG - Intergenic
1124026910 15:25975250-25975272 AGCCACTGTGCTGGGCTCAGGGG + Intergenic
1124265499 15:28230089-28230111 AGAAACAGTGCTGGGCCCTGTGG - Intronic
1124312664 15:28640657-28640679 AGAAACAGTGCTGGGCCCTGTGG + Intergenic
1124313144 15:28645863-28645885 CGCCACTGTACTTGGGCCTGAGG - Intergenic
1124339964 15:28884716-28884738 TGCCCCTTTGTTTGGCCCTGTGG + Intronic
1124402249 15:29359452-29359474 TGCCACTGTGCTCCAGCCTGGGG - Intronic
1125034261 15:35106001-35106023 TGGCACTGTGGTGGGAACTGTGG + Intergenic
1125536828 15:40445829-40445851 TGCCATTGTGCTGGGGACTTTGG + Intronic
1125643486 15:41251115-41251137 AGCCACTGTGCCTGGCCCAGAGG + Intronic
1125851817 15:42911312-42911334 TAGGACTGTGCTGGGCACTGTGG + Intronic
1126075375 15:44904042-44904064 AGGCACTGTGCTGGGTGCTGTGG + Intergenic
1126082995 15:44983745-44983767 AGGCACTGTGCTGGGTGCTGTGG - Intergenic
1126324518 15:47462325-47462347 AGGCACTGTGCTGGGACCTGTGG - Intronic
1126406486 15:48328254-48328276 AGCCACTGTGCCTGGCCTTGTGG - Intergenic
1127287052 15:57541512-57541534 TCCCACTCTGCTGGGCCCCAGGG - Intronic
1127331429 15:57943792-57943814 TGCCTCTCTGCTGGCCCCTCTGG - Intergenic
1127504914 15:59588878-59588900 AGCCACTGTGCCCGGCCCTAAGG + Intergenic
1127959679 15:63881467-63881489 AGCCACTGTGCCCGGCCCAGAGG + Intergenic
1128178589 15:65580050-65580072 TGCCACTGTGGTGGGGCCTCAGG + Intronic
1128239559 15:66092694-66092716 CGGGACTGTGCTGGGCCGTGGGG - Intronic
1128304851 15:66591614-66591636 AGCCACAGTTCTGGGCCCTGGGG + Intronic
1128323004 15:66705679-66705701 AGGCACTGTGCTGGGTGCTGTGG + Intronic
1128870392 15:71150926-71150948 AGCCACTGTGCTAGGTGCTGGGG + Intronic
1129159800 15:73740876-73740898 TACCACTGTTCAGTGCCCTGGGG + Intronic
1129163173 15:73758977-73758999 AGCCACCGTGCCTGGCCCTGAGG - Intergenic
1129278732 15:74466271-74466293 AGCCACTGTGCCTGGCCCAGTGG + Intergenic
1129308596 15:74687657-74687679 AGCCACTGTGCCTGGCCCTTGGG + Intronic
1129450093 15:75646871-75646893 AGGCACTGTGCTGGGCACTGGGG - Intronic
1129450887 15:75650611-75650633 TGGCTCTCTGCTGGGCCCTGGGG + Intronic
1129679917 15:77652930-77652952 ACCCACTGGGCTGGGCCCTGAGG - Intronic
1129779425 15:78260332-78260354 TGCTGCTCTCCTGGGCCCTGGGG - Intergenic
1130136466 15:81185637-81185659 AAGCACTGTGCTGGGCTCTGGGG + Intronic
1130151416 15:81314597-81314619 AGCCACCGTGCTTGGCCCTGGGG - Intronic
1130196544 15:81784857-81784879 GGCCACTGTGCTTTGCCCTGGGG - Intergenic
1130300183 15:82674648-82674670 TGGTACTGTGCTGCGTCCTGAGG - Intronic
1130325512 15:82876242-82876264 TGACACTGCTCTGGTCCCTGAGG - Intronic
1131252601 15:90840096-90840118 AGGCACTGTGCCGGGCACTGGGG - Intergenic
1131388568 15:92028477-92028499 AGCCAGTGTTCTAGGCCCTGGGG + Intronic
1131476429 15:92744116-92744138 TGCCTCTGTGCTTTTCCCTGTGG + Intronic
1131616411 15:94021160-94021182 TTTCTCTGTGCTGGGTCCTGAGG - Intergenic
1131859349 15:96636145-96636167 TGGCACTGTGCTAGGGACTGAGG + Intergenic
1132011995 15:98284277-98284299 GGCCTCTGTGCTAGGCGCTGGGG + Intergenic
1132163539 15:99565026-99565048 TGCTACTGTCCTGGGACCTGGGG + Intergenic
1132279551 15:100601691-100601713 GGCCACTGTTCTAGTCCCTGGGG - Intronic
1132404715 15:101535421-101535443 TGCCACCACCCTGGGCCCTGTGG - Intergenic
1202987016 15_KI270727v1_random:427912-427934 GGCCAACGTACTGGGCCCTGGGG - Intergenic
1132513442 16:354852-354874 TCCCACAGTGCTGGACACTGGGG + Intergenic
1132644178 16:991245-991267 GGCCTCTGTGCCGGGCACTGTGG + Intergenic
1132726413 16:1340847-1340869 GGCCACTGTGCTGGGACCTCGGG - Intronic
1132924064 16:2418233-2418255 AGCCACCGTGCTGGGCCAAGTGG + Intergenic
1133111785 16:3552143-3552165 GGGCATTGTGCTGGGCACTGAGG + Intronic
1133243078 16:4427595-4427617 AGCCACTGTTCTGGGCACTGAGG + Intronic
1133245801 16:4447997-4448019 TGCCACTGGGCTGGGCGCAGTGG - Intronic
1133312087 16:4855056-4855078 TTGCACTGTGCTAGGCTCTGAGG + Intronic
1133357015 16:5143996-5144018 TGCGGCTGTTCTGGGCACTGTGG - Intergenic
1133433432 16:5758458-5758480 GGCCACTGTGCTGCGCTTTGGGG - Intergenic
1133631279 16:7624531-7624553 AGGCACTGTGCTGGGCTTTGGGG - Intronic
1133768208 16:8852335-8852357 TCCCACAGTGCTGGGACCAGAGG - Intergenic
1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG + Intronic
1133982964 16:10647180-10647202 TGCCAGTGGGCTGGGCGCGGTGG + Intronic
1134138088 16:11693119-11693141 TGGCCCTGTGCTAGGCCCCGGGG - Intronic
1134170728 16:11967287-11967309 TGAGTATGTGCTGGGCCCTGTGG - Intronic
1134316296 16:13122008-13122030 TTCCAATGTGCTGGGCACTGTGG - Intronic
1134794740 16:17024631-17024653 AGCCACCGTGCCCGGCCCTGTGG + Intergenic
1135131219 16:19855304-19855326 AGCCACTGCGCCTGGCCCTGTGG - Intronic
1135136185 16:19886329-19886351 TGGAACTGTTCTGGGCTCTGAGG - Intergenic
1135268676 16:21050252-21050274 GGACACTGTGCTGGGCTCTGAGG - Intronic
1135876079 16:26201236-26201258 AGGCACTGTGCTGGGTCCTGGGG - Intergenic
1135955845 16:26955675-26955697 GGCCACAGTGCTGAGCCTTGAGG - Intergenic
1135969910 16:27064841-27064863 AGGCAGTGTGCTGGGCCTTGAGG + Intergenic
1136477586 16:30523127-30523149 AGGCACTGTGCTTGGCACTGGGG - Exonic
1136666214 16:31815485-31815507 AGCCACTGTGCCTGGCCGTGCGG + Intergenic
1136703675 16:32167446-32167468 AGAAACAGTGCTGGGCCCTGTGG - Intergenic
1136764032 16:32760156-32760178 AGAAACAGTGCTGGGCCCTGTGG + Intergenic
1136804067 16:33110230-33110252 AGAAACAGTGCTGGGCCCTGTGG - Intergenic
1137021854 16:35436069-35436091 GGCCACTATGCTGAGCCCTAAGG + Intergenic
1137497974 16:48985504-48985526 AGGCACTGTTCTGGGCACTGGGG + Intergenic
1137692195 16:50436485-50436507 TACCACTGGGCTGGGCACGGGGG + Intergenic
1137863679 16:51871738-51871760 AGCCACTGTGTTAGGCCTTGAGG - Intergenic
1137870287 16:51943769-51943791 AGCCACTGTGCAGGGACCTGTGG - Intergenic
1138375798 16:56563252-56563274 AGGCACTGTGCTGGGCACTGGGG - Intergenic
1138513946 16:57525669-57525691 AGGCACTGTGCTCTGCCCTGAGG - Intronic
1138558007 16:57784170-57784192 TGGCACTGAGCTGGGCACGGGGG - Intronic
1139254569 16:65528699-65528721 GCCCACTGACCTGGGCCCTGGGG - Intergenic
1139311219 16:66029884-66029906 TGCCACTCTGCTGGGCCCTGGGG + Intergenic
1139314875 16:66059603-66059625 AGGCACTGTGCTGGGCACTGGGG - Intergenic
1139515053 16:67447760-67447782 TGCCCCTCTGCTGCGCCCTTTGG + Intronic
1139706565 16:68745013-68745035 TGCCACTGTGCAGGGTGCTCAGG + Intronic
1139738836 16:69017307-69017329 TGCCACTGTGCTGGGCCCTGGGG - Intronic
1139999679 16:71013035-71013057 GGGGACTGTGCTGGGCTCTGGGG + Intronic
1140045667 16:71439058-71439080 CCCCGCTGTGCTGGGCACTGAGG + Intergenic
1140185744 16:72769405-72769427 TGCCACTGGACTGTGCCATGTGG + Intergenic
1140715604 16:77722903-77722925 TGCCACTGTCGGGGGTCCTGGGG - Intronic
1140985760 16:80156757-80156779 TGACACTGAGCTGGGCCTTGAGG + Intergenic
1141065359 16:80909419-80909441 GTGCTCTGTGCTGGGCCCTGGGG - Intergenic
1141182568 16:81764253-81764275 AGCCACTGTACTGCACCCTGGGG + Intronic
1141203565 16:81915289-81915311 AGGCACTGTTCTGGGCTCTGGGG + Intronic
1141469537 16:84229009-84229031 TGCCACTGGGCTGGGCATGGTGG + Intronic
1141535864 16:84679214-84679236 AGCCACTGTGCCCGGCCCTCAGG - Intergenic
1141602376 16:85134548-85134570 TGGCCCTGGGCTAGGCCCTGAGG - Intergenic
1141674610 16:85511074-85511096 AGGCACTGTTCTGGGCACTGAGG - Intergenic
1142185612 16:88693467-88693489 GGCAGGTGTGCTGGGCCCTGGGG + Intergenic
1142288435 16:89181247-89181269 CGCCACTGTTCTGGGCAGTGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1203066381 16_KI270728v1_random:1022282-1022304 AGAAACAGTGCTGGGCCCTGTGG + Intergenic
1142743943 17:1945801-1945823 TGCCAGTGTTCTGGGCCCTGAGG - Intronic
1142994625 17:3753394-3753416 TGGCTCTGAGCTGTGCCCTGTGG - Exonic
1143090129 17:4445180-4445202 TGCCCCTGTCCAGGCCCCTGAGG + Intronic
1143176547 17:4958780-4958802 AGCCACTGTGCCCGGCCCAGAGG - Intergenic
1143203256 17:5126727-5126749 TGCCACTGTTCAGGCTCCTGGGG + Intronic
1143281566 17:5758423-5758445 AGGCACTGTGCTGGGGGCTGGGG - Intergenic
1143377863 17:6478024-6478046 TGCTACAGTGCGGGGCCCTCAGG - Exonic
1143649551 17:8255075-8255097 CGCCACTGGGCTGGGGCCTGTGG + Exonic
1143878925 17:10014790-10014812 AGCCACTGAGCCGGGCTCTGGGG - Intronic
1144038052 17:11384989-11385011 AGACACTGTTCTGGGCACTGAGG + Intronic
1144211959 17:13023357-13023379 GGGCACCGTGCTTGGCCCTGAGG - Intergenic
1144328736 17:14206067-14206089 TGCCATTGTGCCAGGCTCTGGGG + Intronic
1144678962 17:17180192-17180214 TGGCTCAGTGCTGGGCCCTGGGG - Intronic
1144774910 17:17780513-17780535 TCCCCCTGTCCTAGGCCCTGAGG - Intronic
1144779785 17:17802027-17802049 TGCCACCGTGCTGGGGGCGGGGG - Intronic
1144874420 17:18390052-18390074 TGCCACTGTTCAGGCTCCTGGGG + Intergenic
