ID: 1139740968

View in Genome Browser
Species Human (GRCh38)
Location 16:69034500-69034522
Sequence CTGTAACCACAGCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 2, 2: 21, 3: 41, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139740968 Original CRISPR CTGTAACCACAGCTGGAGCC TGG (reversed) Intronic
900102892 1:970392-970414 CTGGAACCGCAGCTGGACCTTGG - Exonic
900531647 1:3156742-3156764 CTGTGGCCACTGCTTGAGCCGGG - Intronic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900879267 1:5368849-5368871 CTGTAACCATAGCTGCTCCCAGG - Intergenic
900963878 1:5944207-5944229 CTGTAAGCACAGCTGAAAACAGG - Intronic
901950004 1:12736747-12736769 CTGTAACAACAGCTGGGTCTTGG - Intergenic
903813173 1:26046051-26046073 CTGCAGCCGCAGCGGGAGCCGGG - Exonic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905246811 1:36620658-36620680 CTGGAACCAAGGCTGGTGCCAGG + Intergenic
905307840 1:37031828-37031850 CTTGAACCCCAGCTGGAGCCAGG - Intronic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905473249 1:38208362-38208384 TTGTGACCAGAGCTGGGGCCTGG + Intergenic
905688691 1:39927149-39927171 CTGGAACTACAGCTTGAGGCAGG - Intergenic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907468247 1:54653830-54653852 CTGATACCATAGCTGGAGCCAGG - Exonic
908091008 1:60685753-60685775 CTGAAACCACAGCCTGAGCTTGG - Intergenic
909018279 1:70403511-70403533 CAGGAACCACAGCTGGGCCCTGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
914306724 1:146426654-146426676 TTGAAACCACAGCAGGAGGCAGG - Intergenic
915500268 1:156311122-156311144 CTGGACCCTCAGCTGGTGCCAGG - Exonic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
917336071 1:173925497-173925519 CAGTAACCACAGCAGAAGCTGGG - Intergenic
917792097 1:178505559-178505581 CTGAATCCACTGCAGGAGCCAGG - Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919861312 1:201740801-201740823 GTGTAACCACAGCTGGCCCTGGG + Intronic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
923814522 1:237360914-237360936 CTGTCACCCAAGCTGGAGCGTGG + Intronic
924089442 1:240487268-240487290 GTGAAATCACAGCAGGAGCCGGG + Intergenic
1063476879 10:6336562-6336584 CTGAGACCACAGGTGCAGCCAGG + Intergenic
1066639980 10:37546206-37546228 GTGTAATCACAGCTGATGCCAGG - Intergenic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1071879340 10:89878070-89878092 CTCTTGCCACAGCTGGACCCTGG - Intergenic
1072854469 10:98932580-98932602 CTGTAACTCCATCTGGAGCTGGG + Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1076216187 10:128695399-128695421 ATGTCACCAGAGCTGGTGCCTGG + Intergenic
1076625588 10:131819652-131819674 GTGTAACCACCGCTGCAGTCGGG - Intergenic
1076948684 10:133667332-133667354 CTGAAACCAAATCTGGACCCTGG - Exonic
1076949668 10:133670631-133670653 CTGAAACCAAATCTGGACCCTGG - Intronic
1076950652 10:133673930-133673952 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076951642 10:133677240-133677262 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076952632 10:133680550-133680572 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076953615 10:133683849-133683871 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076955588 10:133743511-133743533 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076956578 10:133746821-133746843 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076957566 10:133750130-133750152 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076958550 10:133753429-133753451 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076959539 10:133756739-133756761 CTGAAACCAAATCTGGACCCTGG - Intergenic
1076960523 10:133760038-133760060 CTGAAACCAAATCTGGACCCTGG - Intergenic
1077317046 11:1924235-1924257 CTGTAACCCTGGGTGGAGCCTGG + Intronic
1077343594 11:2036645-2036667 CTCTAACTCCAGCTGCAGCCTGG - Intergenic
