ID: 1139743304

View in Genome Browser
Species Human (GRCh38)
Location 16:69054133-69054155
Sequence GAGTGGAAAGAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1109
Summary {0: 1, 1: 0, 2: 6, 3: 107, 4: 995}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139743299_1139743304 1 Left 1139743299 16:69054109-69054131 CCTGGCTGGAGGGTTCCGGAAGA 0: 1
1: 0
2: 2
3: 21
4: 157
Right 1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG 0: 1
1: 0
2: 6
3: 107
4: 995
1139743293_1139743304 18 Left 1139743293 16:69054092-69054114 CCCATAGAGGATAGAAGCCTGGC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG 0: 1
1: 0
2: 6
3: 107
4: 995
1139743294_1139743304 17 Left 1139743294 16:69054093-69054115 CCATAGAGGATAGAAGCCTGGCT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG 0: 1
1: 0
2: 6
3: 107
4: 995

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139743304 Original CRISPR GAGTGGAAAGAGAAGGATGG AGG Intronic
900471398 1:2856752-2856774 AAATGGAAAGAGAAGAAGGGAGG - Intergenic
900852706 1:5156679-5156701 GAGTGAGGAGAGAAGGAGGGAGG + Intergenic
901226189 1:7614067-7614089 GGGTGGGAGGAGAGGGATGGTGG + Intronic
901724297 1:11228631-11228653 GAGGAGAAAGAGAAGGATTGGGG + Intronic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902752263 1:18525186-18525208 TCATGGAAAGATAAGGATGGAGG + Intergenic
902895847 1:19479597-19479619 GTGTGGAAAGGAAGGGATGGTGG - Intronic
903321761 1:22547584-22547606 GAGGGGGAAGAGACAGATGGAGG - Intergenic
904322611 1:29707311-29707333 GAGTGGGGAGGGAAGGAGGGAGG + Intergenic
904338825 1:29819165-29819187 GAGGGGAAAGAGAAAGGGGGTGG - Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
904920131 1:34000958-34000980 GAGTAGAAAGAGGAGGAGGAAGG + Intronic
905619601 1:39431977-39431999 GAGGGGGCAGGGAAGGATGGAGG + Intronic
905820472 1:40986287-40986309 GAGTGGAATGAGAAGTGCGGAGG + Intronic
905930174 1:41781322-41781344 GTGTGGAATGAGCAGGAGGGAGG - Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907430715 1:54409725-54409747 GGGAGGCAAGAGAAAGATGGGGG - Intronic
907807489 1:57836073-57836095 GTGTGGAAAGAAAAGAATGGGGG + Intronic
907912260 1:58836897-58836919 CAGTCCAAAGAGAAGGTTGGTGG - Intergenic
907912852 1:58841768-58841790 CAGTGGAAAGAAAAGGCTGAGGG - Intergenic
908152605 1:61318710-61318732 GAGTTGCTATAGAAGGATGGAGG + Intronic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909164518 1:72202253-72202275 GAGGGGAAAGATAGGTATGGAGG - Intronic
910283421 1:85526867-85526889 AAGTGAGAAGAGAAGGAGGGAGG + Intronic
910700058 1:90063754-90063776 GAGAGGAGAGAGGATGATGGAGG + Intergenic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
911984188 1:104600636-104600658 GTGTGGGAAGAGATTGATGGTGG - Intergenic
912102948 1:106234158-106234180 GAGGGGAAGTAGAAGGTTGGAGG + Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912311483 1:108625655-108625677 CAGTAGATAGAGAAGGATGTAGG - Intronic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913321799 1:117593901-117593923 GGTTGGAAAGAGAAAGAAGGAGG + Intergenic
913380609 1:118206594-118206616 GAGTGGAAAGAGAAGAACATGGG + Intergenic
913706769 1:121433645-121433667 GAAGGGGAAGTGAAGGATGGGGG - Intergenic
914027841 1:143928164-143928186 GAGTCAAAAGAGGAGGATGTAGG + Intergenic
914206594 1:145536121-145536143 AAGTGAGAAGAGAAGGAGGGAGG - Intergenic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914960114 1:152197528-152197550 GAAAGGAGAGAGAAGGAAGGAGG - Intergenic
914963165 1:152224871-152224893 GAGTACAAAGAGAAATATGGAGG - Intergenic
915057969 1:153153653-153153675 GAGTGGAAAGAAGAGGAAAGGGG + Intergenic
915154612 1:153864643-153864665 GAGATGAAAGAGAGGGAGGGAGG + Intronic
915320091 1:155051634-155051656 GGGTGAAAAGAGAAGGAGGGGGG + Intronic
915515894 1:156412555-156412577 GGATGGAGAGAGAAGGAAGGAGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916123994 1:161553059-161553081 GAGGGGAGAGAGATGGAAGGTGG + Intergenic
916133878 1:161634421-161634443 GAGGGGAGAGAGATGGAAGGTGG + Intronic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916616690 1:166448969-166448991 GAGAGGAGAGCGAAGGATGGAGG - Intergenic
916875734 1:168966583-168966605 GAGGGGAGAGAGAGGGACGGGGG + Intergenic
917020351 1:170579883-170579905 GTGGGGAAAGAGTGGGATGGAGG - Intergenic
917512194 1:175677913-175677935 GAGAGGAAAGAGAAGCCAGGGGG + Intronic
917660102 1:177170005-177170027 GAATTGAAAGAGAGGGAGGGAGG - Intergenic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918056397 1:181025323-181025345 GAGTAGAAGGAAAAGGATGGGGG + Intergenic
918302194 1:183214670-183214692 GTGTGGAGAGGCAAGGATGGAGG + Intronic
918407367 1:184224166-184224188 GGGTGGAGAGAGAGGGAAGGAGG - Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918523414 1:185439541-185439563 GAGAGGATAGAGAAGGTGGGGGG + Intergenic
918617093 1:186557481-186557503 GAGTGGAGGGAGGAGGAGGGAGG - Intergenic
919008412 1:191928950-191928972 GAGAGGAAAAAGAAGAGTGGGGG + Intergenic
919046071 1:192453851-192453873 GAGTGCAAAGAGGAGAGTGGGGG - Intergenic
919139233 1:193549826-193549848 GGGTGGAAGGTGGAGGATGGAGG - Intergenic
919881505 1:201904095-201904117 GCGTGAAAAGAGGAGGCTGGTGG - Intronic
919973468 1:202595546-202595568 GGGTGGTAAGAAGAGGATGGGGG - Exonic
920092293 1:203463486-203463508 GAGAGGAAAAAGATGGGTGGTGG + Intergenic
920272203 1:204774382-204774404 GAGTGAGAAGAGAAGGTTTGTGG - Intergenic
920347367 1:205314973-205314995 GAGTTGAAAGAGATGGATCTTGG - Intronic
920434382 1:205938700-205938722 GAGAGGAAGGAGAGGGTTGGAGG - Intronic
920821965 1:209389742-209389764 GGGTGGAGAGGCAAGGATGGGGG + Intergenic
920868491 1:209773226-209773248 GGGTGCAAAGAGAAGGATACTGG - Intronic
920922225 1:210307521-210307543 GAGTAGAAACAGAAGGGAGGAGG - Intergenic
921095299 1:211882069-211882091 GAGTGGGGAGAGAGGGATGGGGG - Intergenic
921315763 1:213888596-213888618 GAGGGGAGAGAGAAGGTGGGAGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921455081 1:215361414-215361436 GGGTGGAGAGAGAAGGAATGGGG - Intergenic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921736659 1:218635746-218635768 GAGGGGAGAGAGAAGGAGCGGGG + Intergenic
922096193 1:222445005-222445027 GAGTTGAGAGACTAGGATGGAGG + Intergenic
922152723 1:223019162-223019184 GAATGGAAATAAAATGATGGAGG - Intergenic
922171463 1:223159184-223159206 GAGGGGCAAGGGAAGGAGGGAGG + Intergenic
922473240 1:225889201-225889223 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
922629926 1:227096411-227096433 GAGTGGGAAGACAAGGATTTAGG - Intronic
922824926 1:228511416-228511438 GAAGGGAAAGAGAGAGATGGGGG - Intergenic
922936293 1:229425710-229425732 GAGAAGAAAGAGGAGGAGGGGGG + Intergenic
923085314 1:230698662-230698684 GAGTGGAAAGACGTGGAGGGTGG + Intergenic
923110543 1:230886417-230886439 GAGTGGGAAGAGAAGGAACCTGG - Intergenic
923429119 1:233904528-233904550 GAGTCAAAAGAGAAGGGTGGAGG + Intergenic
923455828 1:234164406-234164428 GAGAGGAAAAAGAAAGAGGGAGG - Intronic
923747730 1:236718248-236718270 GAGTAGAAAGGGCAGCATGGAGG - Intronic
923772400 1:236948939-236948961 GAGTGGACACAGTTGGATGGAGG - Intergenic
924048435 1:240055921-240055943 GAATGGAAACAGAAAGATGGTGG + Intronic
924126953 1:240864766-240864788 GAGTGGAATGATAAGGCTGGAGG + Intronic
924481171 1:244435634-244435656 GAGGAGGAAGAGAAGGATGGAGG - Intronic
924481175 1:244435653-244435675 GAGGAGGAAGAGGAGGATGGAGG - Intronic
1063162056 10:3425660-3425682 GCGTGGAAAAATAATGATGGTGG + Intergenic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063986135 10:11504891-11504913 GAGTGGTAAAAGAAGGATGGTGG + Intronic
1064145536 10:12823598-12823620 GGGAGGAAAGAGTGGGATGGAGG + Intronic
1064457864 10:15505267-15505289 AAGGGGAAAGTGAAGGATTGGGG + Intergenic
1065220520 10:23491561-23491583 GAGAGGGAAGAGAGGGAGGGAGG - Intergenic
1065479279 10:26176309-26176331 GACTGGAAAGAAAAGGAAGGAGG + Intronic
1065552394 10:26882048-26882070 GAGTGGAGGGAAAAGTATGGAGG - Intergenic
1065704901 10:28463833-28463855 GAGTGGAATGAGGAAGCTGGGGG + Intergenic
1066057163 10:31692681-31692703 TAGAAGAAAGAGAGGGATGGGGG + Intergenic
1066292398 10:34026395-34026417 GGGTGGAAAGAGAAAGAAGAGGG - Intergenic
1067364012 10:45608142-45608164 GAAGGGAAAGGGAAGGAAGGGGG + Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1067935874 10:50611793-50611815 GAGGGGAGAGGGAAGGGTGGAGG - Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068410152 10:56644451-56644473 GACTCGAAATAAAAGGATGGAGG - Intergenic
1068435730 10:56989006-56989028 GAGGTGGAAGAGAAGGAAGGAGG + Intergenic
1068550625 10:58404037-58404059 TTTTGGAAAGAGAAGGATTGGGG + Intergenic
1069567197 10:69471607-69471629 GAGTCGAAAGAGAAGGGGAGGGG - Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069735889 10:70653977-70653999 GAGTCCTAAGAGAAGGAAGGAGG + Intergenic
1069739586 10:70678998-70679020 GAGGGGAAAGAGAAAGATCCAGG + Intronic
1070368664 10:75760689-75760711 GGGTGGATAGGGAAGGATGAGGG + Intronic
1070560555 10:77563585-77563607 GACTGGGAATAGCAGGATGGAGG - Intronic
1070658245 10:78285912-78285934 GAATGGGAAGAGAAGAAGGGAGG - Intergenic