1145101233 17:20079678-20079700 TGGCAGTGTGCTAGGCCCTAGGG + Intronic
1145157805 17:20554368-20554390 TGCCACTGTTCAGGCTCCTGGGG - Intergenic
1145260847 17:21353628-21353650 AGGCACTGTGCTGGGCACTGGGG + Intergenic
1145800165 17:27677435-27677457 TGCCACTGTTCAGGCTCCTGGGG - Intergenic
1146024698 17:29309491-29309513 AGGCACTGTGCTAGGCTCTGGGG - Intergenic
1146230302 17:31101940-31101962 TAAGACTGTGCTGGGCACTGGGG - Intronic
1146448083 17:32949161-32949183 AGGCTCTGTGCTGGGCTCTGGGG + Intergenic
1146512467 17:33461959-33461981 TGCCACTGTGTCAGGCACTGGGG + Intronic
1146845584 17:36179671-36179693 TGCCACTGTTCAGGCTCCTGGGG - Intronic
1146873801 17:36391512-36391534 TGCCACTGTTCAGGCTCCTGGGG - Intronic
1146881158 17:36442602-36442624 TGCCACTGTTCAGGCTCCTGGGG - Intergenic
1147054861 17:37826268-37826290 AGACACTATGCTGGGTCCTGGGG + Intergenic
1147065589 17:37921359-37921381 TGCCACTGTTCAGGCTCCTGGGG + Intergenic
1147250065 17:39147822-39147844 AGGCACTGTGCTGGGTGCTGGGG + Intronic
1147252718 17:39162997-39163019 AGGCCCCGTGCTGGGCCCTGGGG + Intronic
1147292306 17:39453586-39453608 AGCCACTGTGCCCGGCCCAGAGG + Intergenic
1147316365 17:39622445-39622467 AGCCTCTGTGCTGGGCACCGGGG - Intergenic
1147452843 17:40516745-40516767 AGACACTGTGCAGTGCCCTGGGG - Intergenic
1147494586 17:40903807-40903829 TGGCACTGTTCTAGGCCATGAGG + Intergenic
1147557869 17:41490970-41490992 TGCCACCCTGCTGTGCCCAGTGG - Intronic
1147608970 17:41790320-41790342 AGCCACTGTGCCCGGCCCTAAGG - Intergenic
1147700677 17:42392352-42392374 AGCCACTGTGCTGGGCCTGTAGG - Intergenic
1147760143 17:42792713-42792735 TGGCATTGTGCTGGGTACTGTGG - Intronic
1147910223 17:43851611-43851633 GCCCACTGTGCTGGGCACAGAGG + Intronic
1148026752 17:44593972-44593994 TTCCCCTGTGCTAGGCACTGAGG - Intergenic
1148071435 17:44911100-44911122 AGGCACTGTGCTGGGCATTGAGG + Intronic
1148083227 17:44978862-44978884 TGGCACTGTGCTGGGCACTGGGG + Intergenic
1148092371 17:45030259-45030281 TGCCCCTCTGCTGGGCGCTCTGG - Intronic
1148140877 17:45327367-45327389 AGCCACTGTGCTTGGCCCCCAGG + Intergenic
1148156184 17:45426378-45426400 GGTCACTGTGCTGGACACTGGGG - Intronic
1148340277 17:46869289-46869311 TGCCTCTGGGGTGGGGCCTGAGG + Intronic
1148456259 17:47813128-47813150 TGGCTCTGTGCCGGGCTCTGCGG - Intronic
1148864806 17:50622936-50622958 AGGCCCTGTGCTGGGACCTGGGG + Intronic
1148997605 17:51724836-51724858 CACCAATGTGCTGCGCCCTGGGG - Intronic
1149295301 17:55256714-55256736 AGGCACTGTGCTGGGCACTGAGG - Intergenic
1149487256 17:57052396-57052418 TGCCACTGTGCTCTAGCCTGGGG + Intergenic
1149600216 17:57888665-57888687 TGCCTTTGTCCTGGGCTCTGGGG + Intronic
1149679756 17:58497653-58497675 TGGTACTGTGCTAGGCGCTGGGG - Intronic
1149960554 17:61105174-61105196 TTCCAATGTGCTGTGCCCTGCGG - Intronic
1149985994 17:61347495-61347517 AGGCACTGTGCTGTGCACTGGGG + Intronic
1150387853 17:64774996-64775018 GGTCACTGTGCTGGACACTGGGG - Intergenic
1150438857 17:65175593-65175615 GGACATTGTGCTGAGCCCTGGGG - Intronic
1150552103 17:66220395-66220417 AGGCAGTGTGCTGGGCACTGTGG - Intronic
1150780567 17:68118117-68118139 TGCCACTCTGTGGAGCCCTGTGG + Intergenic
1151002677 17:70396744-70396766 TGTCACTGTGCTAGTCTCTGGGG - Intergenic
1151070677 17:71207315-71207337 TGACACTGTGCTAGGCCCTTAGG - Intergenic
1151257710 17:72891942-72891964 GGACACTGTGCTAGGCCCTGAGG - Intronic
1151703446 17:75755091-75755113 TTCCGCTGTCCTGGGCCCTGGGG + Intronic
1151880464 17:76891663-76891685 AGCCACTGCGCCCGGCCCTGGGG + Intronic
1152315062 17:79575348-79575370 GGCCACTTTCCAGGGCCCTGAGG + Intergenic
1152488016 17:80608186-80608208 TGTCACTGTGCTGCGCCGTCGGG - Intronic
1152501034 17:80709133-80709155 TGGCACTGCCCTGTGCCCTGCGG - Intronic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1152755666 17:82086016-82086038 TGCCACTGGTCTTGTCCCTGGGG + Intronic
1153264377 18:3255095-3255117 AGGCACTGTGCTGGGCAGTGGGG - Intronic
1153323321 18:3794006-3794028 AGGCACTGTGCTGGACACTGGGG - Intronic
1153709529 18:7783892-7783914 GGCCACTGGGCTGGGCACAGTGG - Intronic
1153721418 18:7907239-7907261 CACCACTGTGGTGGCCCCTGGGG - Intronic
1153761630 18:8337531-8337553 TACCACTGTCCTGGCCCCAGTGG - Intronic
1154085625 18:11302943-11302965 AGCCCCTGTGCTGGGCCCCGGGG - Intergenic
1154208723 18:12360652-12360674 TGTCCCTGTGCTGGGCCCTCTGG - Intronic
1154330356 18:13424491-13424513 ACCTACTGTGCTGGCCCCTGGGG + Intronic
1155347315 18:24871105-24871127 AGGCACTGTGCTAGGCTCTGGGG + Intergenic
1156290386 18:35744387-35744409 TGCCACTGTGCTCGAGCCTGCGG - Intergenic
1156850765 18:41723299-41723321 TAGCACTGTGCTAGGCACTGGGG - Intergenic
1157086448 18:44585339-44585361 AGCCACTGTGCCTGGCCATGAGG - Intergenic
1157108656 18:44799053-44799075 AGCCATTGTGGTGGGCACTGTGG + Intronic
1157162795 18:45329722-45329744 AAGCACTGTGCTGGGCACTGTGG - Intronic
1157368669 18:47090146-47090168 TGCCACTGTACTGTAGCCTGGGG - Intronic
1157430073 18:47617347-47617369 TGCAACAGTGCTGGGACATGGGG + Intergenic
1157534835 18:48450541-48450563 TGCCACTGTACTGGGATCTGAGG - Intergenic
1157545663 18:48544830-48544852 TGTCTTTGTGCTAGGCCCTGGGG + Intronic
1157660288 18:49435500-49435522 AGCCACTGTGCCCGGCCTTGTGG - Intronic
1157838090 18:50927413-50927435 AGCCACCGTGCCCGGCCCTGTGG - Intronic
1157982665 18:52399618-52399640 TGACACTGAGGTGGGCCTTGAGG - Intronic
1158194819 18:54872878-54872900 AGCCACTGAGCTGAGCTCTGTGG + Intronic
1158392050 18:57051927-57051949 AGGCACTGGGCAGGGCCCTGGGG + Intergenic
1158414109 18:57234243-57234265 AGGCACTGTGCTAGGACCTGGGG + Intergenic
1158443835 18:57501502-57501524 GGCAACTGAGCTGAGCCCTGGGG + Intergenic
1158732542 18:60040381-60040403 TGCTACTGTGCTGGGCGCGGTGG - Intergenic
1158810676 18:61030265-61030287 TGCCAATGTGTTGGGCTTTGGGG - Intergenic
1159077991 18:63702794-63702816 AGCCACCATGCTGGGCTCTGGGG + Intronic
1159144245 18:64433110-64433132 AGCCTCTGTGCTGGCCCCTCAGG - Intergenic
1160223378 18:76992983-76993005 TGCCTTTGCCCTGGGCCCTGCGG - Intronic
1160391299 18:78535258-78535280 AGCCACCGTGCCCGGCCCTGGGG + Intergenic
1160425884 18:78778849-78778871 TGGCGCTGTGCCGGGCCCAGGGG - Intergenic
1160959062 19:1709739-1709761 TGCCACTGTGCTCCAGCCTGGGG - Intergenic
1161018599 19:1996893-1996915 TGCCTCTGGGCTGGGCGCGGTGG + Intronic
1161240535 19:3220818-3220840 TGCGTCTGTGCTGGGCCGAGTGG + Intergenic
1161315406 19:3615116-3615138 GGCCACCCTGCTGGCCCCTGGGG + Intronic
1161615213 19:5266413-5266435 AGCCACTGTGCCTGGCCCAGAGG + Intronic
1161675673 19:5647226-5647248 TGCCACTGAGCTGGATACTGAGG + Intronic
1161942097 19:7411592-7411614 TGCCACTTGGCTGGGCACGGTGG - Intronic
1161954318 19:7484485-7484507 CGCCACCGTGCCCGGCCCTGTGG - Intronic
1162037087 19:7946561-7946583 TGCCACTGCGCTCAGCACTGTGG + Intergenic
1162129353 19:8516149-8516171 TGCCACTGCACTGCGGCCTGGGG - Intergenic
1162490606 19:10989155-10989177 TCCCTCTCTGCTGTGCCCTGCGG + Intronic
1162527933 19:11217469-11217491 AGCCACTGTGCCTGGCCATGAGG - Intronic
1162873255 19:13601511-13601533 TGGCCCTGTGCTAGGTCCTGGGG + Intronic
1163150193 19:15407212-15407234 TGCCACTGTGCTCCAGCCTGGGG + Intronic
1163334502 19:16661775-16661797 GGCCACTGCGCTGGGGGCTGCGG + Intronic
1163360139 19:16840754-16840776 TCACACTGTTCTGGGCACTGGGG + Intronic
1163432001 19:17273846-17273868 AGCCACTGTGCCCGGCCCTGAGG + Intronic
1163476420 19:17528647-17528669 AGCAACTGTGCTGGGCGCTGGGG + Intronic
1163478648 19:17541493-17541515 TCTGTCTGTGCTGGGCCCTGGGG - Intronic
1163524188 19:17810490-17810512 TGGCACTATGCTGGGTGCTGAGG + Intronic
1163769509 19:19182346-19182368 TGGCCCTGGGCTGGGCACTGGGG - Intronic
1164145714 19:22511302-22511324 AGGCTCTGTGCTGGGCACTGGGG - Intronic
1164249430 19:23464293-23464315 TGCCTGTGTGCTGGGCCCCAGGG - Intergenic
1164509097 19:28882940-28882962 CGACTGTGTGCTGGGCCCTGCGG + Intergenic
1164799971 19:31068227-31068249 AGGCACTGTTCTGGGCCCGGTGG + Intergenic
1164950203 19:32330702-32330724 ATCCACAGTGCTGGGTCCTGAGG + Intergenic
1165047139 19:33114123-33114145 TGGCACTGTGTAGGGTCCTGGGG - Intronic
1165215833 19:34271791-34271813 TGCCACTGTGCTCTAGCCTGGGG + Intronic
1165444240 19:35848195-35848217 TTTCTCTGTGCTGGGTCCTGAGG + Intronic
1165463744 19:35959798-35959820 TGGCACGGTGCTGCGCTCTGTGG + Intergenic
1165725449 19:38109684-38109706 AGGCACTGTGCTGGGTACTGAGG + Intronic
1166295543 19:41887689-41887711 TGCCTCTGGGCTGTGCCCTCAGG + Intronic
1166873742 19:45885345-45885367 GGCCAATGGGCTGGGCCGTGAGG - Exonic
1166968074 19:46543043-46543065 TGACACTGTGCTGGGCATGGCGG + Intronic
1167003085 19:46757235-46757257 TGGGGCTGTGCTGGGCCCTGCGG - Exonic