1077522281 11:3043465-3043487 CTCTGACCCCAGCTGGTGCCTGG + Intronic
1077759144 11:5071973-5071995 CTGTAACCACAGCATGAATCAGG - Intergenic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1079114947 11:17634933-17634955 CTCTCACCACAGCTGTAGCTGGG - Exonic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1080439960 11:32283861-32283883 CTGTCACCCAGGCTGGAGCCTGG - Intergenic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1081400902 11:42641621-42641643 CTGTTACCTAAGCTGGAGCGCGG - Intergenic
1081695324 11:45105579-45105601 CTGTCACCACGGCTGGAGGGAGG - Intronic
1081994455 11:47354729-47354751 CTGTACCCAATGCTGGACCCTGG - Intergenic
1082030649 11:47601007-47601029 CTGGTACCGCAGCTGGGGCCAGG - Intergenic
1083234660 11:61343859-61343881 CTGAAACCACTGCAGCAGCCTGG + Exonic
1083298817 11:61729515-61729537 CTGAAACCACAGCTGGCAGCCGG + Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089353051 11:117832224-117832246 CTGCAACCATAGCAGGAGGCAGG - Intronic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1090387328 11:126364666-126364688 CTGGAACCAGGGCTGGGGCCTGG - Intronic
1090389892 11:126381864-126381886 CTGGAACCAGGGCTGGGGCCTGG - Intronic
1202826580 11_KI270721v1_random:91834-91856 CTCTAACTCCAGCTGCAGCCTGG - Intergenic
1092038686 12:5363990-5364012 AGGTAACCTCAGCGGGAGCCGGG + Intergenic
1096075796 12:48803288-48803310 CTGTCACCAGAGCTGGAGTGCGG + Intergenic
1096239987 12:49954668-49954690 CAGTGACGACAGCTGGAGCCAGG - Exonic
1097960063 12:65523558-65523580 CTGTCACTAGAGCTGGATCCTGG + Intergenic
1098146416 12:67502314-67502336 CTGTGAGCTCAGCTGGACCCTGG + Intergenic
1100199674 12:92284828-92284850 ATTTATCAACAGCTGGAGCCTGG + Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1103348594 12:120267072-120267094 CTGTAATCCCAGCAGGAGGCAGG - Intergenic
1103593065 12:122005981-122006003 CTGTAATCCCAGCTGTATCCTGG - Intergenic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1106396402 13:29385100-29385122 TTGTACCAACAACTGGAGCCTGG - Intronic
1108446063 13:50510211-50510233 CTGTAACATCAGCTGTAGCTGGG + Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1112837179 13:103530388-103530410 CTTTAACCACTTCTGGATCCAGG - Intergenic
1113531426 13:111030232-111030254 CTGTAACCGTGGCTGGAGCGTGG - Intergenic
1113724656 13:112588924-112588946 CTGCAACCTGAGCTGGACCCAGG - Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114588694 14:23839358-23839380 CTGTATCCAGAGCTAGAGTCAGG + Intergenic
1115500452 14:34044860-34044882 CTATAACCATATCTGGAGCAAGG + Intronic
1116050664 14:39799058-39799080 CTATTACCACAAATGGAGCCTGG - Intergenic
1116938820 14:50770184-50770206 CTGTGAGCAAAGCAGGAGCCTGG + Intronic
1117357967 14:54944440-54944462 TTCTAACCACATCTGGAACCCGG + Exonic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1121907250 14:97757714-97757736 CTGTAACCACAGCTGCTTCCCGG + Intronic
1121967480 14:98324016-98324038 CTGTAACCACAGTTGGCCTCTGG - Intergenic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1202854644 14_GL000225v1_random:42984-43006 CTGAAACCAAATCTGGACCCTGG - Intergenic
1202860787 14_GL000225v1_random:79857-79879 CTGAAACCAAATCTGGACCCTGG + Intergenic
1202862290 14_GL000225v1_random:90315-90337 CTGAAACCAGATCTGGACCCTGG + Intergenic
1202865535 14_GL000225v1_random:114796-114818 CTGAAACCAAATCTGGACCCTGG + Intergenic
1202868325 14_GL000225v1_random:136869-136891 CTGAAACCAAAACTGGACCCTGG + Intergenic
1202923047 14_KI270724v1_random:2731-2753 CTGAAACCAAATCTGGACCCTGG + Intergenic
1124248735 15:28094278-28094300 CGGGAACCACAGCTTCAGCCTGG + Intronic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1125492113 15:40155924-40155946 CTATAGCCCCAGCAGGAGCCTGG - Intergenic