1070823368 10:79375995-79376017 GAGGGCTAAGAGAAGGCTGGTGG + Intergenic
1070953376 10:80448555-80448577 GAGTGGGAAGGGAAGGTGGGAGG - Intergenic
1071062421 10:81588475-81588497 GAGGGGAAACAGAAAGCTGGGGG + Intergenic
1071094025 10:81952411-81952433 GAGGGGAGAGAGAAAGAAGGCGG + Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071497564 10:86179316-86179338 GAGAGCAAGGAGAAAGATGGAGG - Intronic
1071570653 10:86694947-86694969 GAGGAGAAAGAGAAGGTAGGTGG - Intronic
1071699621 10:87916203-87916225 GGGAGGAAAGAGAAGGAAGTGGG + Intronic
1071889018 10:89982082-89982104 GAGTGGATAGAGAAGAGTGTTGG + Intergenic
1072300524 10:94056794-94056816 GGGTGGAAAGGAGAGGATGGGGG - Intronic
1072367996 10:94733946-94733968 GAGGGGAAAGCGCAGGATGTTGG + Intronic
1072913570 10:99523430-99523452 GAATAGAAAGCGAAGGACGGAGG + Intergenic
1072940810 10:99761981-99762003 GAGTGGGGAGAGAAGGAAAGAGG + Intergenic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1074027181 10:109648625-109648647 GAGTGGTAAGGCAATGATGGAGG - Intergenic
1074603861 10:114941064-114941086 GAGTGGACAGAGAAGGGAGGAGG - Intronic
1074758400 10:116645268-116645290 GCCTGGAAAGAGAGAGATGGTGG - Intergenic
1074827982 10:117228444-117228466 GAGGAGGAAGGGAAGGATGGAGG - Intergenic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075361345 10:121838131-121838153 GAGTGGAAACAGGAGGCTGCTGG - Intronic
1075640695 10:124062335-124062357 TTGTGGAAAGAGAAACATGGCGG + Intronic
1075661575 10:124200561-124200583 GGGAGGAAAGAGAAGGAGGTAGG + Intergenic
1075742511 10:124704507-124704529 GAGTAGCCAGAGAAGGAAGGAGG + Intronic
1075922882 10:126227722-126227744 GAGGGGAAAGAGAAAGGTGATGG - Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076121851 10:127942709-127942731 GGCTGGAGAGAGAGGGATGGAGG + Intronic
1076238138 10:128881719-128881741 GAGTGAAAAGAAGACGATGGAGG + Intergenic
1076318862 10:129564169-129564191 GAGTGGAAGAAGAAGGGAGGGGG - Intronic
1076498528 10:130915751-130915773 GAGTTCCAAGAGAAGGAAGGAGG + Intergenic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077346938 11:2064587-2064609 GTGTGGAGAAAGAAGAATGGAGG - Intergenic
1077386881 11:2273603-2273625 GAGTGACAACAGAGGGATGGGGG + Intergenic
1077554506 11:3219398-3219420 GAGTGCACAGGGAAGGCTGGGGG - Intergenic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1078609286 11:12806207-12806229 GAGTGGGAAGAGAAGGGGGCAGG - Intronic
1078670268 11:13358081-13358103 GAAAGGAAAGAGAAGGGAGGTGG - Intronic
1078817175 11:14837346-14837368 GAGAGGAAAAAGAAAGATTGGGG - Intronic
1079029684 11:16977285-16977307 GTTTGGAAAGGGAAGGAGGGAGG - Intronic
1079206188 11:18416828-18416850 GAGAGGAAAGGAAAGGATGGAGG - Intronic
1079470622 11:20774149-20774171 GAGGGGAGAGGGAGGGATGGAGG - Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1080032946 11:27681113-27681135 TTGTGGAAACACAAGGATGGGGG + Intronic
1080183478 11:29451470-29451492 GTGTTGAGAGAGAAGGAGGGAGG + Intergenic
1080253453 11:30262843-30262865 GAATGACAAGAGAAGGAGGGGGG - Intergenic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1081500939 11:43666075-43666097 GAGTGGAAAGGAAGGGAGGGTGG - Intronic
1081563859 11:44244089-44244111 GAGCAGAATGAGAAGGATGGGGG - Intronic
1081669332 11:44934458-44934480 GAGTGTAGGGAGAAGGATGGGGG + Exonic
1081855039 11:46297497-46297519 GACTGGACAGTGAGGGATGGTGG + Intronic
1081999053 11:47383000-47383022 GAGTGGAAAGAGGAGTTGGGAGG - Intergenic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082847541 11:57738776-57738798 TAGTGCAAAGGGAGGGATGGTGG + Intronic
1083535415 11:63462432-63462454 GATTGCTAAGAAAAGGATGGAGG + Intronic
1084928679 11:72535934-72535956 GGGTGGGAAGGGAAGGAGGGTGG + Intergenic
1084985734 11:72869411-72869433 GAAGGGAAAGAGAGGGTTGGGGG + Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085400450 11:76232717-76232739 GAGTGGAAAGAGAAGAGCGAGGG + Intergenic
1085596910 11:77819779-77819801 GAGAGGAAGGAGAACTATGGAGG + Intronic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086404495 11:86488346-86488368 GAATGGAAAGGAAAGGAGGGTGG - Intronic
1086539860 11:87896219-87896241 GAGTGGAAATGGAAGGTCGGGGG - Intergenic
1086738081 11:90332138-90332160 GAGGGGAGAGAGGAGAATGGAGG + Intergenic
1086846024 11:91750700-91750722 AAGGGGAAAGGGAAGGAAGGGGG - Intergenic
1088325931 11:108601698-108601720 GAAAGGAAAGAGAGGGAGGGAGG - Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088617538 11:111645884-111645906 GATTAGAAAGGGAAGTATGGGGG + Intronic
1088779069 11:113116338-113116360 GAAGGGAAAGAGAAGGGTGGTGG + Intronic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089221368 11:116874768-116874790 GAGTAGGAAGAGAAGGTTGTGGG - Intronic
1089506911 11:118969519-118969541 GAGAGGGAAGAGAAGGGAGGAGG + Intergenic
1089650449 11:119909457-119909479 AAGTGGAAAGAGAGAGCTGGTGG - Intergenic
1090062620 11:123477252-123477274 GAGGGGGAAGGGAAGGAAGGGGG - Intergenic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1091070616 11:132559167-132559189 GAGGGGAAAGAGAGGGAGAGAGG + Intronic
1091078775 11:132646072-132646094 GAGTGGAAAGGGTGGGAGGGGGG + Intronic
1091579748 12:1777069-1777091 GAGAAGAAAGAGTAAGATGGAGG + Intronic
1091584998 12:1811067-1811089 GAGTGAATCGAGAGGGATGGAGG - Intronic
1091618874 12:2070919-2070941 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618904 12:2071026-2071048 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618926 12:2071098-2071120 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1091915855 12:4271518-4271540 GAGAGGCGAGAGAAGGAGGGAGG - Intergenic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092951804 12:13510556-13510578 GTGAGGAAAGAGAAGGATCAGGG + Intergenic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093203754 12:16221881-16221903 GAGAGGAAAGAGATGGATCTAGG + Intronic
1094009639 12:25793850-25793872 GAATGGAAAGAAAAGGAAGAGGG - Intergenic
1094019666 12:25900907-25900929 GAAAGGAAGGAGAAGAATGGCGG + Intergenic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094340199 12:29402551-29402573 TGGTTGAAAGAGAAAGATGGAGG + Intergenic
1094487665 12:30937918-30937940 GACTGGAAAGGGAAAGATTGTGG + Intronic
1094802568 12:34053713-34053735 GTGCAGAAAGAGAAGGCTGGTGG - Intergenic
1095115728 12:38349655-38349677 GTGCAGAAAGAGAAGGCTGGTGG - Intergenic
1095160594 12:38910277-38910299 GAGGGGGATGGGAAGGATGGAGG - Intergenic
1095247571 12:39940859-39940881 GAGGGGGAAGAGTGGGATGGGGG - Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095941245 12:47728531-47728553 GAGTGGAGGGAGATGCATGGTGG + Intergenic
1096122433 12:49097034-49097056 AAGGGGAAGGAAAAGGATGGTGG + Exonic
1096384137 12:51183550-51183572 GAGTGAAAAGGGAAGGCTAGGGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096638350 12:52975475-52975497 GAATGCAGACAGAAGGATGGAGG - Intergenic
1096749296 12:53748494-53748516 GAGTGGAAAGGGAAAGACAGAGG + Intergenic
1096787687 12:54027008-54027030 GAGTTGACAAAGAAGGGTGGTGG - Intronic
1097151054 12:56980178-56980200 GAGAGGATGGAGAAAGATGGTGG - Intergenic
1097223370 12:57462882-57462904 GAGGGGCACGAGAAGGAAGGGGG + Intronic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097477653 12:60078608-60078630 GATAGGAAAGAGGAGGATGAGGG - Intergenic
1097636374 12:62127309-62127331 GAGTGGGTAGGGAATGATGGAGG - Intronic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1097971715 12:65640056-65640078 GGGTGGGAAGGAAAGGATGGGGG - Intergenic
1098035478 12:66297518-66297540 GAGGGAGAAGAGAAGGAAGGAGG + Intergenic
1098185360 12:67890681-67890703 GAGTGGACACAGGAGGATGGTGG + Intergenic
1098203225 12:68079325-68079347 AAGTGGAGAGAAAAGGAGGGTGG - Intergenic
1098477459 12:70921248-70921270 GAGTGGAAAGAGAAGCAAAGAGG - Intergenic
1098512896 12:71339794-71339816 GAGCGGGAAGAGAAGGAGGAGGG + Intronic
1098856629 12:75660152-75660174 GGGTGGAAATAGCAGGAAGGGGG - Intergenic
1098881542 12:75922265-75922287 GAGAGGAAATGGAAGAATGGTGG - Intergenic
1098893869 12:76035434-76035456 GGGTGGGAAGAAAAGGAAGGTGG + Intergenic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100316565 12:93450067-93450089 GAGTGGAAAGCCAGGTATGGTGG - Intergenic
1100343922 12:93708596-93708618 GAGTGGTCAGAGAAGGCTGGTGG - Intronic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100622109 12:96287289-96287311 GAAGGAAAAGAAAAGGATGGTGG + Intronic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1101171004 12:102093162-102093184 GGGTGGAGAGAGAAGGAAGGAGG + Intronic
1101196344 12:102386671-102386693 GGGTGGGAAGAGAAGGAGGCAGG + Intergenic
1101236422 12:102794545-102794567 GAGAAGAAAGGGGAGGATGGAGG - Intergenic
1101570159 12:105946429-105946451 GAGTTGAAAGAAAAAGATGAAGG + Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101754819 12:107613235-107613257 AAGTGGAAAGAGAGGGCTGATGG - Intronic
1102631390 12:114283866-114283888 GACTGACAAGAGAAGGAAGGAGG + Intergenic
1102814012 12:115848165-115848187 GACTGGAAAGTGGGGGATGGAGG - Intergenic
1102816520 12:115870414-115870436 GATTGGAAATAGAAGGATCGGGG - Intergenic