1167022108 19:46885001-46885023 AGCCACTGTGCCTGGCCCAGGGG + Intergenic
1167152311 19:47717332-47717354 AGCCACTGCGCCCGGCCCTGGGG + Intronic
1167199431 19:48054110-48054132 TGGAGCTGTGCTGTGCCCTGGGG - Intronic
1167236626 19:48319567-48319589 TGCCACTGCGCTAGAGCCTGGGG - Exonic
1167312945 19:48747575-48747597 AGCCACCGCGCCGGGCCCTGAGG - Intergenic
1167479124 19:49718568-49718590 AGCCTCTGGGCTGGGCCCAGTGG - Intergenic
1168262070 19:55201076-55201098 TGAAACTGTGCTGGGCCATTGGG - Intronic
1168567660 19:57438592-57438614 TGCCACTGCAATGGACCCTGTGG - Intronic
1168714852 19:58520768-58520790 AGCCACTGCGCCGGGCCATGAGG - Intronic
1202647824 1_KI270706v1_random:157882-157904 AGCCCCTTCGCTGGGCCCTGGGG + Intergenic
1202648183 1_KI270706v1_random:159424-159446 AGTCCCTGCGCTGGGCCCTGTGG + Intergenic
1202648371 1_KI270706v1_random:160221-160243 AGCCACTGAGCTTGGCCCAGTGG + Intergenic
925107625 2:1306521-1306543 TCCTGCTGTGCTCGGCCCTGTGG - Intronic
925283585 2:2701658-2701680 TGCCCCTGTGCTTGCCCCTGAGG - Intergenic
925788203 2:7453437-7453459 AGGCACTGTGCTGGGCTCTGAGG + Intergenic
925953466 2:8937819-8937841 AGGCACTCTGCTAGGCCCTGGGG + Intronic
926021482 2:9499685-9499707 AGCCACTGTGCCGGGCCATCAGG + Intronic
926088515 2:10035231-10035253 AGCCACTGGGCTGGGCACTGGGG - Intergenic
926131611 2:10306322-10306344 TGTCACTGTGCTGGGGGGTGGGG + Intronic
926163496 2:10504051-10504073 CGCCACCGTGCCCGGCCCTGTGG - Intergenic
926316912 2:11716502-11716524 TGCCACTGTACTAGGCACTGGGG + Intronic
926549715 2:14287241-14287263 TACAATTGTGCTGGGCCCAGGGG - Intergenic
926687057 2:15706099-15706121 TGGCATTGTTCTGGGTCCTGGGG - Intronic
926705142 2:15831855-15831877 CGCCACTGTGCCTGGCCCTCTGG + Intergenic
926799153 2:16643910-16643932 AGGCACTGTGCTTGGCACTGGGG - Intronic
927194571 2:20538768-20538790 TGCCCCTGAGCTGGGCCCGCTGG + Intergenic
928179959 2:29062120-29062142 TGCCAAGGTGCTGGGGGCTGGGG - Exonic
928517637 2:32059264-32059286 AGCCACTATGCTTGGCCATGAGG - Intergenic
929142204 2:38676475-38676497 AGCCACTGTGCCTGGCCATGTGG - Intronic
929377235 2:41302755-41302777 AGCCACTGTGCCAGGCACTGAGG - Intergenic
929556936 2:42931517-42931539 TGTCCCTGGGCTGGGCCCTGTGG - Intergenic
929764929 2:44836540-44836562 TGCCACTGTGCAGGGGGCTGCGG - Intergenic
929825038 2:45303452-45303474 AGGCACTGTGCTGGGTGCTGGGG - Intergenic
929934989 2:46287907-46287929 CAACACTGTGCTGGGCCTTGGGG - Intergenic
930191699 2:48466510-48466532 AGCCACTGTGCCTGGCCCTTGGG + Intronic
930255682 2:49087464-49087486 TGACACTGCGCTAGGCCCTGAGG + Intronic
930318604 2:49827357-49827379 AGCCAGTGTGTTGGGCTCTGGGG + Intergenic
930541377 2:52711268-52711290 GGCCAGTGTGAGGGGCCCTGAGG - Intergenic
930604265 2:53476433-53476455 TGCCACTGTGCTTGGTGCTGGGG - Intergenic
930882794 2:56291322-56291344 AGGCACTGTGCTGGGCACTGGGG + Intronic
931706139 2:64947929-64947951 TGCCCCTCTACTGGGGCCTGAGG - Intergenic
932852682 2:75201534-75201556 AGGTACTGTGCTGGGCACTGGGG + Intergenic
933188146 2:79301801-79301823 AGCCACTGTGCCCGGCCCAGAGG - Intronic
933707105 2:85299579-85299601 AGCCACTGTGCCGGGCTCAGTGG - Intronic
933855280 2:86407754-86407776 AGCCACTGTGCCTGGCCCTAAGG - Intergenic
934729577 2:96648089-96648111 AACCACTGTGCCAGGCCCTGTGG + Intergenic
934739147 2:96706660-96706682 TGCCTCTCTGTTGGGGCCTGGGG - Exonic
935952658 2:108345158-108345180 AGCCACTGTGCTGTGCTGTGGGG + Intergenic
936151907 2:110026479-110026501 TGAGGCTGTGCTGAGCCCTGAGG + Intergenic
936152802 2:110030880-110030902 TGCCACTGCCCTGGTCCCAGGGG - Intergenic
936191878 2:110340532-110340554 TGCCACTGCCCTGGTCCCAGGGG + Intergenic
936192766 2:110344890-110344912 TGAGGCTGTGCTGAGCCCTGAGG - Intergenic
936928033 2:117758115-117758137 TGCCACTGTGCCTGGCCTGGTGG - Intergenic
936987621 2:118326704-118326726 TGACACTGTGGTAGGCCATGTGG - Intergenic
937034500 2:118769648-118769670 AGGCACTGTGCTAGACCCTGGGG - Intergenic
937067108 2:119025848-119025870 TGCCACTGTGAGGGGTCCAGAGG + Intergenic
937355140 2:121193563-121193585 TGGCCCTGTGCTGGGCACTGGGG + Intergenic
937357011 2:121204112-121204134 AGCCACTGTGCCGGGCCCTCAGG - Intergenic
937456365 2:122044997-122045019 AGGCACTGTGCTTGGCTCTGGGG - Intergenic
937635772 2:124153896-124153918 AGCCACTAAGCCGGGCCCTGGGG + Intronic
937776010 2:125776224-125776246 AGCCACTGTGCCCGGCCATGTGG + Intergenic
937913024 2:127085396-127085418 TGCTGCTGTGTGGGGCCCTGAGG - Intronic
938342397 2:130544299-130544321 GGCCCCTGCTCTGGGCCCTGAGG - Intronic
938347435 2:130576410-130576432 GGCCCCTGCTCTGGGCCCTGAGG + Intronic
938489281 2:131753590-131753612 AGCCCCTGCGCTGGGCCCAGTGG + Intronic
938489339 2:131753806-131753828 AGCCCCTGCGCTGGGCCCCGTGG + Intronic
938489551 2:131754604-131754626 AGCCCCTGCGCTGGGCCCTGGGG + Intronic
938489974 2:131756276-131756298 AGCCACTGCGCTTGGCCCCGTGG + Intronic
939571007 2:143839633-143839655 TTCCACTGTGCTTTGCCCTGGGG + Intergenic
940856083 2:158729695-158729717 AGACACTGTGCTGGGCCCAAGGG - Intergenic
940948407 2:159644987-159645009 AGCCACTGTGCCTGGCCCAGAGG - Intergenic
941568819 2:167143167-167143189 TGCCCCTGTGCTTGGCACTGGGG + Intronic
942011299 2:171765243-171765265 AGCCACTGTGTTTGGCCCTCAGG - Intergenic
942117056 2:172738293-172738315 AGGCACTGTGCTGGGCACTGGGG + Intronic
942186737 2:173431414-173431436 TGCACCTGTGCTGAGCCCCGTGG - Intergenic
942663659 2:178292692-178292714 AGGCACTGTTATGGGCCCTGGGG + Intronic
944690110 2:202151109-202151131 AGCCACCGTGCCTGGCCCTGTGG - Intronic
944863645 2:203839633-203839655 AGGCCCTGTGCTGGGCACTGAGG + Intergenic
945151436 2:206796219-206796241 AGCCACTGTGCCCGGCCCTGAGG - Intergenic
946007851 2:216540858-216540880 AGGCACTGTGCTAGGCACTGGGG - Intronic
946682275 2:222229896-222229918 AGCCATTGTGCTGGGCCCAGAGG - Intronic
947285788 2:228512836-228512858 AGCCACTGTGCTGGGCTCCAAGG - Intergenic
947437510 2:230085229-230085251 GGCCACTGAGATGGGGCCTGGGG - Intergenic
947498504 2:230656129-230656151 AGGAACTGTGCTGGGCACTGAGG + Intergenic
947763601 2:232621735-232621757 AGCCACTGTGCCTGGCCCAGTGG + Intronic
947800029 2:232923448-232923470 AGCCACTGCACTGGGCCTTGTGG - Intronic
947813059 2:233016247-233016269 AGGTACTGTGCTAGGCCCTGGGG + Intergenic
947949861 2:234137804-234137826 TGCCATTGTGCTGGCGCCAGAGG - Intergenic
948057031 2:235016178-235016200 GGCCACTGCACTGGGCCCAGGGG + Intronic
948161655 2:235829766-235829788 CCCCTCTGTGCTGGGCTCTGTGG + Intronic
948397769 2:237660310-237660332 TGCTAGTGTGCTGGGGCGTGGGG - Intronic
948409737 2:237749852-237749874 TGGCACTGTCCTGGGTGCTGAGG - Intronic
948536487 2:238651076-238651098 GGTCAATGTGCTGTGCCCTGAGG + Intergenic
948694712 2:239727404-239727426 TGCTTCTGTGCCGAGCCCTGAGG + Intergenic
948718359 2:239880737-239880759 GGTCACTGTGATGGGCTCTGGGG - Intergenic
948861247 2:240753603-240753625 CGCCACTGTGCTTGGCCCCTAGG - Intronic
1169011892 20:2257974-2257996 TGGCACAGTACTTGGCCCTGGGG + Intergenic
1169122668 20:3106800-3106822 TGCCATTGTGATGGCCACTGGGG - Intergenic
1169263650 20:4154919-4154941 GGCCACTCTGCTGGGAGCTGGGG + Intronic
1169429599 20:5524851-5524873 TGCCACTGTGCTCCAGCCTGGGG + Intergenic
1169449143 20:5696511-5696533 AGCCACTGTGCTCGGCCATCAGG - Intergenic
1169463841 20:5820439-5820461 GGACACTGTGCTAGCCCCTGGGG + Intronic
1169467349 20:5853123-5853145 AGACACTGTGTTAGGCCCTGGGG + Intronic
1170456762 20:16541009-16541031 TGCCACTTTGCTGGGTACTGAGG - Intronic
1170743379 20:19077554-19077576 TGCCACTCTGCTGCTCCCTCAGG + Intergenic
1170783720 20:19449537-19449559 TCCCACTGGGCTGAGCACTGTGG - Intronic
1170946116 20:20892349-20892371 GGCCACACTGCTGGGGCCTGAGG + Intergenic
1171154538 20:22860043-22860065 TGCCACTGTACTGGGCCTCTTGG - Intergenic
1171402315 20:24882788-24882810 TGCCACAGGGCTGGGGGCTGGGG - Intergenic
1171480869 20:25454748-25454770 TGCAGCAGTGCTGTGCCCTGAGG - Intronic
1171501021 20:25593390-25593412 TGCCACTGTGCCCAGCCCTTGGG - Intergenic
1172007029 20:31824652-31824674 AGGCCCTGTGCTGGGCACTGGGG + Intronic
1172123118 20:32610013-32610035 AGGCCCTGTGCTGGGCCCTGAGG - Intergenic
1172283731 20:33726278-33726300 TGCCTCTGTGCCAAGCCCTGGGG + Intergenic
1172286648 20:33745353-33745375 AGGCACTGTGCTGGGCACTGGGG + Intronic
1172360944 20:34312190-34312212 AGGCACTGAGCTGGACCCTGGGG - Intergenic
1172583778 20:36068100-36068122 AGCCACTGTGCCCGGCCCTGTGG + Intergenic
1172690787 20:36788222-36788244 TGCTGCTGGGCTGGGCCATGTGG + Intronic
1172822344 20:37748492-37748514 AGGCACTGTGCTAGGCCCTTAGG + Intronic
1172841435 20:37904636-37904658 AGCCCCAGTGCTGGGCACTGTGG + Intronic