1126836951 15:52678207-52678229 CTGTCACCGCAGTTGGTGCCAGG - Intronic
1126851140 15:52798055-52798077 CGGTCTCCCCAGCTGGAGCCGGG - Intergenic
1127505721 15:59596136-59596158 CTGGAACAGCAGCTGGAGTCTGG - Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG + Intergenic
1129331766 15:74831500-74831522 CTGAGACCACAGGTGGGGCCGGG + Exonic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1132234213 15:100206938-100206960 CTGTGATGACAGCCGGAGCCAGG + Intronic
1132270636 15:100520808-100520830 CAGCAAGCACAGCTGGTGCCGGG + Intronic
1132495417 16:260974-260996 CTGCAACCCCAGCAGGAGGCAGG + Intronic
1132586371 16:707269-707291 CTCTCACCACAGCAGGTGCCAGG + Intronic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135277209 16:21123824-21123846 CTGTCACCCAGGCTGGAGCCAGG + Intronic
1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG + Intronic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136141655 16:28292593-28292615 CTGGAGCCGCAGCCGGAGCCCGG + Exonic
1136458203 16:30394451-30394473 CTGGAAACACAGCTCCAGCCAGG + Intronic
1137402671 16:48165920-48165942 CTGTAACCACATGTGGAGGGTGG + Intergenic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1137620102 16:49870497-49870519 CTGTCAGGACAGCTGGACCCTGG - Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139368667 16:66450686-66450708 CTGTCACCCAGGCTGGAGCCTGG - Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140454313 16:75095895-75095917 CAGAAACCACACCGGGAGCCGGG + Intronic
1141260446 16:82448840-82448862 CAGTAAGCACGGCTGGAGCAGGG - Intergenic
1141711563 16:85702467-85702489 CTGTCACCCCAGCTGGAGTGCGG + Intronic
1142680709 17:1546608-1546630 CTGTACCCACACATGGAGGCTGG + Intronic
1143732541 17:8889148-8889170 CTACACCTACAGCTGGAGCCAGG - Exonic
1143796748 17:9343069-9343091 TGGTAAGGACAGCTGGAGCCAGG + Intronic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1145237413 17:21218252-21218274 CTGGAACCACCGCTGTGGCCTGG + Intergenic
1145882587 17:28363358-28363380 CTCTAATCCCAGCTGAAGCCTGG + Exonic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1151490275 17:74428778-74428800 CTGTCACCCCAGCTGGAGTGCGG - Intronic
1152659156 17:81534504-81534526 CAGGAACCCCAGATGGAGCCCGG + Intronic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1153263836 18:3248266-3248288 CTGCAACAACAGCTGCAGCAGGG - Intronic
1153587087 18:6633513-6633535 CTGTAAACACAGCACCAGCCCGG + Intergenic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154187324 18:12196851-12196873 CTGTAATCACAGCCAGTGCCTGG - Intergenic
1156274154 18:35566066-35566088 CTGTAACCCCAGCTACAACCTGG + Intergenic
1156507603 18:37608256-37608278 CTGTAAACACAGGCAGAGCCAGG + Intergenic
1158165700 18:54537862-54537884 CTGCCACCACAACTGCAGCCAGG + Intergenic
1158998624 18:62950001-62950023 CTGTCACCCAGGCTGGAGCCAGG + Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1159775558 18:72600017-72600039 CTGTAACCACAGGCGGTGCTTGG - Intronic
1160371549 18:78376293-78376315 CTGCAACCAGAGCTGGTGTCTGG + Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1162115824 19:8428839-8428861 CTGTAATCCCAGCTTGAACCCGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165679406 19:37761094-37761116 CTGTAATCCCAGCCTGAGCCTGG + Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1168139166 19:54373670-54373692 CTGTAATCCCAGCTCGAACCAGG + Intergenic
1168261908 19:55200076-55200098 ATGTAATCACAGCTGGGGGCTGG - Intronic
925836586 2:7952430-7952452 CTCTAACCCCAGCGAGAGCCTGG + Intergenic
926130765 2:10302356-10302378 AGGTAACCAGAGCTGGAGCCAGG + Intergenic
927056197 2:19367621-19367643 CTGGCACCAGAGCAGGAGCCTGG + Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928914908 2:36460134-36460156 ATGTAACCACAGCTGCAGCCAGG - Intronic