1103014256 12:117481761-117481783 GAGTGGAGAGAGAAGGGAGCTGG - Intronic
1103413193 12:120726983-120727005 GAGTGGAAGGAGGAGGCAGGAGG - Intronic
1103678042 12:122672110-122672132 ACGTGGAAAGAGATGCATGGAGG + Intergenic
1103846935 12:123908303-123908325 GAGAAGAAAGAGGGGGATGGAGG - Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1104520618 12:129471490-129471512 GAGGAGAGGGAGAAGGATGGAGG - Intronic
1104772872 12:131375153-131375175 AACAGGAAAGAGAGGGATGGAGG + Intergenic
1104926661 12:132317361-132317383 GAGTGGAAGGAGCAGGAGAGAGG - Intronic
1105052372 12:133066114-133066136 GAAAGGAAAGAGAAGGAAGTAGG + Intergenic
1105839932 13:24245405-24245427 AAGTACAAAGAGAAGGATAGAGG - Intronic
1106052411 13:26204011-26204033 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1106313552 13:28574653-28574675 GAGTGGGAAGCCAAGGATGAAGG + Intergenic
1106365259 13:29073000-29073022 AAATGGAAAGTGAAGGATTGTGG - Intronic
1106782217 13:33070389-33070411 GGGAGGAAAGCGAAGGATAGAGG + Intergenic
1106870576 13:34014552-34014574 GCGTGGAAAGAGAAGGAAAATGG + Intergenic
1107882294 13:44843268-44843290 GAGTGGGAGGAGAAGGGGGGTGG + Intergenic
1108173272 13:47766239-47766261 GAATGGAGAGAGAAGAATGTGGG + Intergenic
1108221793 13:48241510-48241532 GAGTTAAAAGAGAAACATGGAGG - Intronic
1108227647 13:48305202-48305224 GAGTGGAAAGAAATGGGTGAGGG - Intronic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1108667140 13:52644007-52644029 GGGTGGAAAAGGCAGGATGGAGG - Intergenic
1108705706 13:52983697-52983719 GAATGGAGAGAGAAGGATTGGGG - Intergenic
1108777504 13:53784351-53784373 GAGTGGAGGGAGCAGGATGGAGG + Intergenic
1110229478 13:73153380-73153402 TTGTTGAAAGAGAAGGAGGGAGG - Intergenic
1110264347 13:73520995-73521017 GTGTGGAAATAGAAGATTGGAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110439619 13:75513092-75513114 GTGTGGGAAGAGAAGGGTTGTGG - Intergenic
1110459019 13:75723760-75723782 GAGTGAGAAGAAAAGGAAGGAGG + Intronic
1110866351 13:80400159-80400181 GAGTAGAAAGAGCAGGGAGGAGG - Intergenic
1110929538 13:81197395-81197417 GAAAGGAAAGATAAAGATGGTGG + Intergenic
1110932719 13:81242805-81242827 GAGTGTCAAGAGAAGAAGGGAGG - Intergenic
1110980795 13:81894984-81895006 GAGTTGGAAGAGTAGGAGGGTGG + Intergenic
1111400999 13:87734890-87734912 GATTTGAAAAACAAGGATGGTGG + Intergenic
1112151577 13:96770582-96770604 GAGAGGAAATAGAAGGATATTGG + Intronic
1112967377 13:105213116-105213138 CAGGGGAGAGAGACGGATGGGGG - Intergenic
1113266400 13:108622664-108622686 GATGGAAAAGAGAGGGATGGTGG + Intronic
1113292509 13:108922250-108922272 GAGAGGAAAGAGGAGGAAAGAGG + Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113413474 13:110110121-110110143 GCTTGGAAAGAGACGGCTGGGGG - Intergenic
1113596197 13:111535292-111535314 GAGTGGATAAAGAAGGTGGGCGG - Intergenic
1113894546 13:113755294-113755316 GAGTGAGTAGAGAAGGAAGGTGG + Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114189111 14:20427804-20427826 CAGTGGGGAGAGCAGGATGGGGG + Intergenic
1114320020 14:21539457-21539479 GAGGGGAAGGAGAGGGATAGAGG + Intergenic
1114412041 14:22509919-22509941 GAGGGGAAAGAGAAGGCTAAGGG + Intergenic
1114503933 14:23193768-23193790 GAATGGAAAGAGAAGAAGAGTGG + Intronic
1114551282 14:23534175-23534197 GAGGGGCAAGAAGAGGATGGAGG - Exonic
1114567184 14:23641354-23641376 GAGTCGCTGGAGAAGGATGGAGG - Intronic
1114749027 14:25182876-25182898 GAGTGGAAGGAGTAGGATAAGGG + Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1115469780 14:33756482-33756504 GAGTGGCAAGAGATGCAAGGCGG + Intronic
1115844585 14:37513589-37513611 GAGTGCAAAGTGAAGGATCCAGG + Intronic
1116403783 14:44542864-44542886 GAGGTGAGAGAGAAGGAAGGGGG + Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1116651893 14:47604255-47604277 GAGGGGAGAGAAAGGGATGGAGG - Intronic
1117206751 14:53451373-53451395 GATTGGAAAGAGTGGGGTGGGGG + Intergenic
1117362102 14:54985837-54985859 AAATGGAAAGAGAAGAATCGAGG + Intronic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117522315 14:56563022-56563044 GAGAAGGAAGGGAAGGATGGAGG + Intronic
1117838991 14:59838092-59838114 GAGGGGAGAGAGAGGGATAGGGG - Intronic
1117962751 14:61179107-61179129 GAGTGGAATGAGGAGAATTGAGG + Intergenic
1118701226 14:68435172-68435194 GATGGGGAAGAGGAGGATGGGGG - Intronic
1118724781 14:68621355-68621377 GAATGGCAAGAGAAGAAAGGTGG - Intronic
1118739716 14:68730916-68730938 GAGGTGAAAGTGAGGGATGGGGG - Intergenic
1120087929 14:80296535-80296557 GGATGGAAAGAGAAGGAGAGAGG + Intronic
1120508891 14:85388397-85388419 GAGTTGAAAGAAAATGAAGGAGG + Intergenic
1120575501 14:86175720-86175742 GAGGGGAGAGGGAGGGATGGAGG + Intergenic
1120751466 14:88202566-88202588 GAGACGAAAGAGGAGGACGGAGG - Intronic
1120766665 14:88333671-88333693 AAGAGGTATGAGAAGGATGGAGG - Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121439051 14:93937327-93937349 GAGGGGAGAGGGGAGGATGGTGG - Intronic
1121980284 14:98448504-98448526 GTGTGGGAAGAGATTGATGGTGG + Intergenic
1121991692 14:98564026-98564048 GAGTGGAAAGATAAGAAAGGAGG + Intergenic
1122091294 14:99342738-99342760 TAGGGGAAAGGGAGGGATGGGGG - Intergenic
1122366528 14:101197912-101197934 GTGGGGAGAGAGCAGGATGGAGG - Intergenic
1123222578 14:106870884-106870906 GGGTGTCCAGAGAAGGATGGAGG + Intergenic
1123902674 15:24892372-24892394 AAGTGGCAAGAGTAGGAAGGAGG + Intronic
1124008204 15:25811290-25811312 GAGAGGAAAGAGGAGGACAGAGG + Intronic
1125292723 15:38167511-38167533 GAGTTGAAAGATGAGGAGGGAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125793840 15:42389871-42389893 GGGTGGAAAGGGAAGGAGAGAGG - Intronic
1126394349 15:48197344-48197366 AAGTAGAAAGAGAATGATGGTGG - Intronic
1126790025 15:52212473-52212495 GAGGGGAAAGAAAAGGGTAGAGG + Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127809384 15:62550129-62550151 GAGTGGTTAAGGAAGGATGGAGG + Intronic
1128227334 15:66011241-66011263 GAGGGGACTGAGAAGGAAGGTGG + Intronic
1128427685 15:67558807-67558829 TAGTGGAAAGAGACTGAAGGAGG - Intronic
1128713635 15:69890962-69890984 GACAAGGAAGAGAAGGATGGAGG - Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1129228096 15:74181419-74181441 GAGGGGGAAGAGAAGAAAGGTGG + Exonic
1129924606 15:79352063-79352085 GGGGGGAAAGAGTAGGAGGGGGG + Intronic
1130203374 15:81853677-81853699 GGGTGGGAAGAGGAGGATGCAGG + Intergenic
1130844729 15:87734143-87734165 GAGTGGATGAAGAGGGATGGAGG + Intergenic
1130948486 15:88567348-88567370 GAGTGTAAAGAAGAGGCTGGGGG + Intergenic
1131035666 15:89220519-89220541 GAGTGGAAAGAGCAGGAAATGGG - Intronic
1131086186 15:89577364-89577386 AAGTGCAATGAGAAGGATGAAGG - Intronic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132779102 16:1613142-1613164 GAGTGGAAAGAGGTGGGTTGAGG + Intronic
1132902366 16:2264230-2264252 GAGTCGAGTGAGAAGGATCGCGG - Exonic
1133412359 16:5579307-5579329 GACTGGAAAGTGAAGGTGGGTGG - Intergenic
1133513707 16:6485332-6485354 GAGGGGTAAGAGAGGGAGGGAGG - Intronic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133745790 16:8685770-8685792 GAGTGGCAAGAGGAGGCTGTAGG + Intronic
1134278859 16:12800757-12800779 GATGGGAAAGGGAAGGATGAGGG - Intronic
1134509516 16:14834776-14834798 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134610994 16:15607665-15607687 GAATGGAAAGGGAAGCATGAAGG - Intronic
1134697221 16:16233592-16233614 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134800185 16:17077028-17077050 GAGAGGAAAGAGGTGGATGATGG - Intergenic
1134883020 16:17763034-17763056 GAATAGAAAAAGAAGAATGGAGG + Intergenic
1134974625 16:18561082-18561104 AAGAGGAAAGGGATGGATGGAGG - Intronic
1135031461 16:19042165-19042187 AAATGGAAAGAAAAGAATGGGGG - Intronic
1135110924 16:19690314-19690336 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
1135869104 16:26132669-26132691 CAGTGCAAAGAGAAGCATTGAGG + Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136074819 16:27809788-27809810 CAGTGGAAAGACAGGGAGGGTGG - Intronic
1136271868 16:29153405-29153427 GTGTGGAAAGAGAAAGGTGCCGG + Intergenic
1136416309 16:30106269-30106291 GAATGGGAAGAGATGCATGGTGG - Intronic
1137606807 16:49792433-49792455 GGGTGGAAAGAGGAGGAAAGTGG + Intronic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139272422 16:65696721-65696743 AAGAGGAAAGAGAAAGAAGGAGG + Intergenic
1139315840 16:66067755-66067777 GAATGGCAAGAGAATGAGGGTGG - Intergenic
1139672551 16:68501663-68501685 GAGAGGAGAGAGAAAGAAGGAGG - Intergenic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1139966814 16:70750365-70750387 GGGAGGAAAGAGAGGGAGGGAGG + Intronic
1140098612 16:71895710-71895732 GAGGAGAAAGGGAAGGATAGTGG + Intronic
1140356919 16:74314410-74314432 AACTGGGAAAAGAAGGATGGAGG - Intergenic
1140623172 16:76761208-76761230 AGCTGGAAAGAGAAGGAGGGAGG + Intergenic
1140732121 16:77865810-77865832 GAGTGGGAAGAGAAGGGAGATGG + Intronic
1140781435 16:78300492-78300514 GAGGGGAGAGGGAAGGAGGGAGG - Intronic
1140786827 16:78350437-78350459 GAGTGGAGAGAAAAGGAAGTGGG - Intronic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1140967668 16:79983004-79983026 GAGTGAAAATAGAAGGGAGGGGG - Intergenic