1173036718 20:39418743-39418765 TGCCACTCTCCTGGTCCATGGGG + Intergenic
1173180253 20:40801206-40801228 TGGCACTGTGCTAGGCTTTGGGG + Intergenic
1173231309 20:41201070-41201092 GGCCACTATGGTTGGCCCTGGGG + Intronic
1173686537 20:44927632-44927654 AGCCACTGTGCCCGGCCCTTTGG + Intronic
1173826668 20:46052035-46052057 AGCCACTGTGCTGGGCGCTGGGG + Intronic
1173913992 20:46693041-46693063 AGGTACTGTGCTAGGCCCTGGGG + Intergenic
1174179795 20:48667733-48667755 GGCCCGTGTGCTGGACCCTGCGG + Intronic
1174274314 20:49392630-49392652 TGGCTCTGTGCTGGGCAGTGGGG - Intronic
1174374094 20:50113848-50113870 AGACACTGTGCTAGGCGCTGGGG + Intronic
1174417962 20:50379938-50379960 TGGCCCTGTGCTGGGCAGTGGGG + Intergenic
1174452458 20:50628721-50628743 TGGCCCTGTCCTGGGCTCTGGGG - Intronic
1174894484 20:54434376-54434398 TGGCACTGTTCTAGGCACTGGGG - Intergenic
1174919185 20:54683500-54683522 TGACACTCTTCTGGGCACTGTGG + Intergenic
1175264645 20:57695326-57695348 TGCCACTATCCTGGGCCCCCTGG + Intronic
1175272850 20:57746995-57747017 GGCCACTCTGCTGGCCCCTCTGG - Intergenic
1175340158 20:58223816-58223838 AGCCACTGTGCTGGGCCTGGAGG - Intronic
1175465764 20:59190653-59190675 TGGCACTGTGCTGGTGCCAGGGG + Intergenic
1175822608 20:61918448-61918470 TGGCGCTGTGCTGGACGCTGGGG + Intronic
1175828697 20:61950789-61950811 GGCCACAGGGCTGGGCCCAGTGG + Intergenic
1175833335 20:61978764-61978786 TCTCAGCGTGCTGGGCCCTGGGG - Intronic
1175890103 20:62312196-62312218 GGGCACTGTCCTGGGCGCTGTGG + Exonic
1176603482 21:8812468-8812490 AGCCACTGAGCTTGGCCCAGTGG - Intergenic
1176603667 21:8813271-8813293 AGTCCCTGCGCTGGGCCCTGTGG - Intergenic
1176604027 21:8814847-8814869 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
1176618052 21:9038610-9038632 AGCCTCTGAGCTGGGCCCAGGGG - Intergenic
1176618208 21:9039214-9039236 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1176618457 21:9040208-9040230 AGCCACTGCGCTTGGCCCCGTGG - Intergenic
1176618649 21:9041013-9041035 AGTCCCTGCGCTGGGCCCTGTGG - Intergenic
1176619007 21:9042521-9042543 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
1176706633 21:10123244-10123266 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1176707202 21:10125497-10125519 TGCCCTTGTGCTGGGCCCCGGGG + Intergenic
1177973916 21:27824510-27824532 AGCCACTGTGCCCAGCCCTGAGG + Intergenic
1178511718 21:33210840-33210862 TGCCAAGATTCTGGGCCCTGGGG - Intergenic
1179011932 21:37563179-37563201 TGGCACTGCGCTGGGCTCAGAGG - Intergenic
1179291365 21:40020884-40020906 ACCCACTGTGCTCTGCCCTGAGG + Intronic
1179309680 21:40184725-40184747 TGACATTGTGCTGGGTGCTGGGG + Intronic
1179464250 21:41561274-41561296 TGCCTCAGTGCTGGGACCTAGGG - Intergenic
1179504352 21:41830990-41831012 TGCAGCTCTGCTGGGCCCCGGGG - Intronic
1179974092 21:44853936-44853958 TGTGACTGTGCTGTGACCTGAGG - Intronic
1180065958 21:45412525-45412547 TGCCACTGTGCCCAGCCATGGGG + Intronic
1180087563 21:45514831-45514853 TGCCTTTGTGGTGGGCGCTGGGG - Exonic
1180160982 21:45998624-45998646 TCCCACTGTGGTGTGGCCTGTGG + Intronic
1180290668 22:10850178-10850200 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1180290767 22:10850619-10850641 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1180291027 22:10851709-10851731 AGCCCCTGAGCTGGGCCCAGGGG + Intergenic
1180291080 22:10851932-10851954 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1180345765 22:11704026-11704048 AGCCACTGAGCTTGGCCCAGTGG - Intergenic
1180345950 22:11704822-11704844 AGTCCCTGCGCTGGGCCCTGTGG - Intergenic
1180346311 22:11706424-11706446 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
1180384524 22:12169282-12169304 AGTCCCTGCGCTGGGCCCTGTGG + Intergenic
1180493469 22:15879599-15879621 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1180493568 22:15880046-15880068 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1180493829 22:15881134-15881156 AGCCCCTGAGCTGGGCCCAGGGG + Intergenic
1180493885 22:15881354-15881376 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1180822841 22:18843596-18843618 AGCCATTATGCTGGGCCCAGTGG - Intergenic
1181080236 22:20409396-20409418 AGCCACTGAGCTGGAACCTGAGG - Intergenic
1181166713 22:20987842-20987864 TGCCTCTGTGCTGGGCTCTGGGG - Intronic
1181190122 22:21132409-21132431 AGCCATTATGCTGGGCCCAGTGG + Intergenic
1181209081 22:21278095-21278117 AGCCATTATGCTGGGCCCAGTGG - Intergenic
1181502825 22:23328102-23328124 AGCCATTATGCTGGGCCCAGTGG + Intergenic
1181522910 22:23459716-23459738 TGCCACAGTCCTGGGCTGTGTGG - Intergenic
1181545335 22:23599224-23599246 TGCCCCTCTGCAGGGCTCTGGGG + Intergenic
1181672783 22:24433478-24433500 TGCTGGTGTGCTGGGCCGTGTGG + Exonic
1181859340 22:25806068-25806090 AGGCCCTGTGCTAGGCCCTGGGG - Intronic
1181894532 22:26095342-26095364 GGTCACTGTGCTGGGCACTTGGG + Intergenic
1182201771 22:28579680-28579702 AGCCACTGTGCTCAGCCCTTCGG - Intronic
1182213827 22:28699405-28699427 TGCCACTGTGCTCCAGCCTGGGG - Intronic
1182216802 22:28725573-28725595 AGCCACTGTGCCTGGCCATGTGG - Intronic
1182489936 22:30664837-30664859 TGTCTCTGTGCTTGTCCCTGGGG - Intronic
1182673404 22:32017029-32017051 AGCCACTGTGCCCGGCCATGGGG + Intergenic
1182796705 22:32996211-32996233 AGGCACTGTGCTGGGCTCTGAGG + Intronic
1182950592 22:34371834-34371856 TGAGATTGTGCTAGGCCCTGGGG + Intergenic
1182978253 22:34643520-34643542 TGACAATGTGCCAGGCCCTGTGG + Intergenic
1183262127 22:36802313-36802335 TGGCACTGGGCTGGGCACGGTGG + Intronic
1183268582 22:36846699-36846721 AGGCACAGTGCTAGGCCCTGGGG - Intergenic
1183271817 22:36867035-36867057 TGCCACTGTCCTGGGTGATGGGG + Intronic
1183395488 22:37568744-37568766 TTGCACTGTGCTGGGCACTGGGG - Exonic
1183861043 22:40670247-40670269 AGGCACTGTGCTAGGCTCTGTGG - Intergenic
1183992268 22:41605501-41605523 TGACATTGTTCTGGGCACTGAGG + Intronic
1184007327 22:41719994-41720016 TGGCCCTGTGCTGGGCTCTGAGG + Intronic
1184100981 22:42341708-42341730 TGGCCCTGTGCTGGACCCTGGGG + Intronic
1184210941 22:43035297-43035319 TGCCCCAGTGGAGGGCCCTGGGG - Intergenic
1184248814 22:43248949-43248971 AGGCCCTGTGCTGTGCCCTGAGG + Intronic
1184424014 22:44398518-44398540 AGCCACCGTGCCCGGCCCTGGGG - Intergenic
1184482405 22:44755535-44755557 TCCCACAGTGCAGGGCCCAGAGG - Intronic
1184635567 22:45826018-45826040 TGCCACTGTGCTGTAGCCTGGGG + Intronic
1184755227 22:46512076-46512098 GGCCACTGGGCTGGGATCTGGGG - Intronic
1184842885 22:47063007-47063029 TGCCACTGTGGTGACCCCAGAGG + Intronic
1184855000 22:47142049-47142071 TGCCACAGCTCTGGCCCCTGTGG + Intronic
1185068787 22:48645040-48645062 CTCCTCTGTGCAGGGCCCTGGGG - Intronic
1185096506 22:48808861-48808883 TGCCACAGGGCTTGGGCCTGTGG + Intronic
1185140561 22:49098595-49098617 TGCTTCTGTGATGGGCCCGGAGG - Intergenic
1185150618 22:49161724-49161746 GCCCATTGTGCTGGGCCCTGCGG + Intergenic
1185229741 22:49673378-49673400 AGACACTGTGCTGGGCCCTTGGG - Intergenic
1203217859 22_KI270731v1_random:17353-17375 AGCCATTATGCTGGGCCCAGTGG + Intergenic
1203272979 22_KI270734v1_random:69504-69526 AGCCATTATGCTGGGCCCAGTGG - Intergenic
949304132 3:2620456-2620478 TGCCACTGTGCTCCAGCCTGGGG + Intronic
949562124 3:5212861-5212883 GGGCTCTGTGCTAGGCCCTGGGG + Intronic
949568233 3:5265382-5265404 TAGTACTATGCTGGGCCCTGAGG - Intergenic
949959955 3:9303876-9303898 CTACAGTGTGCTGGGCCCTGGGG + Intronic
950243110 3:11389189-11389211 TGCCACTGTGCTCCAGCCTGGGG + Intronic
950399308 3:12758585-12758607 TGCCAGAGAGCTGGGCCATGGGG - Intronic
950432365 3:12958225-12958247 TGCCCCTGTGCTGGGTGCTGTGG - Intronic
950639558 3:14340029-14340051 TTCCCCTGTGCTGGCCCCAGAGG - Intergenic
950714719 3:14839509-14839531 TGCCCCTGTGCTGTGCCCCCGGG - Intronic
950958824 3:17083019-17083041 TGGCACTGTTCTAGGCTCTGAGG + Intronic
951850094 3:27129713-27129735 AGGCACTGTGCAAGGCCCTGGGG + Intronic
951956359 3:28258906-28258928 AGCCACTGTGCCTGGCCTTGTGG + Intronic
952383901 3:32825078-32825100 AGCCACTGTGCCTGGCCCTTAGG + Intronic
952494350 3:33902804-33902826 AGGCCCTGTGCTGGGCTCTGGGG + Intergenic
952508338 3:34028479-34028501 TGGCACTATGCTAGGCACTGGGG + Intergenic
952816236 3:37450585-37450607 TGGCACTGAGCTGGGCCTTGGGG + Intergenic
952828880 3:37546566-37546588 AGCTACTGTCCTAGGCCCTGGGG + Intronic
952858386 3:37792260-37792282 AGGCACTGTGCTAGGCACTGGGG + Intronic
952921120 3:38284433-38284455 TGGCACTGTGGTGGGCCTAGAGG - Intronic
953607076 3:44419201-44419223 AGCCACCGTGCTCTGCCCTGTGG - Intergenic
953666503 3:44929701-44929723 AGGCACTGTGCTTGGCACTGGGG - Intronic
953737761 3:45510899-45510921 TGGCACTGAGCTAGGCACTGGGG - Intronic