933184108 2:79259734-79259756 TTTTAACCACAGCTGCAGTCAGG + Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
934080489 2:88463691-88463713 CTATACCTACAGCTAGAGCCAGG - Intergenic
935679003 2:105620058-105620080 CGGTCACCACCACTGGAGCCTGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
937749421 2:125456741-125456763 CTGTGACCATAGCTGCAGCCTGG - Intergenic
938732641 2:134158477-134158499 CTGAAATCAGAGCTGGTGCCGGG + Intronic
940554872 2:155211937-155211959 CTGTTACCCAGGCTGGAGCCTGG + Intergenic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
945039406 2:205731518-205731540 ATGGAACCACAGCTGGTGACAGG + Intronic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
947624983 2:231613663-231613685 CTGTAAACCTGGCTGGAGCCGGG - Intergenic
947680151 2:232023521-232023543 CTGAGACTACAGCTGGAACCTGG + Intronic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948678038 2:239610634-239610656 CTGCATCCACACCTGCAGCCTGG - Intergenic
1170540094 20:17379035-17379057 TTTGAACCACAGCTGTAGCCAGG - Intronic
1171780346 20:29411397-29411419 CTGAAACCAAATCTGGACCCTGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172576327 20:36011560-36011582 CTGTAATCCCAGCTGAATCCAGG + Intronic
1173075322 20:39813046-39813068 CTGGAACCTTAGCTAGAGCCAGG - Intergenic
1173252626 20:41372604-41372626 CAGTAATCACACCTGCAGCCAGG - Intergenic
1173922500 20:46757005-46757027 AGGAAAACACAGCTGGAGCCAGG - Intergenic
1174285544 20:49470314-49470336 CTGTGACCACTGGTGGAGGCAGG + Intronic
1174398777 20:50264640-50264662 CTGGATCTTCAGCTGGAGCCAGG - Intergenic
1174429220 20:50455923-50455945 CTGCTCCCACAGCTGGAGACAGG - Intergenic
1174558352 20:51412561-51412583 CTGTAACCACAGCAGGAGGGAGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175591021 20:60192146-60192168 CTGTGACCACAGCCTGAACCAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175777901 20:61664391-61664413 CAGAAACCACAGCTGGGGCATGG + Intronic
1177148635 21:17432691-17432713 CTGTAACCCAGGCTGGAGCGAGG - Intergenic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181981375 22:26769232-26769254 TTGTACCCACAGCCAGAGCCGGG + Intergenic
1183299932 22:37053851-37053873 CTGTTAGCAGAGCTGCAGCCAGG + Intronic
1184224564 22:43121852-43121874 CTGTAATCCCAGCTTGAACCTGG - Intronic
1184341084 22:43886302-43886324 CTCTCACCAGAGCTGGAGGCTGG - Exonic
1184630801 22:45777269-45777291 TTGTTACCATAGCTGGAGTCGGG + Intronic
1184643693 22:45885203-45885225 CTGTCACCACAGCTTGGTCCAGG - Intergenic
1184825143 22:46945535-46945557 CCGTCAGCACAGCTGCAGCCTGG - Intronic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950017721 3:9765970-9765992 CTGTGACCACTGCTGGACCAAGG + Exonic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
950218342 3:11175704-11175726 CTGTAACCACATCTAGAATCAGG + Intronic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
952072146 3:29650318-29650340 CTGTCACCCAAGCTGGAGGCTGG + Intronic
954317672 3:49810129-49810151 CTGAAGCCACTGCTGGAGGCAGG - Exonic
954420390 3:50416023-50416045 CTGTAACCACAGCTGTTGACAGG - Intronic
957084740 3:75669112-75669134 CTGAAACCAAATCTGGACCCTGG - Intergenic
957095109 3:75771109-75771131 CTGTAACAACAGCTGAGTCCTGG + Intronic
957182692 3:76900756-76900778 ATGTGACCACATCTGAAGCCTGG + Intronic
960797916 3:121507888-121507910 CTGTCACCAAGGCTGGAGCATGG + Intronic
961141457 3:124559907-124559929 CTGTATCTAAAGCTTGAGCCCGG + Intronic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961695628 3:128702293-128702315 CTATAAACAAAGCTGGAGACTGG - Intergenic
962929259 3:140022223-140022245 CTGTGACTCTAGCTGGAGCCTGG + Intronic
964523714 3:157594846-157594868 TTGTAACCACAGTTGGAGGCAGG + Intronic
966324951 3:178743515-178743537 TTGTCAACACAGCAGGAGCCTGG - Intronic
967463975 3:189780850-189780872 CTGAAACCTTAGCTGGACCCAGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG + Intronic