1141185700 16:81785558-81785580 GACAGGATAGAGAAGGATGTTGG + Intronic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142895871 17:2978464-2978486 GGGTGGATAGAGTGGGATGGTGG + Intronic
1142928323 17:3260302-3260324 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
1142982448 17:3679953-3679975 GGGTGGAGAGAGCAGGGTGGAGG - Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143502055 17:7345021-7345043 GAGTTGGAAGAGCAGGGTGGTGG + Intronic
1143638714 17:8182563-8182585 GTGGGGAGAGGGAAGGATGGGGG + Intergenic
1143712284 17:8743226-8743248 CAGTGCAAGGACAAGGATGGAGG + Intronic
1143779662 17:9222580-9222602 GTGAGGAAAGAGGAGGAGGGAGG + Intronic
1143818535 17:9540530-9540552 GAGAGGAAGGAGAATGATGTCGG - Intronic
1143953121 17:10649057-10649079 GATTGGAAAGTCAAGGAGGGTGG - Intronic
1144255014 17:13458964-13458986 GAGGAGAATGAGAAGAATGGAGG - Intergenic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145204557 17:20976063-20976085 GAGGGGGAAGAGGATGATGGAGG - Intergenic
1146497209 17:33333788-33333810 GAGAGGAAAGAGGAGGATTATGG + Intronic
1146624272 17:34424066-34424088 GAGTGGAGACGGAGGGATGGAGG + Intergenic
1146994873 17:37310926-37310948 GATTGGTAAGAGTAGAATGGAGG + Intronic
1147188466 17:38725536-38725558 GTCTGGAAAGAGAGGGAGGGAGG - Exonic
1147452728 17:40515942-40515964 GAGTGCTAAGGGAAGGATGGGGG - Intergenic
1147569465 17:41559625-41559647 GAGTGGAGAGAGAAGTAGAGGGG - Intergenic
1147717218 17:42516548-42516570 GAGTGAAAAGAAAAGAAAGGAGG - Intronic
1147899398 17:43774160-43774182 GAGTGGGAAGAGATGGCTGCAGG + Intronic
1147962063 17:44173820-44173842 AAGTGGGAAGAGAGGTATGGGGG + Intronic
1148392622 17:47283656-47283678 GGGTGGGAAGACAAGGATGAGGG + Intronic
1148579490 17:48733952-48733974 GAGAGGAAAAAAAAGGAAGGAGG - Intergenic
1148682831 17:49484461-49484483 GATTGGAAGGAGGAGGAGGGAGG - Intergenic
1148763446 17:50021734-50021756 CAGTGGAATGAAGAGGATGGGGG - Intergenic
1149242595 17:54667879-54667901 GAGTGGAAAGAGAACCAAGGAGG + Intergenic
1149438937 17:56658785-56658807 GCATGGAAAGAGAAAGCTGGAGG - Intergenic
1149528355 17:57375820-57375842 GAATGAAAGGAGAAGGATGGGGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151179129 17:72313030-72313052 GAGTAGAAAAAGAAGGAAGTTGG - Intergenic
1151236536 17:72724184-72724206 GAGAGGAAAGAGAGGGACAGAGG + Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151345764 17:73500359-73500381 GGGAGGATGGAGAAGGATGGAGG - Intronic
1151507184 17:74537105-74537127 GAGTAGAAAGAGGAGAAAGGAGG + Intergenic
1151624459 17:75267914-75267936 GAGAGGAAGGTGAAGGGTGGGGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151850575 17:76687328-76687350 CAGTGGAAAGAGAAGGTTTCAGG - Intronic
1151886922 17:76928315-76928337 GAGTGGAAATAGAGGCAGGGAGG + Intronic
1152373161 17:79903127-79903149 GAAAGGAAAGAGAGGGAGGGAGG - Intergenic
1152799781 17:82325483-82325505 GAGGGGAAAGGGAATGTTGGGGG - Intronic
1152914879 17:83028959-83028981 GAGTGGAAAGAGAAACACGAGGG + Intronic
1153328628 18:3848836-3848858 GAGTGGAAGGAGAAGGACAGTGG - Intronic
1153400962 18:4683209-4683231 GAGGGGACAGAGAGAGATGGAGG + Intergenic
1153917407 18:9758276-9758298 GAGTGGGATCAGCAGGATGGGGG + Intronic
1153939902 18:9968635-9968657 GAGTGGAGGGAGAAGGAATGGGG - Intergenic
1155446762 18:25921168-25921190 GATTTGAAAGAGAAGAATGAAGG - Intergenic
1155496087 18:26444047-26444069 AGGTGGAAAGATAAGGATGATGG - Intergenic
1155725990 18:29083951-29083973 GACAGGAAAGAGGAGGCTGGTGG + Intergenic
1155784370 18:29879035-29879057 AAGAGGAAAGAGTAGGATTGGGG - Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1156794201 18:41022272-41022294 GAGGGGACAGAGAAAGAAGGTGG + Intergenic
1156965379 18:43085046-43085068 GAGTAGAATGAGAAGGAAGCGGG + Intronic
1157467500 18:47959993-47960015 GAAGGCAAAGAGTAGGATGGTGG - Intergenic
1157612715 18:48968433-48968455 GAGAGGGAAGGGAAGGAGGGAGG + Intergenic
1157895206 18:51460082-51460104 AAGGGGAAAGATAAGGATGGAGG - Intergenic
1158776250 18:60583579-60583601 GAGTGAAAAAGGAAGGATGACGG - Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1160001878 18:75032496-75032518 GAGAGAAGAGAGAAGGTTGGTGG - Intronic
1160011131 18:75107796-75107818 GAGTCGGAAGAGAAGGAGGAAGG - Intergenic
1160130767 18:76223033-76223055 GAGTGAAGAGATAAGGTTGGTGG + Intergenic
1161619932 19:5292641-5292663 GAGCGGAAACAAATGGATGGAGG + Intronic
1162270215 19:9608239-9608261 GAGGGGAAGGAGAGAGATGGTGG + Exonic
1162480778 19:10925852-10925874 GCATGGAAAGAGAAGGGTGGAGG - Intronic
1162887449 19:13706312-13706334 GGGAGGAAAGAGAAGGACAGAGG - Intergenic
1163623295 19:18373523-18373545 GAGTGGAAGGGCAAGAATGGAGG - Intergenic
1164441378 19:28282870-28282892 CAGTGGGAAGAAGAGGATGGTGG - Intergenic
1164578459 19:29419558-29419580 GAGTGGAAGCAGAAGGGTGGGGG - Intergenic
1165213550 19:34254094-34254116 GAGGGGAAAGAGTAAGAGGGAGG - Intergenic
1165405959 19:35631301-35631323 GAGGGGAGAGGCAAGGATGGTGG - Intronic
1165407207 19:35638144-35638166 GAGTGGTCAGGGCAGGATGGGGG + Intergenic
1165454580 19:35903328-35903350 CTGTGGAAAGAGAAAGAAGGTGG - Intronic
1165655568 19:37529378-37529400 GGATGGAAAGAGAAGTGTGGTGG - Intronic
1165768996 19:38367612-38367634 GAGTGGAAGGAGATGGGTGCAGG + Intronic
1165779482 19:38423932-38423954 TAATGGAGAGACAAGGATGGTGG + Intronic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1165994509 19:39834192-39834214 GAGCGGAGAGGGAGGGATGGGGG - Intronic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166178823 19:41092971-41092993 ATTTGGAAAGAGAAGGATGAGGG - Intronic
1166351352 19:42199904-42199926 GGGTGGAGGGAGAAGGCTGGAGG - Intronic
1166910149 19:46148726-46148748 GAGTGGAGGGAGAAGAAAGGAGG + Intronic
1167567340 19:50264913-50264935 GAAAGGAATGAGAAGGATGGAGG + Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167642872 19:50691434-50691456 GAGGGGAGGGAGAAAGATGGAGG - Intronic
1167685412 19:50952863-50952885 GAGGGGACAGAGAAAGATGTGGG + Exonic
1167686781 19:50961494-50961516 AAGTGCAGAGACAAGGATGGAGG - Intronic
1167724296 19:51200247-51200269 GAGGGGAGAGGGAAGGATGGGGG - Intergenic
1168523178 19:57068822-57068844 CAGTGGTAAGAGGAGGCTGGAGG + Intergenic
1168698193 19:58417999-58418021 GGGTGGATAGAGGTGGATGGCGG - Exonic
925390461 2:3490571-3490593 GAGTGGATGGGGAAGGATGGAGG - Intergenic
925842591 2:8006582-8006604 GAGGAGGAAAAGAAGGATGGAGG - Intergenic
925862600 2:8194475-8194497 GAGAGGAGGGAGGAGGATGGTGG - Intergenic
925895401 2:8467759-8467781 GACTGAAAACAGAAGCATGGTGG - Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
926531734 2:14055506-14055528 CAGTGGAAAGTGGAGGCTGGTGG - Intergenic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
926703928 2:15823012-15823034 GAGTGGAAGGTGAAGGTTGAGGG + Intergenic
926772525 2:16391235-16391257 GACTGGAAAGAACAGGATGTAGG + Intergenic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
926875430 2:17471440-17471462 GAGTGGGAAGAGGAGCATTGTGG + Intergenic
927583475 2:24277164-24277186 GAGTAGAAAAAGGAGGCTGGAGG + Intronic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928133445 2:28670186-28670208 GAGAGAAGAGAGATGGATGGTGG + Intergenic
928373654 2:30758747-30758769 GAAAGGAAAGAGAGGGAGGGAGG - Intronic
928443497 2:31312799-31312821 TAGTGGAGAGAGAAGGAAAGAGG - Intergenic
929187647 2:39112058-39112080 GAGTTAGAAGAGAAGGATAGTGG - Intronic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
930044003 2:47152972-47152994 CTTTTGAAAGAGAAGGATGGTGG - Exonic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
930360390 2:50370674-50370696 GAGTAGAAAGGGAAAGGTGGTGG + Intronic
930852512 2:55975621-55975643 GGGTGGGAAGAGGAGGGTGGGGG + Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931553024 2:63468168-63468190 GAAAGGAGAGAGAAGGAAGGAGG - Intronic
931759797 2:65406615-65406637 GGGTGGAAATGGAAGGTTGGGGG + Intronic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932192548 2:69753171-69753193 GCATGGCAAGAGAAAGATGGAGG - Intronic
932430367 2:71670532-71670554 GAGTGGAGAGAGGAGGGTGATGG - Intronic
932542367 2:72668766-72668788 GAGGGGAGAGAGAATGATAGGGG + Intronic
932697205 2:73966932-73966954 GTGGGGAAAGATAAGGCTGGAGG - Intergenic
932708716 2:74047027-74047049 GGGTGGAATGAGAAGGCTGCGGG - Exonic
932730668 2:74219830-74219852 AAGTGGGATGAGAAGGAAGGTGG + Intronic
932841601 2:75088310-75088332 GCGTGGAGAGGGAAGGAAGGAGG - Intronic
933897129 2:86821831-86821853 CAGGGGGAAGAGAAGGGTGGAGG - Intronic
935014168 2:99164305-99164327 GAGTGGAGAGGGGAGGAGGGGGG - Intronic
935016960 2:99191974-99191996 GATTAGGATGAGAAGGATGGTGG - Intronic
935062746 2:99622465-99622487 GAGTGGTAAGAAAAAGAAGGGGG + Intronic
935379359 2:102435306-102435328 AAGTGGAAACAGAAAGAAGGTGG + Intronic
935505603 2:103898374-103898396 AAGTAGAAAGAGAAAGAAGGAGG + Intergenic
935520568 2:104098848-104098870 GAGTTGAAAGAAAAGGGAGGGGG + Intergenic
935635750 2:105248569-105248591 GAGAGGCAAGAGGAGGGTGGAGG + Intergenic