954045895 3:47930086-47930108 TGCCACTGTACTGCAGCCTGGGG + Intronic
954155117 3:48681155-48681177 TCTTACTGTGCTGGGCACTGGGG - Intronic
954448650 3:50560017-50560039 AGCCCCTGTGCTAGGGCCTGGGG - Intronic
954476190 3:50748290-50748312 AGCCAGTGTGCCTGGCCCTGTGG + Intronic
954550244 3:51475314-51475336 AGCCACTGTGCCTGGCCCAGAGG - Intronic
954699810 3:52445335-52445357 TGTCACTTTGCTGGAGCCTGGGG - Intergenic
954758836 3:52859632-52859654 TGCCACTGTACTCTACCCTGGGG + Intronic
954839035 3:53495111-53495133 GGGCACTGTGCTGGGCGTTGAGG - Exonic
954956171 3:54519926-54519948 TGGCACTGTTCTGGCCCCAGTGG - Intronic
955183663 3:56694240-56694262 AGGCACTGTGGTGAGCCCTGGGG - Intergenic
955312728 3:57905564-57905586 AGCCACTGTGCCCGGCCCAGGGG + Intronic
955479621 3:59376350-59376372 AGACACTGTTCTAGGCCCTGGGG + Intergenic
955662453 3:61315861-61315883 TGGCACTGTGTTGGTCACTGGGG + Intergenic
955863677 3:63359123-63359145 AGAAACTGTGCTGGGCTCTGGGG + Intronic
955938574 3:64126859-64126881 AGCCACTGTGCCCGGCCTTGTGG + Intronic
956001642 3:64735861-64735883 TGACACTGTGCTGGCCAGTGTGG - Intergenic
956161904 3:66364032-66364054 AGACACTCTCCTGGGCCCTGGGG + Intronic
956445459 3:69321594-69321616 AGGCACTGTTCTAGGCCCTGCGG - Intronic
956464998 3:69511353-69511375 AGCCACTATGCTAGGCCCTGAGG + Intronic
956517219 3:70062493-70062515 TGCTACTGTTCTGGGGCCTGAGG - Intergenic
957480704 3:80789829-80789851 TGGCACTGGGCTGGGCGCGGTGG + Intergenic
958797474 3:98721117-98721139 TGCCACTGTGCTGGACACATAGG + Intergenic
958905263 3:99935181-99935203 TGCATCTGTGCTTGGCCCAGGGG + Intronic
959584124 3:108010203-108010225 TAGCACTAGGCTGGGCCCTGTGG + Intergenic
959678154 3:109060789-109060811 TGCCTCTGTTCTGTGCTCTGGGG - Intronic
960000911 3:112731005-112731027 AGCCACTGTACTTGGCCCTTAGG - Intergenic
960050371 3:113233645-113233667 TAACAGTGTGCTGGGCTCTGGGG + Intronic
960899276 3:122538276-122538298 AGGCACTGGGCTGGGCACTGGGG + Intronic
960934500 3:122889577-122889599 GGCCACTGGGCTAGGCACTGAGG + Intergenic
961315297 3:126031414-126031436 TGCCACTGAGCGGGGCCTTGAGG - Intronic
961375541 3:126463021-126463043 GGGCACTGTGCTGGGGGCTGAGG - Intronic
961402309 3:126655980-126656002 AGATACTGTGCTGGGCGCTGCGG + Intergenic
961584077 3:127907962-127907984 AAGCACTGTGCTGGGCTCTGGGG + Intergenic
961620012 3:128216649-128216671 GGCCAGTGAGCTGGGCACTGAGG - Intronic
961636725 3:128337676-128337698 AGCTCCTGTGCTGGGCACTGAGG + Intronic
961643242 3:128378477-128378499 GGTCAGTGTGCTAGGCCCTGGGG - Intronic
961687918 3:128647647-128647669 GGCCACTGTGCTCTACCCTGGGG + Intronic
961806474 3:129492858-129492880 TGCCACTGCGCTTGAGCCTGGGG - Intronic
961984970 3:131122506-131122528 GGCCCCTGTCCTGGGCACTGAGG - Intronic
962321504 3:134394419-134394441 TGCCACTTAGCTAGGTCCTGTGG + Intergenic
962683623 3:137825090-137825112 TGAAACTGCGTTGGGCCCTGAGG - Intergenic
962923894 3:139974496-139974518 CTCCCCTTTGCTGGGCCCTGGGG - Intronic
964100850 3:152986521-152986543 TGCCACTGTTATAGGCACTGAGG - Intergenic
964475507 3:157094565-157094587 CCGCACTGTGCTGGGCACTGGGG + Intergenic
964545582 3:157829970-157829992 AGTTACTGTGCTGGGCCCTCGGG - Intergenic
964735220 3:159910528-159910550 TGTCACTCTGCTCGGTCCTGGGG - Intergenic
964913618 3:161812535-161812557 GGCCACTGTGCTGGTTACTGAGG + Intergenic
965294596 3:166927399-166927421 AGACACTGTGCTAGGTCCTGGGG - Intergenic
965431130 3:168590297-168590319 GGGCACTGTGCAGTGCCCTGTGG + Intergenic
965535318 3:169817908-169817930 TGATGCTGTGCTGGGCTCTGAGG - Intergenic
965629098 3:170712314-170712336 AGGCTCTGTGCTGGGCACTGGGG + Intronic
966449813 3:180045478-180045500 GGGCACTGTGCTCAGCCCTGAGG - Intergenic
966736689 3:183192422-183192444 AGCCACCGTGCTTGGCCTTGGGG + Intronic
966916299 3:184585908-184585930 AGGCACTGTGCTGGGCACTGGGG + Intronic
966960882 3:184937453-184937475 TACCAGTGTGCTAGGCCCTAGGG + Intronic
967302576 3:188030252-188030274 AGGCATTGTGCTGGGCTCTGAGG - Intergenic
967304885 3:188050672-188050694 TGCCACTGTGCTCCAGCCTGGGG - Intergenic
967457450 3:189704650-189704672 GAGCACTGTGCTAGGCCCTGAGG - Intronic
967732740 3:192920849-192920871 TGCCGTAGTGCTGGACCCTGGGG + Intergenic
967934001 3:194711965-194711987 GGCCACTGGGCTGGGCGCCGTGG - Intergenic
968182158 3:196603852-196603874 TGCTCCTCTGCTGGGCACTGTGG - Intergenic
968224825 3:196967094-196967116 AACCACTGTGCTGGGCGCGGGGG + Intronic
968469022 4:769164-769186 TGCCCCTGGGCAGGGCCATGTGG + Exonic
968524391 4:1048594-1048616 TGCCACTGGGCTAGGACCTCTGG - Intergenic
968565598 4:1310986-1311008 AGCCACTGTGCTTAGCCGTGAGG - Intronic
968812043 4:2804545-2804567 TCCTGCTGAGCTGGGCCCTGCGG + Intronic
968912830 4:3484650-3484672 TGACGCTGGGCTGGTCCCTGGGG + Intronic
968933426 4:3596812-3596834 AGCCACTGCGCCAGGCCCTGTGG + Intergenic
968938479 4:3625698-3625720 TCCCCCTGTGCCTGGCCCTGGGG - Intergenic
969044048 4:4323651-4323673 AGGCACTGTTCTGGGCACTGAGG - Intergenic
969045588 4:4334253-4334275 TGCCTCTGTGCTGGGTCTTTGGG + Intergenic
969435484 4:7186792-7186814 TGGCACTGTTCTAGGCCCTGGGG - Intergenic
969477533 4:7429991-7430013 GGCCACTGTCCTGGGCCCTGTGG + Intronic
969514203 4:7637539-7637561 GGGCACTGTTCTGGGCACTGAGG - Intronic
969625052 4:8298062-8298084 TGCCCCGGTGCTGGACCCGGAGG - Intronic
969700310 4:8764316-8764338 AGCCAGCGTGCAGGGCCCTGGGG - Intergenic
969782645 4:9421554-9421576 AGCCACTGTGGCCGGCCCTGAGG - Intergenic
970364974 4:15349385-15349407 GGGCACTGTGCTAGGCCCTTCGG - Intronic
970609710 4:17713797-17713819 AGGCTCTGTGCTGGGCACTGGGG + Intronic
971322475 4:25616580-25616602 AGCCACTGTGCCCGGCCTTGAGG + Intergenic
971341179 4:25770452-25770474 AGCCACTGTGCTCGGCCCAGAGG - Intronic
971691568 4:29843879-29843901 TGCCACAGAGCAGGGCCCTAGGG + Intergenic
972598863 4:40554084-40554106 AGGCACCGTGCTGGGTCCTGGGG - Intronic
972732486 4:41808612-41808634 AGGCACAGTGCTGGGCCCTGGGG - Intergenic
972861010 4:43169225-43169247 AGCCACTGTGCTGTGCTGTGGGG - Intergenic
973307432 4:48668611-48668633 TGCCACTGGGCTAAGCTCTGGGG + Intronic
973374090 4:49276071-49276093 AGCCCCTTCGCTGGGCCCTGGGG + Intergenic
973374203 4:49276495-49276517 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
973374456 4:49277574-49277596 AGTCCCTGCGCTGGGCCCTGTGG + Intergenic
973374597 4:49278181-49278203 AGCCACTGCGCTTGACCCTGTGG + Intergenic
973382814 4:49332060-49332082 AGCCACTGCGCTTGACCCTGTGG - Intergenic
973382955 4:49332667-49332689 AGTCCCTGCGCTGGGCCCTGTGG - Intergenic
973383209 4:49333744-49333766 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
973383322 4:49334168-49334190 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
973386433 4:49517104-49517126 AGCCACTGCGCTTGACCCTGTGG - Intergenic
973386581 4:49517709-49517731 AGTCCCTGCGCTGGGCCCTGTGG - Intergenic
973816272 4:54622358-54622380 AGCCAAAGTCCTGGGCCCTGTGG - Intergenic
974107614 4:57488469-57488491 TGCTACTGTTCTGGGCTTTGAGG - Intergenic
974530954 4:63107418-63107440 TGGCGCTGTGCTGGTCCCAGAGG + Intergenic
975544482 4:75547199-75547221 TGTCACTGTGCCAAGCCCTGGGG + Intronic
976188470 4:82466702-82466724 TGCCACTGTGCTCCAGCCTGGGG - Intergenic
976709118 4:88050324-88050346 TGCCACTGTTCTAGGCACTGGGG + Intronic
977656157 4:99523159-99523181 AGGCACTGTGCTGGGACCTGGGG - Intronic
978765099 4:112397060-112397082 AGCCACAGTGCCTGGCCCTGTGG + Intronic
978802536 4:112769331-112769353 TGACTCTGTGCTGGGCAATGTGG - Intergenic
979672958 4:123380672-123380694 GGGCACTGTGCTGGGGACTGTGG + Intergenic
980101221 4:128543267-128543289 AGGCACTGTGCTAGGCTCTGAGG - Intergenic
981071504 4:140545334-140545356 GGGCACAGGGCTGGGCCCTGAGG - Intronic
982069036 4:151679177-151679199 AGCCACTGTGCCCGGCCCTCTGG + Intronic
982333625 4:154209775-154209797 TGGCACTGTGCTGGGATTTGGGG - Intergenic
982358066 4:154490905-154490927 CGCCACGCTGCTGGGCGCTGTGG - Intronic
982762962 4:159309414-159309436 TGGCACTGTGCTAGGCTCTAGGG - Intronic
982778867 4:159469360-159469382 TGCCTCTGAGCTGTGTCCTGGGG + Intergenic
983556712 4:169065690-169065712 AGCCACTGTGCCTGGCCCAGTGG - Intergenic
984497352 4:180515470-180515492 GGGCACTGTGCTGGGTACTGAGG + Intergenic
984702026 4:182824822-182824844 TAACACTGTGCTGGAGCCTGGGG - Intergenic
984853975 4:184177216-184177238 AGCCACTGTGCTGCGCTGTGGGG - Intronic
984969654 4:185176396-185176418 AGCCACTGTGCCTGGCCCGGTGG + Intronic
985721560 5:1492262-1492284 TGTCTCTGAGCTGGGGCCTGGGG + Intronic
985721567 5:1492288-1492310 TGTCTCTGAGCTGGGGCCTGGGG + Intronic
985776869 5:1848911-1848933 TGCCACAGCGCAGGCCCCTGAGG + Intergenic
985779016 5:1860169-1860191 TGCCACTTTTCTGAGCCCTCTGG + Intergenic