969571059 4:8008635-8008657 CTGTGAACGCAGCCGGAGCCAGG - Intronic
971971815 4:33630825-33630847 CTGTGTCCTCATCTGGAGCCTGG + Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972548257 4:40102993-40103015 TTGTAACCACAGCTGCACACTGG + Exonic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973296100 4:48522317-48522339 GTGTAACCATAGCTGGTGCCTGG + Intronic
973317976 4:48780794-48780816 ATGTATCCAGAGCTGGCGCCCGG + Intergenic
973624407 4:52757017-52757039 CTGTAAGAACACCTGGATCCTGG + Intergenic
974083905 4:57239455-57239477 ATGTAACCACAGCTGCAGGGGGG - Intergenic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975599765 4:76086996-76087018 CTGTCAGCCCAGCTGCAGCCGGG - Intronic
976097890 4:81528391-81528413 CTGAAATCAGAGCTGGTGCCAGG + Intronic
976232262 4:82856712-82856734 CTGTCACCCCAGCTAGAGTCCGG - Intronic
977124612 4:93149668-93149690 CTGTCACCAAAGCTGGAGTATGG + Intronic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
978516515 4:109574440-109574462 CTGCCAACACAGCTAGAGCCTGG + Intronic
982879809 4:160699517-160699539 CTGTAATCCCAGCTTGAACCCGG + Intergenic
983226776 4:165093131-165093153 CTGTCACCAAGGCTGGAGCGCGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
985446234 4:190022462-190022484 CTGAAACCAAATCTGGACCCTGG + Intergenic
985452138 4:190068116-190068138 CTGAAACCAAATCTGGACCCTGG - Intergenic
985453122 4:190071413-190071435 CTGAAACCAAATCTGGACCCTGG - Exonic
985454112 4:190074706-190074728 CTGAAACCAAATCTGGACCCTGG - Exonic
985455100 4:190077999-190078021 CTGAAACCAAATCTGGACCCTGG - Exonic
985456088 4:190081299-190081321 CTGAAACCAAATCTGGACCCTGG - Exonic
985457072 4:190084593-190084615 CTGAAACCAAATCTGGACCCTGG - Intergenic
985458059 4:190087886-190087908 CTGAAACCAAATCTGGACCCTGG - Exonic
985459048 4:190091186-190091208 CTGAAACCAAATCTGGACCCTGG - Exonic
985463301 4:190173955-190173977 CTGAAACCAAATCTGGACCCTGG - Exonic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
991472351 5:66982839-66982861 CTGCAACCACTGTTGGAGCGTGG + Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
992603075 5:78424606-78424628 CTGTAATCCCAGCTCGAGGCAGG + Intronic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998096994 5:139401636-139401658 CTGTATCCTCAGCTGGGGACAGG + Intronic
999254094 5:150200046-150200068 ATGTAACCACCCCTGGAGCTGGG + Intronic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001562196 5:172677097-172677119 CTGTAAGCACACCTTGGGCCGGG + Intronic
1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG + Intergenic
1002140143 5:177133244-177133266 CTGTAACCTAAGATGGAGGCCGG + Intronic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1004199629 6:13535780-13535802 CTGTCACCCCAGCTGGAGTGCGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004858986 6:19781765-19781787 AGGTCACCACAGCTGGAGCAGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005488320 6:26322444-26322466 CTGTAGCCCCGGCTGGAGTCTGG + Intergenic
1006100717 6:31684462-31684484 CTGTCACCCAAGCTGGAGTCCGG + Intergenic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1012261204 6:97089654-97089676 CTGTAATCCCAGCTGAGGCCTGG + Intronic
1012412680 6:98976809-98976831 CTGTCACCACTGCTGGAGTTTGG - Intergenic
1013904152 6:115195492-115195514 CTGCTTCCACAGCAGGAGCCTGG - Intergenic
1014563329 6:122917494-122917516 CAGTAACCTGAGCAGGAGCCTGG - Intergenic
1015886845 6:137926351-137926373 CTGTAACTACAGCTGGCACGGGG - Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1018197314 6:161366655-161366677 CTGTAACAACAGCTGGGTCTTGG + Intronic