935747203 2:106198881-106198903 GAGTGCAAAGATGAAGATGGAGG - Intergenic
936983712 2:118288324-118288346 GAGGGGATAGAGAAGGAATGAGG + Intergenic
937234653 2:120423402-120423424 CAATGGAAAGAGGAGGAGGGAGG - Intergenic
937265736 2:120613696-120613718 GAGGGGAAAGAGAACGCTGGAGG - Intergenic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
937552318 2:123108922-123108944 GAGAGGGAGGAGCAGGATGGTGG - Intergenic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
938559706 2:132460975-132460997 GAGTGGACTGAGAAGGATAGAGG + Intronic
938744014 2:134260011-134260033 CAGTGGAAAGAGAGAGGTGGAGG + Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
938943765 2:136192123-136192145 GAGTGGAAGGGGAAGCCTGGGGG + Intergenic
939011838 2:136855774-136855796 GAGTGATAAGAGAAGAATGAGGG - Intronic
939069451 2:137521489-137521511 GAGAAGAAAAAGAGGGATGGGGG - Intronic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
939202031 2:139048262-139048284 GGAGGGAAAGAGAAGGAGGGGGG + Intergenic
939315107 2:140538367-140538389 GAGTGGGGAGAGAAAGACGGTGG - Intronic
939579196 2:143928277-143928299 GAAAGGAGAGAGAAGGAGGGAGG + Intergenic
939628054 2:144502624-144502646 GAGTGGAAAGAGAGGCAGAGGGG + Intronic
939844652 2:147228736-147228758 GACAGGATAGAGAAGGATGAAGG - Intergenic
939884829 2:147670217-147670239 GAGAAGAAAGAGAGGCATGGAGG + Intergenic
940277087 2:151950797-151950819 GAGTAGAAAGAGAAGGGAGTGGG + Intronic
940531420 2:154882615-154882637 GAGTATAAAGAGAAGGAAAGGGG - Intergenic
941675942 2:168343772-168343794 GGGTGGAAAGTGAAGGGTGGAGG + Intergenic
942892536 2:181008660-181008682 TAGTGGTGAGAGGAGGATGGAGG + Intronic
943635760 2:190305172-190305194 GAATAGAAAGAAAAGGAGGGGGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944848143 2:203689664-203689686 GGGTGGGAAGTGGAGGATGGGGG - Intergenic
944894378 2:204149466-204149488 GAGTGGAAAGTTCAGGATGGAGG + Intergenic
944982386 2:205136231-205136253 GAATGGAAAGAAAAGGAGGAAGG - Intronic
945455657 2:210049301-210049323 GAGAGGAAAGAGAAGTGTGGTGG - Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946458402 2:219848412-219848434 GAGGGGATGGAGCAGGATGGTGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946896017 2:224324995-224325017 GGGTATAAAGAGAAAGATGGTGG + Intergenic
946915460 2:224516046-224516068 GAATGAAAGGAGAAGGTTGGAGG - Intronic
946947582 2:224837504-224837526 GAGAGGAAAGAAAAAGATAGAGG - Intronic
947282497 2:228470931-228470953 GAGAGAATAGAGAAAGATGGGGG - Intergenic
947351249 2:229247934-229247956 GAGTAGTAAGAGAAGGAGGTGGG - Intronic
947646530 2:231745897-231745919 GAATGGGAAGGGAAGGATTGGGG + Intronic
947890696 2:233616720-233616742 GAGTTGAAGGTGAAGCATGGTGG - Intergenic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948138941 2:235658953-235658975 GGGAGGAAAGAGGAGGAGGGAGG - Intronic
948726818 2:239939192-239939214 GAGTGGAAAGGGAGGCCTGGGGG + Intronic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
949045986 2:241872873-241872895 GAAGGCAAAGAGAAGGAAGGTGG + Exonic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1168965716 20:1896683-1896705 GGGTGGAAGGAGAAGTATGGGGG + Intronic
1169087736 20:2837882-2837904 GAGTGGAAAGACAGGGAGGAAGG - Intronic
1169316716 20:4597896-4597918 GAGAGGAGAGAGAGGGAGGGAGG - Intergenic
1169329667 20:4706393-4706415 GAGTGGGAAGAGAAGGGGGTAGG + Intergenic
1170132209 20:13032740-13032762 GAGTGGTGAGTGAAGGATGAAGG - Intronic
1170172094 20:13426072-13426094 GACTGAAAAGAGGAGGATGTGGG + Intronic
1170480431 20:16760103-16760125 GAGTTGGAAGAGATGGAAGGAGG - Intronic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1170570273 20:17628633-17628655 GGCTGGAAGGAGAAGGCTGGTGG - Intronic
1170579922 20:17691040-17691062 GATTGGAAAGAGAAAGCAGGGGG - Intergenic
1171019460 20:21572090-21572112 GAGTGGAGAGAGAAGGGTTGCGG + Intergenic
1171390091 20:24795657-24795679 GACTGGAAAGAGAGGGAGGTTGG + Intergenic
1172250440 20:33475751-33475773 GAGGGGAGAGTGAAGGATGCTGG - Intergenic
1172360883 20:34311895-34311917 GCGTGGGATGAGAAGGATTGAGG - Intergenic
1172587471 20:36094617-36094639 GAGTGTAAAAGGAAGGAAGGTGG + Intronic
1172995014 20:39064316-39064338 GGGTGGAAAGACAGGGAAGGGGG - Intergenic
1173473424 20:43341080-43341102 TATTTGAAAGAGAAAGATGGGGG + Intergenic
1173780179 20:45749411-45749433 GAGAGGAAATAGACTGATGGAGG + Intronic
1173952198 20:47002143-47002165 AGGTGGAGAGAAAAGGATGGGGG - Intronic
1174557736 20:51407789-51407811 GAGTGGAAAGTGAAGGCTTAGGG - Intronic
1174707673 20:52673812-52673834 GAGTAGAACGTGGAGGATGGCGG - Intergenic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1175710603 20:61217447-61217469 GAGTGGGAAGAGACGTGTGGTGG - Intergenic
1175999888 20:62827067-62827089 GAGTGGTCAGAGATGGCTGGAGG - Intronic
1176019550 20:62955654-62955676 TAGTGGAAAGTTAAGGGTGGGGG + Intronic
1177455333 21:21331003-21331025 GAATGGTAAGAGAGGCATGGAGG - Intronic
1177567108 21:22838177-22838199 GAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1177674372 21:24277308-24277330 GAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1177836388 21:26190128-26190150 GAGTAGGAAGAGAAAGAGGGTGG + Intergenic
1177844215 21:26269734-26269756 GAGTGGAGAGGGGTGGATGGAGG + Intergenic
1178189664 21:30265901-30265923 GAGTAGAAAGAGCAGGGAGGAGG - Intergenic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179965613 21:44802928-44802950 GAGTGGAGTGAGAGGGAGGGAGG - Intergenic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181612760 22:24029707-24029729 GAGTGGAAATAGAAGGCAGTGGG + Intronic
1181887356 22:26031878-26031900 GAATGGCAAGAGGTGGATGGTGG - Intergenic
1181927343 22:26370568-26370590 GAGAAGAAAGAAAGGGATGGAGG - Intronic
1182050668 22:27310495-27310517 GAGAGAGAAGAGAAGGAGGGAGG + Intergenic
1182155959 22:28073181-28073203 AAGTTGAGAGAGAAAGATGGAGG + Intronic
1182657161 22:31899897-31899919 GAGTGGAGGGGGAAGGGTGGAGG - Intronic
1182710896 22:32322640-32322662 GCTGGGAAAGAGCAGGATGGGGG + Intergenic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1183422358 22:37719258-37719280 GAGGGGACAGAGAAGGAGAGAGG + Intronic
1183512157 22:38242634-38242656 GAGGGGAAATACAAGGATCGGGG + Intronic
1183602640 22:38849021-38849043 TAGAGGAGAGGGAAGGATGGAGG - Intergenic
1184135938 22:42549952-42549974 GAGTGTGAAGATGAGGATGGGGG + Intergenic
1184661365 22:45967070-45967092 GAGTGGGAAGACAAGGAAGGGGG + Intronic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1185071248 22:48657851-48657873 GAGCAGAGAGGGAAGGATGGGGG + Intronic
1185119625 22:48958165-48958187 GGGTGGAAAGAGATCGTTGGGGG - Intergenic
1185214325 22:49589843-49589865 GAGTGGGAAGAGAAGAAGGATGG - Intronic
1203313900 22_KI270736v1_random:166934-166956 GAGTGGAAAGAAATGGAGTGAGG + Intergenic
949319947 3:2798071-2798093 GAGTTGAAAGAGTGGGAGGGTGG - Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
950018667 3:9770783-9770805 GAGTGGAAAGAGGGGGCGGGGGG + Intronic
950041787 3:9924325-9924347 GAGTGGGAAGATGATGATGGGGG + Intronic
950094345 3:10319983-10320005 GAGTGGGGAGAGAGGGAGGGTGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950567254 3:13777499-13777521 GGAAGGAAAGAGAACGATGGTGG - Intergenic
950651047 3:14406867-14406889 GAGTGGGGAGGGAATGATGGGGG + Intronic
951194503 3:19808911-19808933 GAGAGGAAAGTGAGGGATGTAGG + Intergenic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
951827417 3:26883628-26883650 GAGTCAAAATAAAAGGATGGAGG + Intergenic
952089251 3:29864860-29864882 GAAGGGGAAGAGAAGGAGGGAGG + Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952715540 3:36476299-36476321 GAGGGGACAGAGAAGAGTGGTGG + Intronic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
953761321 3:45689431-45689453 GGGCGGAGAGAGAAGGAAGGAGG + Exonic
953806852 3:46077927-46077949 GAGTGGGGAGAGAAGGAAAGGGG + Intergenic
954138064 3:48591374-48591396 GTGTGGAAGGAGAGGGCTGGAGG + Intronic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
955726181 3:61935197-61935219 GAGGTGAGAGACAAGGATGGGGG - Intronic
955972120 3:64445806-64445828 GAGTGGAGATGGAAGGATGAGGG + Intergenic
956219298 3:66884717-66884739 GAAAGGGAAGAGAAGGAGGGAGG + Intergenic
956402177 3:68891716-68891738 GAGTGGAAGGGTAGGGATGGGGG + Intronic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
958630090 3:96673154-96673176 GAGGGGAGAGAGAGAGATGGAGG - Intergenic
958849686 3:99309401-99309423 GGGTGGAAATAAAGGGATGGAGG - Intergenic
959539628 3:107524043-107524065 GAGGGGGAAGAGGAGGAGGGAGG + Intronic
959562661 3:107800233-107800255 GATTGGACAGAAAAGGAGGGAGG - Intronic
959626315 3:108456119-108456141 AAGAGGAAAGAGAGGGAGGGAGG + Intronic
959675876 3:109035107-109035129 GGGTTCAAAGAAAAGGATGGGGG - Intronic
959796276 3:110432410-110432432 GAGGGGAGAGGGAAGGAGGGGGG - Intergenic
960048877 3:113222087-113222109 GAAGGGAGAGAGAATGATGGTGG - Intronic
960061212 3:113323465-113323487 GAGTGGTGAGGGAAGGAGGGGGG + Intronic
960530293 3:118756459-118756481 GAGGAGAAAGAGAAGAAAGGAGG + Intergenic
960684493 3:120283602-120283624 GAGTGGAAAAATAATGATTGAGG - Intronic