986281590 5:6327544-6327566 GGCCACTGTGCCTGGCCCTGAGG - Intergenic
986351576 5:6885195-6885217 TGGCACTGTTCTGGGCACTGGGG + Intergenic
986429421 5:7666551-7666573 AGCCACTGTGCTTGGCCGGGTGG + Intronic
988470364 5:31532044-31532066 TGCCACTGTCTTGGTACCTGCGG - Exonic
988523915 5:31969850-31969872 CGCCACTGTGCTGGTGCATGAGG + Intronic
988727532 5:33939098-33939120 TGCCGGTGAGCTGGGCCCGGAGG + Intergenic
989204734 5:38799254-38799276 AGCCACTGTGCCCAGCCCTGAGG + Intergenic
989276811 5:39598991-39599013 AGCCACTGTGCTGCGCTCTGGGG + Intergenic
990428574 5:55712458-55712480 AGCCTCGGGGCTGGGCCCTGCGG - Exonic
990571819 5:57086440-57086462 AGCCACCGTGCTCAGCCCTGTGG + Intergenic
990860774 5:60324378-60324400 AGGCACTGTGCTGGGTCCTATGG - Intronic
990940736 5:61200612-61200634 AGCCACTGTGCTGTGCTGTGGGG + Intergenic
992116743 5:73545580-73545602 AGAGACTGGGCTGGGCCCTGGGG - Intergenic
992803061 5:80310523-80310545 AGCCACCGTGCCCGGCCCTGGGG + Intergenic
992993359 5:82308053-82308075 AGCCACTGTGCTCAGCCATGAGG - Intronic
994953229 5:106493374-106493396 TGTCACTGAGCTGGGCACAGTGG + Intergenic
995052229 5:107719641-107719663 AGCCACTGTGCTGCGCTGTGGGG - Intergenic
995288894 5:110426357-110426379 TGGCACTGTGTTGGGCACTGAGG - Intronic
995705689 5:114986918-114986940 TGCCACTGTACTGCAGCCTGAGG + Intergenic
995914272 5:117224594-117224616 AGACACTGTGCTAGGCCTTGAGG - Intergenic
996546018 5:124679500-124679522 AGCCAATGTGCTGGGCACCGGGG + Intronic
996718730 5:126609630-126609652 TGCTAAAGTGCTGGGCACTGTGG - Intronic
996829651 5:127726619-127726641 AGCCACTGTGCTGTGCTGTGGGG - Intergenic
997348413 5:133210774-133210796 AGCCACTGTGCCCGGCCCAGAGG + Intronic
997465557 5:134085600-134085622 AGCCACTGCGCCTGGCCCTGTGG - Intergenic
997653492 5:135538770-135538792 AGGCACTGTGCTGGACACTGGGG + Intergenic
997775231 5:136598179-136598201 GGCCACTGTGTTAGGCTCTGAGG - Intergenic
997835361 5:137187634-137187656 AGGCACTGTGCTGGGCACTATGG + Intronic
997953622 5:138261406-138261428 TGCAACTGTGCTGGGCGCAGTGG + Intronic
998262339 5:140641017-140641039 GGACACTGTGCTGGTCACTGAGG + Intronic
998536948 5:142942030-142942052 AGCCACTGTGCTGGGCAATGGGG - Intronic
998562152 5:143181594-143181616 AGCCACTGTGCTTGGCACTGAGG - Intronic
999190976 5:149747508-149747530 TGCCTGCCTGCTGGGCCCTGGGG - Intronic
999192238 5:149756963-149756985 AACCACTGTGCTTGGACCTGGGG + Intronic
999701628 5:154233721-154233743 TGATACTGTGCTAGGCCCTGAGG + Intronic
999827326 5:155286280-155286302 AGGCACTGTGCTGGATCCTGGGG + Intergenic
1000073134 5:157759848-157759870 TGTCAGTTTTCTGGGCCCTGAGG + Exonic
1000125769 5:158242381-158242403 TGGCATCGTGATGGGCCCTGGGG + Intergenic
1000138788 5:158381231-158381253 AGGCACTGTGCTAGGCCCAGGGG - Intergenic
1000232545 5:159329580-159329602 TCCCTCTGTGCTGGACTCTGGGG - Intronic
1000284936 5:159818919-159818941 AGACACTGTGCTAGGCACTGGGG + Intergenic
1000293874 5:159896088-159896110 AGGCACTGTGCTAGGTCCTGGGG - Intergenic
1000719871 5:164693290-164693312 AGCCACTGTGCTGCACTCTGAGG - Intergenic
1001022440 5:168194969-168194991 CGTCACTGAGCTGGGCCCAGGGG - Intronic
1001086937 5:168707344-168707366 TGCCCCTCTGCTGACCCCTGTGG - Intronic
1001105275 5:168848115-168848137 TGGCACTGCGCTAGGCACTGGGG - Intronic
1001599977 5:172922524-172922546 GGCCTCTCTGTTGGGCCCTGAGG + Intronic
1001690715 5:173630738-173630760 AGGCACTGTGGTGGGCACTGGGG + Intergenic
1002026469 5:176399221-176399243 AGGCACTGTGCTGGGCTCTGGGG - Intronic
1002047860 5:176552141-176552163 TGCCCCTGGGCTGGGACTTGCGG - Intronic
1002076059 5:176709177-176709199 GGGGACTGTTCTGGGCCCTGAGG - Intergenic
1002596567 5:180327626-180327648 TTACTGTGTGCTGGGCCCTGGGG - Intronic
1002932470 6:1644034-1644056 AGTCACAGCGCTGGGCCCTGGGG - Intronic
1003024899 6:2545846-2545868 AGGCACTGTGCTAGGCCCTGAGG - Intergenic
1003250755 6:4427696-4427718 TACCACGGTGCTGGGCATTGGGG + Intergenic
1003643526 6:7895632-7895654 AGCCACTGCGCTGGGCACTCTGG - Intronic
1003959836 6:11198681-11198703 AGGCACTGTACTAGGCCCTGTGG - Intronic
1004487918 6:16085304-16085326 TGCCACTGTTCTGGTCACTGGGG + Intergenic
1004714406 6:18203563-18203585 TCACACTGTGCTGGGCGCGGTGG + Intronic
1005338560 6:24821469-24821491 AGCCACAGAGCTGGGCACTGTGG - Intronic
1005349362 6:24919026-24919048 TGAAACTGTGCTGGGCCCATGGG - Intronic
1005357610 6:24999595-24999617 TGCCACTGTGCTCCAACCTGGGG - Intronic
1005752557 6:28896887-28896909 TGCCCATGTGGTGGTCCCTGTGG - Intergenic
1005882242 6:30070611-30070633 TGACTCTGGTCTGGGCCCTGTGG - Exonic
1006105397 6:31713457-31713479 TGCTTCTGTGCTGGGCCCTTTGG - Intronic
1006330403 6:33386248-33386270 TCCCAAAGTGCTGGGCCCAGCGG - Intergenic
1006436301 6:34027667-34027689 GGCCAGTGTGCAGGGCCCCGGGG + Intronic
1006502295 6:34466482-34466504 TGCCACTGCGCTGGGTCCCTTGG + Intronic
1006646893 6:35521125-35521147 TCCCACTGTGGGGGGCCCAGTGG - Intergenic
1006835723 6:36997781-36997803 AGCCCCTGTGCTGGGACCTTGGG - Intergenic
1006925443 6:37651830-37651852 AGGCACTGTGCTAGGTCCTGGGG - Intronic
1007057048 6:38896826-38896848 TGCCACTGTGCTCCAGCCTGGGG - Intronic
1007104173 6:39272180-39272202 GGGCACTGTGCTGCACCCTGTGG + Intergenic
1007125377 6:39421840-39421862 GGTCACTGTGCTGGGCTCTGTGG + Intronic
1007231102 6:40348160-40348182 GGCCCCTGTGCTTGGCCCTCAGG + Intergenic
1007291414 6:40789991-40790013 TGGTACTGTGCTGGGCACTGTGG - Intergenic
1007352646 6:41285025-41285047 AGGCACTGTGCTGGGCTCTTTGG + Intronic
1007413554 6:41678995-41679017 TGGCCCTGTGCTGGGTGCTGGGG - Intergenic
1007762400 6:44140706-44140728 AGCCACTGTGCTGGGTTCTCAGG + Intronic
1007822307 6:44569704-44569726 AGTCACTGTACTGGGTCCTGGGG - Intergenic
1007822692 6:44572551-44572573 TGCCTCTGTGCTCAGCCCTCTGG + Intergenic
1007881726 6:45175673-45175695 TACCATGGTGCTAGGCCCTGAGG + Intronic
1007995869 6:46307166-46307188 AGGCACTGTGCTGGGTGCTGGGG + Intronic
1008054951 6:46936600-46936622 AGACACTGTTCTAGGCCCTGGGG + Intronic
1008158833 6:48052033-48052055 AGACACTGTGCTTGGCACTGGGG - Intronic
1008458514 6:51740314-51740336 TGACAATATGCTGGGACCTGTGG + Intronic
1009543517 6:64996478-64996500 TGACACTATGCTGGTCTCTGAGG - Intronic
1009760628 6:68000657-68000679 TGTCACTGTGCAAGGCACTGAGG - Intergenic
1011003085 6:82613470-82613492 AGGCACTGGGCTGGGCCCTCTGG + Intergenic
1011151297 6:84276316-84276338 AGACACTGTGCTTGGTCCTGGGG + Intergenic
1011477636 6:87763622-87763644 AGCCACTGTGCCCGGCCCTCCGG - Intergenic
1011494959 6:87928445-87928467 TGGCATTGTGCTTGGCCCTCTGG - Intergenic
1012601680 6:101106131-101106153 AGTCACTGTGCTAGGGCCTGAGG + Intergenic
1012961760 6:105629767-105629789 TGGCACTGTACTTGGCACTGGGG + Intergenic
1013081109 6:106814099-106814121 TGGAACTGGGCTGGGCACTGTGG + Intergenic
1013190642 6:107802116-107802138 TGCCAGTGTTCTGAGCACTGAGG + Intronic
1013454788 6:110320719-110320741 AGGAACTGTTCTGGGCCCTGAGG - Intronic
1014221144 6:118799990-118800012 AGGCACTGTGCTAGGCACTGGGG - Intergenic
1014760737 6:125354113-125354135 TGCCTCTGTGGTGGGGACTGGGG - Intergenic
1014951444 6:127560546-127560568 AGCCACTGTGCTTGGCCTTGTGG - Intronic
1015759941 6:136647890-136647912 TGGGACTGTGCTGGTTCCTGAGG - Intronic
1015888626 6:137946489-137946511 TGCCTCCGTTCTGAGCCCTGTGG - Intergenic
1016250522 6:142035578-142035600 AGCTACTGTGCCAGGCCCTGTGG + Intergenic
1017669411 6:156755763-156755785 AGCCACTGTGCCCGGCCCAGAGG + Intergenic
1017842406 6:158232394-158232416 TGCCCCTGCGGTGGGCCCCGGGG + Intronic
1017956387 6:159181460-159181482 GGGCACTGTGCTAGGCTCTGGGG + Intronic
1018198101 6:161372509-161372531 AGGCACTGTCCTGGACCCTGGGG + Intronic
1018362189 6:163082338-163082360 TGCAAATGTGCTTGGCCCTTTGG - Intronic
1018785468 6:167104588-167104610 TGCCACTGTGGTGCCCACTGAGG - Intergenic
1018809999 6:167292274-167292296 TGCCACAGTGTTGTACCCTGTGG + Intronic
1018859510 6:167700505-167700527 TTTGCCTGTGCTGGGCCCTGAGG - Intergenic
1019293961 7:264141-264163 CGCCACTGTGCCCGGCCCTGGGG - Intergenic
1019333610 7:472265-472287 TGCAAGTGAGCTGGGGCCTGTGG - Intergenic
1019491645 7:1316652-1316674 TGCCACTGTACTCCACCCTGGGG + Intergenic
1019497308 7:1346559-1346581 AGCCCATGTGCGGGGCCCTGTGG + Intergenic
1019588415 7:1816821-1816843 TGCCACGGTCCTGGGCTGTGTGG + Intronic
1019719674 7:2560431-2560453 TGCAGCTGTGCTGAACCCTGTGG - Intronic
1019927794 7:4204776-4204798 TGTCCATGAGCTGGGCCCTGGGG - Intronic
1020007916 7:4792157-4792179 CGCCACCTTCCTGGGCCCTGTGG + Intronic
1021279799 7:18703774-18703796 TGACACTGCCCAGGGCCCTGGGG - Intronic
1021462098 7:20900335-20900357 TGCCACTGTGCTCCAGCCTGGGG - Intergenic