1018685641 6:166302325-166302347 CTGTCACCAGAGCGGGAGGCAGG - Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1020430651 7:8113391-8113413 CTGTCCCCACAGCAGGTGCCTGG - Exonic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022687554 7:32610666-32610688 CTGTAATCCCAGCTAGAGGCAGG + Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1025245452 7:57313268-57313290 CTGCTCCCACAGCTGGAGACGGG + Intergenic
1025943670 7:66090687-66090709 GGGTAAAGACAGCTGGAGCCAGG - Intronic
1026374785 7:69739413-69739435 GTGTACCCACATCAGGAGCCTGG - Intronic
1026801620 7:73403861-73403883 CTGTAACCACCGCTGCATTCGGG + Intergenic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030845384 7:114402654-114402676 CTGTCACCCAAGCTGGAGGCTGG + Intronic
1031034901 7:116778206-116778228 CTGTCAACACAGGCGGAGCCAGG - Intronic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032085056 7:128879510-128879532 CTGGAGCCGCACCTGGAGCCCGG + Exonic
1032200070 7:129814565-129814587 CTGTCACCCCAGCTGGAGGCTGG + Intergenic
1032755776 7:134889370-134889392 CTCTAACCACAGCTGGAAAGGGG + Intronic
1034880468 7:154758864-154758886 GTGGGACCAGAGCTGGAGCCTGG + Intronic
1034900203 7:154903541-154903563 CAGTCACCACGGCTGGAACCTGG + Intergenic
1035656446 8:1310411-1310433 CTCTAATCATAGCTGGAGGCTGG + Intergenic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1038459789 8:27706186-27706208 CTGTCACCAAAGCTGGAGTGCGG + Intergenic
1042333889 8:67610334-67610356 CTGTCACCCAAGCTGGAGTCTGG - Intronic
1043916140 8:85924661-85924683 CTGTTATCACATCTGGAGCAAGG + Intergenic
1044224858 8:89707256-89707278 CTGTCACCCCAGCTGGAGTGTGG - Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1047974708 8:130118493-130118515 ATGGAACCACTGCTGGAACCTGG - Exonic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049542454 8:143214729-143214751 CTGTGACCACGGCAGGAGCCTGG + Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049621979 8:143602538-143602560 CTGTCACCACAGCCAGGGCCTGG - Exonic
1049678651 8:143905145-143905167 CTGTCACCCAAGCTGGAGTCTGG - Intergenic
1050376194 9:4975897-4975919 CAGTAATCACAGCTGCAGCCAGG - Intergenic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1052382352 9:27785161-27785183 CTGGAAACAGAGCTGAAGCCAGG - Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1055525072 9:77124899-77124921 CTGTAACCCAGGCTGGAGCGCGG + Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056630130 9:88286657-88286679 CTGTAATCACAGCAGGAGACGGG + Intergenic
1056816114 9:89802436-89802458 CTGTCCCCAGAGCTGCAGCCGGG - Intergenic
1057280527 9:93708137-93708159 CTGTAACCAGAGCTGGATATAGG - Intergenic
1058445777 9:105053684-105053706 CTGTAACCGAAGCTGGAGTGCGG - Intergenic
1059058963 9:111014923-111014945 ATGTGACCACATTTGGAGCCAGG + Intronic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060518845 9:124282590-124282612 CTGTCACCACAGCAAGGGCCAGG + Intronic
1060890392 9:127184281-127184303 CTGTCACCCAAGCTGGAGCGCGG - Intronic
1061725311 9:132579317-132579339 CTGTTCCCACAGCAGGAGGCAGG - Intergenic
1062546914 9:137067977-137067999 CTGTACCCACTTCTGTAGCCTGG - Intronic
1203736455 Un_GL000216v2:143399-143421 CTGAAACCAAAACTGGACCCTGG - Intergenic
1203738805 Un_GL000216v2:161362-161384 CTGAAACCAAATCTGGACCCTGG - Intergenic
1186477114 X:9866060-9866082 CTGGGACCACAGCAGGGGCCAGG + Intronic
1187474960 X:19602396-19602418 CTGTAAGTACAGCTGGAGAAGGG + Intronic
1188977120 X:36689124-36689146 CTGTAAACACAAGTAGAGCCAGG - Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1195108881 X:101625236-101625258 CTGGAACCAGAGCTAGGGCCAGG + Exonic
1196496570 X:116330335-116330357 CTGTAATCCCAGCTTGAACCTGG + Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1200176472 X:154120563-154120585 CTATAACCACAGATGCAGACAGG - Intergenic
1200775493 Y:7166846-7166868 ATGCAACCACAGCTGGAAACTGG - Intergenic
1201972924 Y:19816197-19816219 CGGAAACCACAGCTGGAGGGAGG + Intergenic