960983933 3:123259283-123259305 GAGTGGAATGAAATTGATGGGGG + Intronic
961615344 3:128175114-128175136 GCGTGGGAAGAGAAGGGAGGAGG - Intronic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
961906270 3:130265773-130265795 GAGTGGTAATAGAAGGCTGATGG + Intergenic
962104727 3:132378982-132379004 GATTGGAAAGAGCAGGTTTGAGG + Intergenic
962239819 3:133743021-133743043 GGGAGGAAAGAGAGGGAGGGAGG - Intergenic
962862680 3:139419143-139419165 GAGAGGAGAGAGAAGAGTGGAGG - Intergenic
962981457 3:140494340-140494362 GAGAGGTAAGAGAATGAGGGAGG + Intronic
963049326 3:141128037-141128059 GAGAAGAAAAAGAAGGCTGGTGG + Intronic
963326726 3:143871350-143871372 GATTGGAAAGAAACAGATGGAGG + Intergenic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
963724657 3:148906427-148906449 GAGTGGAAAGCACAGGGTGGTGG + Intergenic
963935328 3:151046506-151046528 GACAGGAAAGAGAAAGATGTGGG + Intergenic
964124333 3:153220353-153220375 GAGGGGAAAGAGAGGGATATAGG - Intergenic
966210894 3:177452415-177452437 GAGGGGAAAGAAAGGGAGGGAGG - Intergenic
966527238 3:180932705-180932727 GAAGGGAAAGAGAAGTATGTAGG + Intronic
967511738 3:190321275-190321297 TCTTGGAAAGAGAAGGTTGGTGG - Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968593904 4:1472799-1472821 GAGGGGACAGAGACGGATTGGGG - Intergenic
969148041 4:5141504-5141526 GAGTGGGAAGAGAAGGCTTGGGG + Intronic
969859304 4:10023160-10023182 GAGCGGACAGAGAAGGATACGGG + Intronic
970001772 4:11372125-11372147 GAGTCGAGTGAGAAGGATCGCGG + Intergenic
970520205 4:16875877-16875899 GAGTGGAAGGAGAAGGATAGAGG - Intronic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
971504922 4:27356113-27356135 GAGTGAAAAGAGGAAGATGATGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972127747 4:35790208-35790230 GAGAGGGAAGGGGAGGATGGGGG + Intergenic
972193615 4:36626164-36626186 GGGTAGAAAGAGCAGGGTGGAGG - Intergenic
972230631 4:37068810-37068832 GTGTGGCAAGAGAAAGTTGGAGG + Intergenic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972418278 4:38863796-38863818 GGGAGGGGAGAGAAGGATGGAGG - Intergenic
972732225 4:41806188-41806210 GAGGGGAAGGTGATGGATGGAGG + Intergenic
972798591 4:42448379-42448401 GAAAAGAAAGAGAAGGAGGGAGG - Intronic
973544153 4:51963678-51963700 GTTTGGGAAGGGAAGGATGGAGG - Intergenic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
973808062 4:54544638-54544660 GTGTGGGAAGAGAAAGAAGGGGG - Intergenic
973865469 4:55108696-55108718 GAGTGGAGAGGGAGGGAGGGAGG - Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975362350 4:73485675-73485697 GAGGTGGAAGAGAAGGAGGGGGG + Intronic
975406726 4:73998784-73998806 GTGTGGAAAGAAGAGGTTGGGGG + Intergenic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
977188502 4:93970684-93970706 AAGGGGAAAGAGAAAGATTGAGG + Intergenic
977914721 4:102578592-102578614 GAGAGGAAAGGGAAAGGTGGGGG + Intronic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978400971 4:108330355-108330377 GAGTGGGAAGAGCAGGAAGGAGG - Intergenic
978482734 4:109212659-109212681 AAGTGGAAAGCCAAGGAAGGGGG + Intronic
979436809 4:120702986-120703008 TGGGGGAAAGAGAAGGCTGGTGG - Intronic
979457378 4:120942417-120942439 GAATGGAAAGAGAAGGAAACTGG - Intergenic
979545855 4:121939227-121939249 GAGTGAAAAGAAAAGGATCATGG + Intronic
980121190 4:128730225-128730247 GAAGGGGAAGAGAAGGAAGGAGG - Intergenic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981283500 4:142988980-142989002 GAATTGAAACAGAAGGATGCTGG - Intergenic
981579744 4:146239459-146239481 GAGAGGAAAGAGATGGGTGGAGG - Intergenic
981672998 4:147309211-147309233 TAGTGGGAAGAAAAAGATGGTGG + Intergenic
981863579 4:149386252-149386274 CAGTGGAGAGAGAAGAATGAGGG + Intergenic
982049678 4:151488317-151488339 GAGTGGAGAGAGAGTGAGGGGGG - Intronic
982184940 4:152786575-152786597 GAGAGGACAGATAAGAATGGAGG - Intronic
983057225 4:163112448-163112470 GAGAGGAAACACATGGATGGAGG + Intronic
983525495 4:168756550-168756572 TAAGGGAAAGAGAAGGATTGAGG + Intronic
983653167 4:170053617-170053639 GACTGGAAGAAGAAGGAGGGGGG - Intergenic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984515656 4:180735855-180735877 GAGTTGAAATGGGAGGATGGTGG - Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985870404 5:2549718-2549740 TAGTTGAAAGAGAAGCTTGGTGG - Intergenic
985966761 5:3343641-3343663 GGGGGGAGAGAGAAGGGTGGGGG - Intergenic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986310459 5:6547217-6547239 GAGTGGAAAGGGAAGGGAAGGGG - Intergenic
986470357 5:8067681-8067703 GAGTGGGAAAGGAAGGCTGGAGG + Intergenic
986565045 5:9104722-9104744 GGGTGGAAGGAGCAGGGTGGTGG - Intronic
986589887 5:9357649-9357671 GAGTGCCAAGAGAGGGTTGGAGG + Intronic
986857832 5:11891633-11891655 GTGAGGAAAGAGCAGGAAGGCGG + Intronic
987151471 5:15045107-15045129 GAATGGGAACAGAAGTATGGTGG + Intergenic
987212538 5:15697604-15697626 GAGTGAGAACAGAATGATGGAGG + Intronic
987333913 5:16881717-16881739 GAGTGGAAGTAGAAAGATTGGGG - Intronic
987353218 5:17039917-17039939 GAGGAGAAGGAGGAGGATGGGGG - Intergenic
988673932 5:33411617-33411639 GAGTGAAGAGAGAAGGAAAGGGG - Intergenic
988926110 5:35992403-35992425 AAGGGGAAAGAGAAGTGTGGAGG + Intergenic
989098818 5:37806005-37806027 GGGTGGAAAAAGAAGGCTGGAGG + Intergenic
989502136 5:42179873-42179895 GAGAGGAAAGAGGGGCATGGAGG + Intergenic
990224966 5:53640181-53640203 AAGTGGAAAGTGAAGGATTCTGG + Intronic
990332227 5:54739512-54739534 CAGTGGAGAGAGATGGGTGGAGG - Intergenic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
990875235 5:60476796-60476818 GAGCAGAAAGGGAATGATGGCGG - Intronic
991646676 5:68807978-68808000 GAGTGGGAAGGGAAGGGAGGGGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992022388 5:72637219-72637241 GAAAGGAAAGAGAGGGAGGGAGG + Intergenic
992658662 5:78936060-78936082 GAAGGGAAAGAGAGGGAGGGAGG - Intronic
992676794 5:79112854-79112876 GAAGAGAGAGAGAAGGATGGAGG + Intronic
992936049 5:81706331-81706353 GAGGGGAGAGGGAAGGATAGAGG + Intronic
993124682 5:83819080-83819102 GAAGGGAGAGAGAGGGATGGGGG - Intergenic
993511483 5:88776634-88776656 GAGAGGAAAGAAAGGGAGGGAGG + Intronic
993894341 5:93513653-93513675 GAGGGGAGAGAGAAGGCAGGGGG + Intergenic
994113490 5:96035603-96035625 GAGTGTAAAGAGTGGAATGGGGG + Intergenic
994186746 5:96823394-96823416 GACTCGAATGAGGAGGATGGCGG - Intronic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
995147441 5:108802499-108802521 GAGGGGAGAGGGAAGGACGGGGG - Intronic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
996156319 5:120107175-120107197 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
996483105 5:123997956-123997978 GCGTGAAAAGAGAAGCATGTGGG + Intergenic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
996916884 5:128722778-128722800 CAGTTGAAAGACAAAGATGGGGG - Intronic
997076888 5:130689552-130689574 GAGTGGACGGAGAGGGCTGGTGG - Intergenic
997203031 5:132024222-132024244 GAATGGAAATAAAAGGATGAGGG - Intergenic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997755571 5:136395741-136395763 GAGAGGTAAGAGAAAGATGCAGG + Intronic
997836041 5:137194276-137194298 GAGGGGACAGAGTAGCATGGTGG + Intronic
997853384 5:137352652-137352674 GAGTGGAGGGAGAAGAAAGGTGG + Intronic
997879406 5:137576036-137576058 GAGAGGCAAGGGAAGGATGTGGG + Intronic
998370190 5:141655844-141655866 GAGGGGAAAGAAAAGGCTGAGGG - Intronic
998413932 5:141931654-141931676 GGTGGGAAAGAGGAGGATGGTGG + Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998570525 5:143252896-143252918 GATTGGAAAGAGCAAGAAGGAGG - Intergenic
998736332 5:145145465-145145487 GAGTGGGAGGAGAAAGAGGGTGG - Intergenic
999007791 5:148001838-148001860 GGGTGAAAAGAGAAAAATGGGGG - Intergenic
999252657 5:150191810-150191832 GAGAGGGAAGAGAAGGAGAGTGG - Intronic
999558354 5:152770671-152770693 AAAAGGAAAGGGAAGGATGGAGG + Intergenic
999616327 5:153428486-153428508 GAAAAGAAAGAGAAGGAAGGAGG + Intergenic
999744967 5:154584947-154584969 GAGGGGACAGATAGGGATGGAGG - Intergenic
1000033210 5:157420786-157420808 GAGTGGGAAGGGCAGGAGGGGGG + Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000137142 5:158363775-158363797 AAGTGGACACAGAGGGATGGTGG + Intergenic
1000555374 5:162718886-162718908 GAGTGGTAAGAGGAGGCTGAGGG - Intergenic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1000966666 5:167665900-167665922 GAGAGGAATGAGAATGATGTTGG - Intronic
1001088642 5:168720575-168720597 GAATGGTAGGAGAAGGAAGGGGG + Intronic
1001108495 5:168875790-168875812 GAAGGGAAAGAGAAGGGTGGAGG + Intronic
1001241944 5:170077891-170077913 GAGAAGAGAGAGAAGGAGGGGGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001514459 5:172345687-172345709 GAGTGGGAAGAAAAGGAGAGAGG + Intronic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1002025738 5:176395188-176395210 GGGTGGGAAGAGAAGGTGGGAGG - Intronic
1002170497 5:177371700-177371722 GCGTGGAACAGGAAGGATGGGGG + Intronic
1002381331 5:178831950-178831972 GAGGGGAAAGAGCAGGTTGGGGG - Intergenic
1002851762 6:1003164-1003186 GAGAAGACAGGGAAGGATGGCGG - Intergenic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002980526 6:2131862-2131884 GAGTGGCAAGAATGGGATGGAGG - Intronic