1021616021 7:22504151-22504173 GACAACTGTGTTGGGCCCTGGGG + Intronic
1021640079 7:22728082-22728104 TGCCACTTTGGTGGGCTCTGAGG - Intronic
1021764447 7:23932739-23932761 AGGCACTGTGCTAGACCCTGGGG + Intergenic
1022201707 7:28123493-28123515 TGCTACTGTGCTGGTCACTGGGG - Intronic
1022925812 7:35055354-35055376 GACAACTGTGTTGGGCCCTGGGG + Intergenic
1023010500 7:35921151-35921173 AGCCACTGTGCCGGGCCAAGGGG - Intergenic
1023317120 7:38950468-38950490 GGCCAATGAGCTGTGCCCTGAGG - Intergenic
1024034397 7:45495242-45495264 AGCCACTGTGCTGTGCCGTGGGG + Intergenic
1024038780 7:45533248-45533270 TGACACCATGCTTGGCCCTGTGG + Intergenic
1024589966 7:50872700-50872722 AGCCACTGTGCTGTGCTGTGGGG - Intergenic
1024643293 7:51349583-51349605 AGCCACTGTGCTGGGCCCAGGGG + Intergenic
1025064166 7:55838834-55838856 TGAAACTGGGCTGGGCTCTGTGG - Intronic
1026319434 7:69256123-69256145 TGTCTCTGGGCTGGGCACTGTGG + Intergenic
1026524455 7:71142153-71142175 AGCCACTATGCGGGGCCCTCAGG + Intronic
1026546162 7:71324363-71324385 AGCCACTGTGCTGGGCCTCTTGG - Intronic
1026820500 7:73544771-73544793 AGCCACTGTGCCTGGCCCTTGGG - Intronic
1026847505 7:73706129-73706151 TGCCCCTCTGCTTGCCCCTGGGG + Intronic
1026982277 7:74533746-74533768 AGCCACTGTGCCTGGCCTTGTGG - Intronic
1027005232 7:74687176-74687198 TGACACTTGGCTGGGCCCAGTGG - Intronic
1027381128 7:77610606-77610628 AGACACTGTGCTTGGCACTGTGG - Intronic
1028111738 7:86949855-86949877 TGCCACTGTTCTGGGCACCCAGG - Intronic
1028234060 7:88338888-88338910 AGCCACTGTGCCTGGCCCTCAGG + Intergenic
1028445428 7:90916523-90916545 TGCCACTGTCCAGGGCCCTCAGG + Intronic
1029823818 7:103170047-103170069 GACAACTGTGTTGGGCCCTGGGG + Intergenic
1029893071 7:103951956-103951978 AGCCACTGTGCCCGGCCCTCTGG + Intronic
1030023697 7:105301154-105301176 TGCCACTTGGCTGGGCGCAGTGG + Intronic
1030045803 7:105494337-105494359 AGCCACTGTGCCAGGCCGTGAGG - Intronic
1030335336 7:108319344-108319366 AGGCACTGTTCTGGGCACTGAGG + Intronic
1030371096 7:108700093-108700115 TTCCATTGTGATGGGGCCTGGGG + Intergenic
1031319955 7:120312190-120312212 AGCCACTGTGCCTGGCCCTTAGG + Intronic
1032345610 7:131113780-131113802 TGCCACTGTGCTCCGGCCTGGGG + Intronic
1032602653 7:133315986-133316008 AGCCACTGTCCTAGGCCTTGAGG - Intronic
1032666914 7:134046194-134046216 AGCCATTGTGCCCGGCCCTGAGG - Intronic
1032773160 7:135080341-135080363 TGCCACTGTGCTTGGTGCTAGGG + Intronic
1033127216 7:138716847-138716869 AGCCACTGTGCCTGGCCATGGGG + Intronic
1033157179 7:138967115-138967137 AGGCACTGTGCTGGGCCCTTGGG - Intronic
1033210897 7:139459570-139459592 AGCGCCTGGGCTGGGCCCTGAGG - Intronic
1033426686 7:141251097-141251119 TGTGGCTCTGCTGGGCCCTGAGG + Intronic
1033772315 7:144566142-144566164 TGCCACTGTACTCCACCCTGGGG - Intronic
1034066932 7:148146019-148146041 TGCCTCTGTGTTGGGCCCCTTGG - Intronic
1034412001 7:150946781-150946803 TGCCTTTCTGCTGGGCTCTGTGG - Intronic
1034437436 7:151069893-151069915 TGCCACTGTTTTGTGACCTGGGG + Intronic
1034475233 7:151277764-151277786 CCCCTCTGTGCTGGGCACTGTGG - Intronic
1035228035 7:157444302-157444324 TGCCTCGCTGCTGTGCCCTGGGG - Intergenic
1035273128 7:157732036-157732058 AGTAACTGTGCTGGGCCATGGGG - Intronic
1035731126 8:1854154-1854176 AGACACTGCCCTGGGCCCTGGGG - Intronic
1036147644 8:6269579-6269601 AGCCGCTGTGCCGGGCCCAGAGG - Intergenic
1036711568 8:11082752-11082774 GGCCACTGGGCTGGGCCTTTGGG + Intronic
1036936910 8:13012106-13012128 CGCCAGTGTACTGAGCCCTGTGG + Intronic
1037249588 8:16877092-16877114 AGCCACTGTGCTGTGCTGTGGGG + Intergenic
1037821124 8:22135023-22135045 TGGCCCTGTGCTGGGCGCTGGGG + Intergenic
1038146955 8:24905921-24905943 AGGCACTGTGCTGGCCACTGGGG - Intergenic
1038533123 8:28334779-28334801 TGCTACTGTGCTGGGCATGGTGG - Intronic
1039890991 8:41685214-41685236 GGCCACTGTGGTGGGCACGGTGG - Intronic
1040275460 8:46011523-46011545 TGCTGCTTTGGTGGGCCCTGTGG + Intergenic
1040276288 8:46015766-46015788 TGCCACTTTGCAGTGCCCCGTGG + Intergenic
1040277372 8:46020920-46020942 TGCCACTTTGGGGTGCCCTGTGG + Intergenic
1040278368 8:46025333-46025355 AGCCCCTGGGCTGGGCCCGGAGG - Intergenic
1040466697 8:47702279-47702301 AGCCACTGTGCTAAGCACTGGGG + Intronic
1040978152 8:53216775-53216797 AGGCACTGTGCTGGGCCCTGAGG + Intergenic
1041173932 8:55173611-55173633 TGGCACTGTGCTAGGCAGTGGGG - Intronic
1041528574 8:58836864-58836886 AGGCACTGTTCTGGGCACTGAGG - Intronic
1041862296 8:62528417-62528439 TGTCACTGTGGTGGGCTTTGTGG + Intronic
1041864055 8:62548413-62548435 TGCCCCTGTCCAGGGGCCTGGGG + Intronic
1042632669 8:70836804-70836826 AGGCACTATGCTGGGCACTGGGG + Intergenic
1042801280 8:72720659-72720681 AGTCACTGTGCTGGGCCCTGGGG - Intronic
1042837405 8:73091116-73091138 AGGCCCTGTGCTAGGCCCTGAGG - Intronic
1042983456 8:74556343-74556365 TGACATTGTACTGAGCCCTGGGG + Intergenic
1043092566 8:75924230-75924252 AGCCACTGTGCTGTGCTGTGGGG - Intergenic
1043605983 8:82000385-82000407 AGCCACTGTGCCCGGCCCAGAGG + Intergenic
1044108025 8:88236469-88236491 AGCCACTGTGCCTGGCCCTAGGG - Intronic
1044434595 8:92147280-92147302 AGCCACTGTCCTGGGTCTTGGGG + Intergenic
1044853820 8:96454287-96454309 CAATACTGTGCTGGGCCCTGGGG + Intergenic
1045406003 8:101867380-101867402 AGGCACTGTGCTAGGTCCTGGGG - Intronic
1045465800 8:102468754-102468776 AGCCACTGTGCTTGGCCTGGAGG - Intergenic
1045506230 8:102780776-102780798 GACCACTGTGCTGGGCCCTGGGG + Intergenic
1045640913 8:104249218-104249240 TTCCACTGGGCTGAGCCCAGTGG - Intronic
1045706584 8:104930467-104930489 GGACACTGTGCTGGTCACTGGGG - Intronic
1046183731 8:110686275-110686297 AGCCACTGTGCTAGGTGCTGTGG + Intergenic
1046620842 8:116528100-116528122 AGCCACTGTGCTGGATGCTGGGG + Intergenic
1047416064 8:124665580-124665602 AGCCACTGTGCCCGGCCTTGGGG - Intronic
1047694774 8:127392713-127392735 AGGCACTGTACTGGGCACTGTGG + Intergenic
1047772000 8:128037161-128037183 GGGCACTGTGCTGGGGCCTTAGG + Intergenic
1048018381 8:130517462-130517484 GGCTACTGTGCTAGGCCCTTTGG + Intergenic
1048296412 8:133217838-133217860 AGCCACTGTGCTGGGGACTCCGG + Intronic
1048491409 8:134897060-134897082 TCCCACTGTTCTGGGGTCTGTGG - Intergenic
1048933761 8:139338640-139338662 TGCACCTGTGCTGGGCCCTGTGG + Intergenic
1049031962 8:140044582-140044604 AGGCTCTGTGCTGTGCCCTGGGG - Intronic
1049641943 8:143719786-143719808 TGTCACTGTGCCGGGAGCTGGGG + Intronic
1049698068 8:143993303-143993325 TATCCCTGTGCTGAGCCCTGAGG + Exonic
1049820415 8:144629945-144629967 GGACACTGTGGGGGGCCCTGGGG + Intergenic
1049970144 9:814974-814996 AGCCACTGTGCTGGGCCCCTTGG - Intergenic
1050170158 9:2807309-2807331 AGCCATTGTGCTTGGCCCTTAGG - Intronic
1050494882 9:6230337-6230359 TGCCACTTTCCTGGACCCTGGGG - Intronic
1051235432 9:14993701-14993723 AGACATTGTGCGGGGCCCTGCGG + Intergenic
1051277334 9:15409261-15409283 AGCCACTGTGCCTGGCCTTGGGG + Intergenic
1052913670 9:33906987-33907009 TGCCACTGCACTGGAGCCTGGGG + Intronic
1052987591 9:34499465-34499487 TGGCCCTGTGCTAGGCACTGGGG + Intronic
1053066628 9:35073626-35073648 TGTCACTGTCCTGGGCTTTGGGG + Intergenic
1053244059 9:36519990-36520012 TGCCACTGTACTCTGGCCTGGGG - Intergenic
1053391790 9:37741147-37741169 GGCAAATGGGCTGGGCCCTGTGG + Intronic
1053515724 9:38729211-38729233 GGGCACTGTGCTGGGTTCTGAGG + Intergenic
1053643928 9:40110364-40110386 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1053644450 9:40112434-40112456 AGCCCCTGAGCTGGGCCCAGGGG + Intergenic
1053761652 9:41352837-41352859 CGCCCTTGTGCTGGGCCCCGGGG - Intergenic
1053761710 9:41353055-41353077 AGCCCCTGAGCTGGGCCCAGGGG - Intergenic
1053762224 9:41355125-41355147 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1054324784 9:63707593-63707615 AGCCCCTGCGCTGGGCCTTGGGG + Intergenic
1054325298 9:63709681-63709703 AGCCCCTGAGCTGGGCCCAGGGG + Intergenic
1054325356 9:63709899-63709921 CGCCCTTGTGCTGGGCCCCGGGG + Intergenic
1054350418 9:64014373-64014395 AGCCCCTGTGCTGGGCCCTGGGG - Intergenic
1054350473 9:64014571-64014593 AGCCCCTGAGCTGGGCCCTGTGG - Intergenic
1054350728 9:64015577-64015599 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
1054350841 9:64016001-64016023 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
1054452738 9:65412110-65412132 TCCCCCTGTGCCTGGCCCTGGGG + Intergenic
1054540245 9:66263955-66263977 CGCCCTTGTGCTGGGCCCCGGGG - Intergenic
1054540303 9:66264173-66264195 AGCCCCTGAGCTGGGCCCAGGGG - Intergenic
1054540821 9:66266245-66266267 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1054776242 9:69126216-69126238 AGGTACTGTGCTAGGCCCTGAGG + Intronic
1054808254 9:69413019-69413041 AGCCACGGTGCTGGGAGCTGCGG - Intergenic
1054849792 9:69835937-69835959 TGACACGGAGCTGGGCCCTCTGG + Intronic
1054917410 9:70508046-70508068 AGCCACTGTGCCTGGCCCTGGGG + Intergenic
1055031388 9:71773991-71774013 AAACACTGTGCTAGGCCCTGAGG - Intronic
1055575509 9:77657144-77657166 AGCCACTGTGCTTGGCCAAGGGG - Intergenic
1056126947 9:83543815-83543837 GGGCACTGTGCTTGGCTCTGTGG + Intergenic
1056281803 9:85048667-85048689 TGCCACAGTGATAGGCTCTGGGG - Intergenic
1057473526 9:95379598-95379620 AGCCACTGTGCCCAGCCCTGTGG + Intergenic
1057566202 9:96168147-96168169 AGACACTGTGCTGGGCACTGGGG - Intergenic
1057663977 9:97028862-97028884 TAGCACTGTGCTAGGCTCTGGGG - Intergenic
1057798889 9:98177278-98177300 AGCCCCTGTGCTGGGCTCTGTGG + Intronic
1057903320 9:98965985-98966007 TGGCGCTGGGCTGGGCTCTGGGG - Intronic
1058118687 9:101114629-101114651 TTACACTGTGCTGTGTCCTGAGG - Intronic
1058428864 9:104900347-104900369 AGGCTCTGTGCTGGGCTCTGAGG + Intronic
1058802786 9:108561096-108561118 AGCCACTGTGCCTGGCCTTGAGG + Intergenic
1059170223 9:112117726-112117748 AGGCACTGTGCTAGGGCCTGAGG - Intronic
1059323305 9:113485916-113485938 AGGCACTGTGCTGGTCACTGGGG + Intronic
1059407745 9:114112377-114112399 AGCCACTGTTCTGGCCCCTGTGG + Intergenic
1059409814 9:114124828-114124850 TGCCCATGGTCTGGGCCCTGGGG - Intergenic
1059454496 9:114390978-114391000 GGCCTGTGTGCTGGGTCCTGGGG - Intronic
1059960312 9:119558286-119558308 TGGCACTGTGCTGGGCCCCTAGG - Intergenic
1060018609 9:120109255-120109277 TGCATCTCTGGTGGGCCCTGAGG + Intergenic
1060051168 9:120379413-120379435 AGGCACTGTCCTGGGCCCTTGGG - Intergenic
1060188309 9:121577128-121577150 TGTCCCTGTGCTGGGCGATGCGG - Intronic
1060203125 9:121663750-121663772 TGGGACTGAGCTGGGCCCTGGGG + Intronic
1060459830 9:123840621-123840643 CGGCACTGTGCTAGGCCCTTGGG - Intronic
1060762322 9:126266042-126266064 AGCCACTGTACTGGACTCTGAGG + Intergenic
1060956466 9:127644524-127644546 TGCCTCTGTCCTGGGCAGTGTGG + Intronic
1061048112 9:128178313-128178335 TCCCACCCTGCTGGGCTCTGTGG + Intronic
1061149931 9:128822848-128822870 TGGCAGTGGGCTGGGGCCTGGGG + Intronic
1061152620 9:128837521-128837543 TGCCCCTGTCCTGGGACCTCTGG + Intronic
1061262348 9:129487310-129487332 AGTCACTGTGCTAGGCACTGGGG - Intergenic
1061774179 9:132949596-132949618 CGGGACTGTGCTGGTCCCTGGGG + Intronic
1061905458 9:133694438-133694460 TGCCCCTGTGAGCGGCCCTGGGG - Intronic
1062015074 9:134287318-134287340 TGACACTGAGCTGCTCCCTGTGG - Intergenic
1062159384 9:135071490-135071512 CGCCACTCAGCTGGGCACTGAGG + Intergenic
1062168804 9:135122722-135122744 GGCCCCTGAGCTGGCCCCTGGGG - Intergenic
1062318394 9:135978938-135978960 TCCCAATGCGCTGGGCTCTGGGG + Intergenic
1062532072 9:137006433-137006455 TGAAGCTGTCCTGGGCCCTGGGG - Intergenic
1062546718 9:137066869-137066891 AGCCACTGTGCCCGGCCATGCGG - Intronic
1202791950 9_KI270719v1_random:94372-94394 TGCCCTTGTGCTGGGCCCCGGGG + Intergenic
1203697768 Un_GL000214v1:113980-114002 AGCCCCTTTGCTGGGCCCTGGGG + Intergenic
1203697927 Un_GL000214v1:114623-114645 AGTCCCTGAGCTGGGCCCTGTGG + Intergenic
1203698122 Un_GL000214v1:115482-115504 AGTCACTGCGCTGGGCCTTGTGG + Intergenic
1203698308 Un_GL000214v1:116288-116310 AGCCACTGCGCTTGGCCCTTTGG + Intergenic
1203550938 Un_KI270743v1:164891-164913 AGCCACTGCGCTTGACCCTGTGG - Intergenic
1203551080 Un_KI270743v1:165498-165520 AGTCCCTGCGCTGGGCCCTGTGG - Intergenic
1203551437 Un_KI270743v1:167003-167025 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
1185758861 X:2673964-2673986 AGCTTCTGTGCTGGGCCTTGCGG - Intergenic
1186282991 X:8014387-8014409 TCCCACTGTGCTGGATCCTATGG - Intergenic
1186826948 X:13349975-13349997 TGGCAATGTGCAGAGCCCTGGGG - Intergenic
1186836975 X:13447943-13447965 TGGCACTGGGCTGGGCTCAGTGG - Intergenic
1187305087 X:18087758-18087780 TACCTCTGAGCTGGACCCTGAGG - Intergenic
1187888339 X:23909892-23909914 CTCCACTGTGCTAGGCACTGAGG + Intronic
1188682354 X:33026271-33026293 TGCCACTGCGCTCCGGCCTGGGG + Intronic
1189388648 X:40557730-40557752 AGCCACTGTGCCCGGCCCTGAGG + Intergenic
1189588422 X:42485901-42485923 TGACACTGTACTAGGCACTGGGG + Intergenic
1189718879 X:43894437-43894459 TGCCACTGTGCTAAGGTCTGGGG - Intergenic
1190074091 X:47302948-47302970 TGACATGGTGCTGAGCCCTGTGG + Intergenic
1190303374 X:49068840-49068862 TCACACTGTGCTGGGGACTGGGG + Intronic
1190416563 X:50185724-50185746 AGGCATTGTGCTGGGCGCTGAGG + Intergenic
1190448760 X:50557113-50557135 AGCCACTGCGCTTGGCCCAGAGG + Intergenic
1190931035 X:54949967-54949989 TGGCCCTGTGCTGGGTGCTGGGG + Intronic
1191249959 X:58255543-58255565 AGCCCCTGTGCTGGGCCCTCTGG - Intergenic
1191250277 X:58256907-58256929 AGCCACTGAGCTGGGCCCGCAGG + Intergenic
1191251534 X:58262344-58262366 AGCCCCTGTGCTGGGCCCGTAGG + Intergenic
1191251918 X:58263897-58263919 AGCCCCTGTGCTGGGCCCGCGGG + Intergenic
1191252441 X:58266011-58266033 AGCCACTGTGCAGGGCCCGCGGG - Intergenic
1191257906 X:58287729-58287751 AGCCCCTGCGCTGGGCCCAGAGG + Intergenic
1191257966 X:58287943-58287965 AGCCACTGCACTGGGCCCAGGGG + Intergenic
1191258965 X:58292297-58292319 TGCCAATGCACTGGGCCCGGGGG + Intergenic
1191901420 X:66044477-66044499 TGACACTGTTCTAGGTCCTGGGG + Intergenic
1192268149 X:69554792-69554814 AGACACTGTGCTAGGCCTTGAGG + Intergenic
1192478092 X:71460921-71460943 AGGCACTGTGCTAGGCTCTGGGG + Intronic
1192799257 X:74450208-74450230 AGCCCTTGTGCTAGGCCCTGGGG - Intronic
1193091096 X:77494509-77494531 TGCCAGTGTGTTGGGCTATGGGG - Intergenic
1193652349 X:84152655-84152677 AGACACTGTGCTGGACACTGGGG + Intronic
1194195984 X:90893462-90893484 TGTCACTGTTGTGGGTCCTGAGG - Intergenic
1194199141 X:90933782-90933804 TGCCATTGAGCTGGGCACGGTGG - Intergenic
1195005282 X:100679547-100679569 AGGCACTGTGCTAGGCACTGAGG - Intronic
1195649372 X:107268725-107268747 AGCCACTGTGCCTGGCCCAGAGG + Intergenic
1195698182 X:107682318-107682340 AGACACTGTACTGAGCCCTGTGG - Intergenic
1195751228 X:108163275-108163297 GGGCACAATGCTGGGCCCTGAGG - Intronic
1195922536 X:109998042-109998064 TGCCACTCTGCTAGGTGCTGTGG + Intergenic
1196008828 X:110864850-110864872 AGGCACTGTGCTAGGCACTGAGG + Intergenic
1196284519 X:113863866-113863888 AGCCACTGTGCTGTGCTGTGGGG + Intergenic
1196598713 X:117575691-117575713 AGCCACTGTGCCTGGCCCTAGGG + Intergenic
1196740027 X:119016628-119016650 AGCCACTGTGCCCGGCCCTGGGG + Intronic
1196889616 X:120279387-120279409 TGGCATTGTACTAGGCCCTGGGG + Intronic
1197032865 X:121839143-121839165 TGCCACAATGCTGGGGGCTGAGG + Intergenic
1197187875 X:123608436-123608458 AGCCACTGTGCTGGGCCATCTGG - Intronic
1197192269 X:123661117-123661139 AGCCACTGTGCCCGGCCATGAGG - Intronic
1197344402 X:125315264-125315286 TTACAATGTGCTAGGCCCTGTGG - Intergenic
1197626956 X:128813013-128813035 AGACACTGTGCTGGGTGCTGGGG - Intergenic
1197784662 X:130187829-130187851 TGCCACTGTTCTGAATCCTGGGG + Intergenic
1197991431 X:132322360-132322382 AGGCACTGTGCTAGGCCCTGAGG + Intergenic
1198225406 X:134640757-134640779 AGGCACTGTGCTGGGCTCTAGGG - Intronic
1198394510 X:136208365-136208387 AGGCACTGTGCTGGGCGCTTTGG - Intronic
1198523355 X:137474617-137474639 AAGCACTGTGCTGAGCCCTGAGG - Intergenic
1198700785 X:139396163-139396185 TGGCACTGTGCTAGAACCTGTGG + Intergenic
1199308236 X:146292672-146292694 AGCCACTGTGCTGTGCTGTGGGG + Intergenic
1199551332 X:149064751-149064773 TGACACTGTGCCAGGCCCAGAGG + Intergenic
1199621733 X:149707255-149707277 AGGCACTGTCCTGGGCTCTGAGG + Intronic
1199767618 X:150952581-150952603 AGGCACTGAGCTGAGCCCTGGGG - Intergenic
1199808488 X:151326336-151326358 AGCCACTGTTCAGGGCACTGGGG + Intergenic
1199860997 X:151800532-151800554 AGACACTGTGCTGGGCCCTGAGG + Intergenic
1200009230 X:153108814-153108836 TGGCACTGTGCTAGGCACTAGGG + Intergenic
1200030370 X:153291108-153291130 TGGCACTGTGCTAGGCACTAGGG - Intergenic
1200057220 X:153468043-153468065 AGCTGCTGTGCTGAGCCCTGGGG + Intronic
1200109489 X:153733155-153733177 AGCCACTGTGCCTGGTCCTGTGG + Intronic
1200210049 X:154343017-154343039 TTCCTCTTTGCTGGGCTCTGAGG + Intergenic
1200220803 X:154389075-154389097 TTCCTCTTTGCTGGGCTCTGAGG - Intergenic
1200523887 Y:4247550-4247572 AGCCACTGTGCTGCACTCTGGGG - Intergenic
1200541832 Y:4467643-4467665 TGTCACTGTTGTGGGTCCTGAGG - Intergenic
1200545135 Y:4510200-4510222 TGCCATTGAGCTGGGCACAGTGG - Intergenic
1201151433 Y:11097445-11097467 AGCCCCTGAGCTGGGCCCAGGGG - Intergenic
1201151597 Y:11098051-11098073 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1201152712 Y:11102606-11102628 AGCCCCTTCGCTGGGCCCTGGGG - Intergenic
1201305072 Y:12542862-12542884 TGCCTCTGTGCAGGCCTCTGGGG - Intergenic