1003328849 6:5112891-5112913 GTGTGGATAGAGAAGGGTGAGGG + Intronic
1003579283 6:7325074-7325096 GAGTGGAGAGAGAAGGGTCTAGG - Intronic
1003673460 6:8181322-8181344 GAGAGGAAAGTAAAGGAGGGAGG - Intergenic
1003773302 6:9331919-9331941 GTGCAGAAACAGAAGGATGGAGG + Intergenic
1004726092 6:18312596-18312618 GAATGGAAACAGAGGGTTGGAGG - Intergenic
1004739727 6:18447129-18447151 AAGGGGAAAGAGATAGATGGGGG + Intronic
1005049677 6:21673309-21673331 GAGAGGAAAGAGGAATATGGCGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005845443 6:29773377-29773399 GAAGGGGAAGAGAAGGAGGGAGG - Intergenic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1005995471 6:30928460-30928482 GAGTGAGAAGGGGAGGATGGTGG + Intergenic
1006098799 6:31672868-31672890 GACTGGATTGAGAGGGATGGGGG - Exonic
1006104984 6:31711033-31711055 AAGTGGAAAGAGATGGACAGAGG + Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1007040440 6:38716334-38716356 GAGGGGAATGAGAAGGGTAGAGG - Intronic
1007040679 6:38719376-38719398 GAAGGGGAAGGGAAGGATGGGGG - Intronic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007368597 6:41411817-41411839 GACAGGGAAGAGAAGGATGAGGG - Intergenic
1007593717 6:43038733-43038755 GAGTGGAGAGAAGAGGATGGAGG + Intronic
1008101874 6:47400592-47400614 GAGGGGAGAGAGCAGGTTGGAGG - Intergenic
1008498563 6:52156972-52156994 GAGTGGAGAAAGAAGGATGGAGG + Intergenic
1008521691 6:52367729-52367751 TAGAGGAAAGATGAGGATGGAGG + Intronic
1008617093 6:53237141-53237163 GGGGGGAATGAGAAGGATGGAGG - Intergenic
1008863219 6:56176867-56176889 GGGAGGAAAGAGGAGGAAGGGGG + Intronic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1008966609 6:57319180-57319202 GGGTGGATGGAGAAGTATGGAGG + Intronic
1010348992 6:74849342-74849364 AAGTTTAAAGAGAAGGATGTAGG - Intergenic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1011841173 6:91501008-91501030 GGGAGGAAAGTGAAGGAGGGAGG - Intergenic
1011950443 6:92958319-92958341 GAAGGGAGAGAGAAGGAGGGAGG - Intergenic
1012019527 6:93900139-93900161 GAGTGGAAGGAGAAAGGAGGAGG + Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012533556 6:100268065-100268087 GAGAGGAAAAGGAAGGCTGGTGG - Intergenic
1012695332 6:102374679-102374701 GAGTAGAAGGAGAAAGATTGGGG - Intergenic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013345178 6:109253175-109253197 GAGTGCAAAGTGAGGGAAGGTGG - Intergenic
1013364713 6:109428022-109428044 GATAGGGAAGAGAAGGATGCTGG + Intronic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1015250621 6:131124002-131124024 GAGCGGAGTGAGCAGGATGGCGG - Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016816295 6:148306204-148306226 GAGTGGAAAGAGAAAGAAGTAGG - Intronic
1017297223 6:152812024-152812046 GGAAGGAAAGAGAAGGAAGGAGG - Intergenic
1017321931 6:153104703-153104725 GGTTGGAAGGAGGAGGATGGGGG + Intronic
1017445813 6:154506300-154506322 GAGAGGAAAGGGGAGGAAGGAGG + Intronic
1017728959 6:157297520-157297542 AAGTGGGAAGAGAAGAGTGGTGG - Intronic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1018885764 6:167935130-167935152 GAGAGGAGAGAGAAGAAAGGAGG - Intronic
1018925193 6:168201041-168201063 AAGTGGAAAGAGAAGGCAGTAGG + Intergenic
1019103388 6:169649991-169650013 GAGGGGGAATAGAGGGATGGAGG - Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019482888 7:1274536-1274558 GAGTGGACCCTGAAGGATGGGGG - Intergenic
1019805098 7:3117756-3117778 GAGAGGAGAGAGAAAGAGGGAGG + Intergenic
1020066485 7:5191675-5191697 GTGAGGAAAGAGAAGGAGTGGGG + Intronic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021165132 7:17329431-17329453 GAGAGGCAAGAGAAGGAAAGTGG + Intronic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1021536412 7:21709619-21709641 GAGAGGATAGAGAATGATGAAGG - Intronic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1022370865 7:29770114-29770136 GAGAGGGAAAAGAAGGAGGGAGG - Intergenic
1022469845 7:30675331-30675353 GAGTGCACAGGGAAGGATGCTGG + Intronic
1022485795 7:30776709-30776731 GAGAGGGAAGACAAGGATGAAGG - Intronic
1022715755 7:32896530-32896552 AAGAAGAAAGAGAAGGCTGGAGG + Intergenic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1023370185 7:39505496-39505518 GGGGGGAAAGAGAGGGAGGGAGG - Intergenic
1023380894 7:39607450-39607472 GATTTGAAAGTGAAGGAAGGAGG + Intronic
1023382771 7:39624213-39624235 GAGTGGAAAGAAAGGGAAGGAGG - Intronic
1023458805 7:40370604-40370626 GAGAGGAGAGAGAGAGATGGGGG + Intronic
1023635353 7:42204104-42204126 GAGTGGGAAGAGCAGAGTGGTGG - Intronic
1023910047 7:44547293-44547315 GAGGGGGAAGGGAAGGAGGGAGG + Intergenic
1024225790 7:47325872-47325894 AAGTGGAAACAGAAGGGTAGAGG + Intronic
1024518841 7:50285082-50285104 GAAAGGAAAGCGAAGGAAGGAGG + Intergenic
1024637418 7:51301837-51301859 GAGTGGAAGCCCAAGGATGGAGG - Intronic
1024741287 7:52357833-52357855 TTGTGGAAAGAAAATGATGGTGG - Intergenic
1024920069 7:54545975-54545997 GAGAGGAGAGAGAATGAGGGGGG + Intronic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1025710383 7:63902342-63902364 GAGTGGAATGAGAATATTGGGGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026497298 7:70914249-70914271 GAGGGGAAAGGGAAGGGAGGGGG - Intergenic
1026677207 7:72437899-72437921 GAGAGGGAAGGGAAGGAGGGAGG - Intronic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1027138826 7:75642598-75642620 GAGAGGATAGACAAGAATGGGGG - Intronic
1027765872 7:82340892-82340914 GAGTGGAATTAGAATGATGGTGG - Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028542985 7:91965191-91965213 GACTGGGAAGAGTAGGAAGGTGG - Intronic
1028752228 7:94394408-94394430 GAGGGGGCAGAGAAGGAGGGAGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029372055 7:100156554-100156576 GAGTGGTGAGAGAGGGATGCTGG + Intronic
1029409312 7:100398573-100398595 GAATGGATAGAGAAGGGTTGGGG - Intronic
1030127574 7:106169055-106169077 GACTTGAAAGAGAGGGATGGCGG + Intergenic
1030962420 7:115943229-115943251 GAGGGGAATGAGTGGGATGGTGG + Intronic
1031051507 7:116950348-116950370 GAGGGGGAAGGGAAGGAGGGAGG - Intergenic
1031216162 7:118895020-118895042 GGGTGGAAAGAAAAAGATTGAGG + Intergenic
1031264521 7:119566809-119566831 GAGGGGAGAGAGAGAGATGGAGG + Intergenic
1031326437 7:120404805-120404827 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1031654209 7:124332249-124332271 GAGAGGGAAGAGAAGGAGAGAGG + Intergenic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1032123856 7:129176562-129176584 GAGAGGATAGAGAGTGATGGAGG + Intergenic
1032342760 7:131091150-131091172 AAGTGGAAAGAGAAAGCAGGAGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1032502860 7:132413023-132413045 GGGTGGAGAGAGAAGGAAGGAGG + Intronic
1033062046 7:138118838-138118860 GAGGGGAAAGAAAAAGAAGGAGG + Intergenic
1033366911 7:140678790-140678812 TAATGGAAAGAGAGGGCTGGGGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033454390 7:141489559-141489581 GAGTGGGGAGAGAAGGAGGGAGG - Intergenic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033633832 7:143189483-143189505 AAGTGGATAGAGCAGGAAGGGGG + Intergenic
1034018741 7:147616660-147616682 AAGTGGAAGGAGAATGATTGAGG - Intronic
1034878907 7:154749015-154749037 GACAGGAGAGAGAGGGATGGAGG + Intronic
1034878918 7:154749067-154749089 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034878925 7:154749119-154749141 GACCGGAAAGAGAAGGATGGCGG + Intronic
1034878971 7:154749327-154749349 GATGGGAGAGAGAGGGATGGAGG + Intronic
1034878999 7:154749481-154749503 GACGGGAGAGAGAGGGATGGAGG + Intronic
1034879008 7:154749533-154749555 GACGGGAGAGAGAGGGATGGAGG + Intronic
1034879018 7:154749585-154749607 GACGGGAGAGAGAGGGATGGAGG + Intronic
1034879035 7:154749688-154749710 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879044 7:154749740-154749762 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879053 7:154749792-154749814 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879071 7:154749895-154749917 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879080 7:154749947-154749969 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879089 7:154749999-154750021 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034911309 7:155001327-155001349 GAGGGGGAAGAGAAAAATGGTGG + Intronic
1035876481 8:3195315-3195337 GGCAGGAAAGAGAAGGATGTGGG + Intronic
1036048065 8:5166113-5166135 GAGAGGAAAAAAAATGATGGAGG + Intergenic
1036188836 8:6650833-6650855 GAGGAGAGAGAGAAGGAAGGAGG - Intergenic
1036638164 8:10565431-10565453 GAGTGGGAAGAGTGGGGTGGGGG - Intergenic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1037718552 8:21421179-21421201 GACTGGAGAGAGAAGGAAGAAGG - Intergenic
1037734001 8:21552482-21552504 GGGTGGAGAGAGATGGAAGGAGG - Intergenic
1038046374 8:23768798-23768820 GAGAGGGAAGGGAAGGAGGGAGG - Intergenic
1038171225 8:25134658-25134680 GCGTGGAAAGAGAAGGGAAGAGG + Intergenic
1038234326 8:25737225-25737247 GAGTAGGAAGAGGAGGATGAAGG - Intergenic
1038356269 8:26832045-26832067 GAGGGGGAAGAGAAGGCTGGTGG - Intronic
1038390075 8:27189363-27189385 GAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038615936 8:29095055-29095077 GAGCAGAGAGAAAAGGATGGGGG + Intronic
1038670400 8:29578382-29578404 GTGTGGAAAGAAAAGAAAGGAGG - Intergenic
1038735691 8:30167025-30167047 GAGAGGAAAGGGAGGGAGGGAGG + Intronic
1038840612 8:31181207-31181229 GAGTAGAAAGAGCAGGGAGGAGG + Intergenic
1039338279 8:36619049-36619071 GAGGGGAAGGGGAAGGATGGGGG + Intergenic
1039407600 8:37326619-37326641 GAGAGGAAAGGGAAGGAGAGGGG - Intergenic
1039591374 8:38752693-38752715 GAATGAAAAGAGAGGGAAGGAGG - Intronic
1041059416 8:54021973-54021995 GAGGGGAGGGAGAAGGAGGGAGG + Intronic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1042628810 8:70792644-70792666 GAGTGGAAAGAGATGGGTGTGGG + Intergenic
1043657321 8:82685323-82685345 GAAGGGAAATAGAAGGATGAAGG + Intergenic
1044211762 8:89558969-89558991 GAGTGGATAGAGAAGGAAGTGGG - Intergenic
1044520064 8:93189057-93189079 GAATGGAGAGAGAGGGAGGGAGG + Intergenic
1044695531 8:94918776-94918798 GGTTGGAAAGAGAAGGATGTTGG - Intronic
1044802999 8:95976262-95976284 AAGGAGAGAGAGAAGGATGGAGG + Intergenic
1044816133 8:96115308-96115330 GAGTAGAGAGAGAAGGGAGGGGG - Intergenic
1044860189 8:96515453-96515475 TATGGGAAATAGAAGGATGGAGG + Intronic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044935567 8:97290446-97290468 GTGGGGAAAGACAGGGATGGGGG + Intergenic
1045458816 8:102409215-102409237 GGGTGGAAAGAAGAGGATGTTGG - Intronic
1045564576 8:103299689-103299711 GAATGGCAAGAGTAAGATGGAGG - Intronic
1045952103 8:107864172-107864194 GAGTGCAGAGTGAAGGTTGGGGG + Intergenic
1046478249 8:114778368-114778390 GAGGGGAGAAGGAAGGATGGGGG + Intergenic
1046561482 8:115843252-115843274 GAGAGGAGAGAGATGGATGTAGG - Intergenic
1046889371 8:119404436-119404458 GAATGGAAAGAGGAGGTAGGAGG - Intergenic
1046920480 8:119722884-119722906 GAGGAAAAAGAGAGGGATGGAGG + Intergenic
1047180844 8:122586319-122586341 GAGCAGATAGAGATGGATGGGGG - Intergenic
1047340040 8:123972213-123972235 GAGTGGAAAGAGAAATGAGGAGG + Intronic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047634914 8:126750949-126750971 GAGTGGAAATGGGAGGATGTTGG + Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1047785321 8:128148659-128148681 GGTGGGAAAGAGAAGGAGGGAGG + Intergenic
1047832024 8:128643906-128643928 GAAAGGAAAGAGAAGAAAGGAGG - Intergenic
1048313445 8:133344262-133344284 AAGGGGAGAGAGAAGGAAGGAGG - Intergenic
1048385467 8:133908717-133908739 GAGAGGAAAGAGCCAGATGGAGG - Intergenic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049067011 8:140324183-140324205 GACTGAAAATAAAAGGATGGGGG + Intronic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1050083328 9:1938528-1938550 GAGTGAAAAGAGAAGACAGGAGG + Intergenic
1050132467 9:2426991-2427013 GGGTGTAATGAGAAGGATGACGG + Intergenic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051840874 9:21396449-21396471 GAGTGAAATGTGAAGGATGGAGG - Intergenic
1052301640 9:26958837-26958859 GAGAGAAAAGAAAAAGATGGTGG + Intronic
1052364356 9:27595668-27595690 GAGTGAAGAGAGAAAGAGGGAGG + Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1052926961 9:34025274-34025296 GAGTGGAAAGTGATAGATGATGG - Intronic
1052998743 9:34565707-34565729 GACTGGAAATGGAAGGGTGGAGG + Intronic
1053004726 9:34596908-34596930 GTGTGGAAAGAGAAGCAGGTGGG + Intergenic
1053160244 9:35809126-35809148 GGGTGGAATGGGGAGGATGGTGG - Intronic
1053547628 9:39040551-39040573 GAGTGGCAATAGAAGGAGAGTGG - Intergenic
1053811731 9:41860206-41860228 GAGTGGCAATAGAAGGAGAGTGG - Intergenic
1053898943 9:42773651-42773673 CAGTGGAAAAAGAAAGTTGGAGG - Intergenic
1054618863 9:67327233-67327255 GAGTGGCAATAGAAGGAGAGTGG + Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055613190 9:78044091-78044113 AACTGTAAAGAGTAGGATGGAGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1055863906 9:80789157-80789179 GAGTGGAGAGAAAAGGATCTGGG + Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056381729 9:86062538-86062560 AAGAGGACAGAGTAGGATGGAGG + Intronic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057131534 9:92657584-92657606 AAGGGGACAGAGAAGGCTGGAGG + Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057676234 9:97138175-97138197 GGGTTGAAAGATAAGGATGGGGG - Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058555225 9:106159701-106159723 GATTAGGAAGAGAGGGATGGTGG + Intergenic
1058655481 9:107216830-107216852 GTGTGGAGAGTGAAGGATGCTGG + Intergenic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1059806191 9:117803070-117803092 GAGAGGATGGAGAAAGATGGAGG + Intergenic
1060026070 9:120172622-120172644 GAGGGGAAAGAGTGGGAAGGGGG + Intergenic
1060185294 9:121560425-121560447 GAGGGGAAAGAGATGGGAGGAGG + Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060674326 9:125498823-125498845 GAATGGAAAGGGAAGGAGAGTGG - Intronic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061339157 9:129965443-129965465 GAGTAGCCAGAGAAGGAGGGAGG - Intronic
1061844904 9:133382089-133382111 GCATGGAAAGGGAAGGGTGGTGG - Intronic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1062201308 9:135304279-135304301 GAGTGGATAGATGATGATGGAGG + Intergenic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1185603604 X:1354987-1355009 GAGGGGAGAGAGGAGGAGGGAGG + Intronic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185915177 X:4027058-4027080 GAGTGGGGAAAGAAGGAGGGGGG + Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186363836 X:8871194-8871216 GAGAGGATGGAGAAGGGTGGAGG + Intergenic
1186579569 X:10803024-10803046 TAGGGGAGAGAGAGGGATGGGGG + Intronic
1187090391 X:16089953-16089975 GGGTATAAAGAAAAGGATGGTGG - Intergenic
1187283719 X:17882997-17883019 GAGAAGGGAGAGAAGGATGGAGG + Intergenic
1187357568 X:18591495-18591517 AAGTGAAAAGAGAAAGATCGGGG - Intronic
1187552957 X:20324205-20324227 GAGAGAGAAGAGAAGGAGGGAGG - Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1187837012 X:23442219-23442241 GGGTGGAAAGGGTAGGAAGGCGG + Intergenic
1189185144 X:39048580-39048602 GAATGGGAAGAGAAGGAGAGTGG - Intergenic
1190066672 X:47246089-47246111 GAGGGGATGGAGAGGGATGGTGG - Intronic
1190259780 X:48790631-48790653 GAGTGGAAAGAGAAGGAAATGGG + Intronic
1190553606 X:51611573-51611595 GAGAGGAAAGAGAAAGAAGGAGG - Intergenic
1190972028 X:55358750-55358772 GACTCAAAAGAAAAGGATGGAGG + Intergenic
1191178772 X:57537122-57537144 GAATAGAGAGAGAGGGATGGTGG + Intergenic
1192007468 X:67232658-67232680 GAGGAGAAGGAGGAGGATGGAGG - Intergenic
1192313563 X:70035302-70035324 GAGAGGAAAGAGAGGGTGGGGGG - Intronic
1192339707 X:70253616-70253638 GAGTGGAATGTGAAAGATGCTGG + Intergenic
1192851881 X:74965498-74965520 GTGTAGAATGAGAAAGATGGAGG - Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193377643 X:80780715-80780737 GAGTACAAAGAGGAGGAAGGTGG + Intronic
1193568343 X:83108392-83108414 AAAGAGAAAGAGAAGGATGGTGG - Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1193972297 X:88069447-88069469 GAGGGGAAAGAAAAGCAAGGAGG + Intergenic
1194265198 X:91744453-91744475 GAGAAGACAGAGAAAGATGGTGG - Intergenic
1194275531 X:91876208-91876230 TCGGGGAAAGAGAAGGAAGGTGG + Intronic
1195082552 X:101385268-101385290 GAGTGGGAAGAGGAGGAGGTTGG + Intronic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195660274 X:107371172-107371194 GAGTGGGGAGGGAAGGGTGGTGG - Intergenic
1196197450 X:112851108-112851130 TAATGGAAAGATAAGGACGGTGG - Intergenic
1196834486 X:119801906-119801928 GGAGGGAAAGAGAAGGAGGGAGG - Intergenic
1197548560 X:127858933-127858955 GAGGGGGAAGGGAAGAATGGGGG + Intergenic
1197795905 X:130298639-130298661 AAATTGAAAGAGAAGGAGGGAGG + Intergenic
1198011743 X:132563645-132563667 GGGTGGACAAAGAAAGATGGAGG - Intergenic
1198264680 X:134998272-134998294 AACTAGAAAGAAAAGGATGGGGG + Intergenic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1198713836 X:139534944-139534966 GTCTGGGAAGAGAAGGATGAAGG + Intronic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1199467981 X:148161356-148161378 GGGTGGGAAGAGGAGGAGGGGGG - Intergenic
1199541850 X:148966445-148966467 GAGAGGAGAGAGGAGGAGGGAGG - Intronic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1199975141 X:152890347-152890369 GTTTGGAAGGTGAAGGATGGTGG + Intergenic
1200582350 Y:4964901-4964923 GAGAAGACAGAGAAAGATGGTGG - Intergenic
1200592778 Y:5097643-5097665 TTGGGGAAAGAGAAGGAAGGTGG + Intronic
1201253902 Y:12088419-12088441 AAGGGGAGAGAGAAGAATGGAGG - Intergenic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201760083 Y:17527427-17527449 GTGGGGGAAGAGAAGGATAGTGG - Intergenic
1201841471 Y:18378563-18378585 GTGGGGGAAGAGAAGGATAGTGG + Intergenic
1202163644 Y:21963249-21963271 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202227712 Y:22623116-22623138 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202315445 Y:23573062-23573084 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202555356 Y:26097535-26097557 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic