ID: 1139746422

View in Genome Browser
Species Human (GRCh38)
Location 16:69078251-69078273
Sequence CTACATAGAACAAGCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139746422_1139746431 28 Left 1139746422 16:69078251-69078273 CCTGGGGAGCTTGTTCTATGTAG 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1139746431 16:69078302-69078324 CCCCAGTGTCCATGCTGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139746422 Original CRISPR CTACATAGAACAAGCTCCCC AGG (reversed) Intronic
900484362 1:2914446-2914468 CTCCATGGAAGATGCTCCCCGGG - Intergenic
904551649 1:31324371-31324393 CTCCATAGAACATGCAGCCCTGG - Intronic
905619204 1:39427424-39427446 ATATATAGAACAAGCTGCTCAGG - Intronic
907326413 1:53641346-53641368 CAACAGACAGCAAGCTCCCCTGG + Intronic
907974164 1:59414724-59414746 CTCCACAAAACAATCTCCCCAGG - Intronic
908138879 1:61162232-61162254 CTGCATGTAACAAGCTTCCCAGG - Intronic
918296404 1:183161235-183161257 CTTCATAGAACTTTCTCCCCTGG - Intergenic
1067232251 10:44420048-44420070 CCACAGAGAACATGCTTCCCTGG - Intergenic
1068385508 10:56321764-56321786 CTACATAGAGGAAGATTCCCTGG - Intergenic
1069027395 10:63557553-63557575 CAACAAAGAAGAAGCTCTCCAGG + Intronic
1069124204 10:64608748-64608770 CCCCATAGAAAAAGATCCCCTGG + Intergenic
1070526222 10:77298226-77298248 ATAAATAAAATAAGCTCCCCAGG - Intronic
1071832008 10:89381246-89381268 CATCATAGCACAAGCTCCACGGG + Intronic
1072047344 10:91670207-91670229 CTGCATTTAACAAGATCCCCAGG - Intergenic
1074310933 10:112322827-112322849 CTACATATTACAATCACCCCGGG + Intergenic
1078665931 11:13325189-13325211 CTACAGAGAACATGCATCCCAGG - Intronic
1079351643 11:19696860-19696882 CTACTTATAAGAAGCTCCCTAGG - Intronic
1081757059 11:45552276-45552298 CTACATACAACAAGTGCCCCAGG + Intergenic
1083232833 11:61333782-61333804 CCACATCAAACAGGCTCCCCGGG + Intronic
1083276091 11:61597877-61597899 CTGCAGAGACCACGCTCCCCTGG + Intergenic
1085173740 11:74469035-74469057 CTTAGTAAAACAAGCTCCCCAGG - Intergenic
1085313614 11:75530488-75530510 CTACATCCAACCAGCTCTCCAGG - Intergenic
1085760073 11:79233981-79234003 CTACATTGAACAACCTCCGTTGG - Intronic
1088984936 11:114897361-114897383 CTGCATTTAACTAGCTCCCCAGG + Intergenic
1093783678 12:23167766-23167788 TAACATAGAACTGGCTCCCCAGG + Intergenic
1097285633 12:57875033-57875055 ATGCATTGAACAAGATCCCCAGG + Intergenic
1102399225 12:112614108-112614130 CTAGAAGGAACCAGCTCCCCTGG + Intronic
1117983796 14:61367674-61367696 CTACAATGAATATGCTCCCCAGG + Intronic
1120436034 14:84483820-84483842 TTATTTTGAACAAGCTCCCCAGG + Intergenic
1123110671 14:105865511-105865533 CTACAAAAACCATGCTCCCCCGG - Intergenic
1125421358 15:39507951-39507973 CTTCAAAGAAAAAGCTCTCCTGG + Intergenic
1127523120 15:59762807-59762829 CTGCATTTAACAAGATCCCCTGG + Intergenic
1130319422 15:82828339-82828361 GTACTTAGAAGAAGCTCTCCAGG - Intronic
1130646039 15:85728047-85728069 CCACAGAGGACAAGCTACCCAGG + Intronic
1133281450 16:4667750-4667772 CGAAATAGAACAAGCACACCCGG - Intronic
1133688096 16:8186246-8186268 TTACATAGAACTAGTTCCTCAGG + Intergenic
1134905787 16:17978453-17978475 CTTCTTAGAGCATGCTCCCCCGG + Intergenic
1135322739 16:21507892-21507914 CTGCACAGAACAAGGTCCCAGGG + Intergenic
1135780992 16:25300457-25300479 CTATTTTTAACAAGCTCCCCTGG + Intergenic
1136334223 16:29601055-29601077 CTGCACAGAACAAGGTCCCAGGG + Intergenic
1139746422 16:69078251-69078273 CTACATAGAACAAGCTCCCCAGG - Intronic
1142034937 16:87856913-87856935 CTGCACAGAACAAGGTCCCAGGG + Intronic
1143335064 17:6165923-6165945 CAGCATTGAACAAGGTCCCCAGG + Intergenic
1143946009 17:10592697-10592719 CTGCATTTAACAAGATCCCCAGG + Intergenic
1144049079 17:11482166-11482188 GTAGATAGAATAAGCTCCCCAGG + Intronic
1144078229 17:11737987-11738009 TTACTTAGAACAAGCTCAGCAGG + Intronic
1145871919 17:28281011-28281033 CTACATTTAACAAGCCCTCCAGG - Intergenic
1148349044 17:46926049-46926071 CTACATTTAACAAGCTCCCTAGG + Intronic
1149394845 17:56229979-56230001 CTACATTGAACCAGCCCCTCTGG + Intronic
1149544601 17:57494039-57494061 CTACATAGCAGAAGCTCCACTGG + Intronic
1149984776 17:61339121-61339143 CTCCACAGAACAACCTTCCCAGG - Intronic
1155346673 18:24864151-24864173 CTGCATTTAACAAGATCCCCAGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
926636808 2:15189038-15189060 CTGCTTTGAACAAGCACCCCAGG + Intronic
927744591 2:25605575-25605597 TTACATAGAGCCAGCTCACCTGG - Intronic
930020768 2:47000826-47000848 CTGCAAAGAACATGCTCCCTGGG - Intronic
930194613 2:48496761-48496783 CTAAATCCAACAAGCTCCACTGG - Intronic
931214426 2:60228002-60228024 CTACATATGTTAAGCTCCCCAGG - Intergenic
937090125 2:119200730-119200752 CTCTAGAGAACAAGCTGCCCTGG + Intergenic
937990865 2:127661591-127661613 CTACGTAGAACATACTGCCCAGG + Intronic
939541826 2:143503875-143503897 CTACACAAAGCAAGGTCCCCAGG + Intronic
940126787 2:150334904-150334926 GTGCATAGACCAAGCTCTCCGGG - Intergenic
942442714 2:176052714-176052736 CCACATAGAACAAGTTCAACAGG - Intergenic
1169811848 20:9616593-9616615 CCACATCTAACAAGCTCCCAGGG + Intronic
1171572040 20:26261753-26261775 CTACAAAGAATAAGCTACCAAGG - Intergenic
1173925320 20:46776937-46776959 GTACAGAGAAGAGGCTCCCCAGG + Intergenic
1174144480 20:48441763-48441785 CTACAGAGAACAGGCTCCTTGGG + Intergenic
1174649729 20:52114456-52114478 CTGCATTTAACAAGGTCCCCGGG - Intronic
1174839063 20:53884631-53884653 CAACCTAGAACAAGCCCACCTGG - Intergenic
1174850381 20:53988235-53988257 TTACAAAAAACAAGGTCCCCAGG + Intronic
1183527928 22:38335039-38335061 GTACATAGAGCTACCTCCCCAGG - Intronic
950606573 3:14086711-14086733 CTACACATAACAAGCTGTCCAGG + Intergenic
955708578 3:61754708-61754730 CTTTAAATAACAAGCTCCCCTGG + Intronic
959866433 3:111275863-111275885 CCACATAGAACAACCTCTCCTGG - Intergenic
963219949 3:142798071-142798093 CTAGGTTGAACATGCTCCCCAGG - Intronic
965531848 3:169778268-169778290 CTACATTTAACAAGATTCCCGGG + Intronic
967019706 3:185512094-185512116 TTACAGAGATCAAGCTCCCCAGG + Intronic
967722093 3:192826739-192826761 CTAAATAGCACAAGGTCTCCGGG + Intronic
980422467 4:132581484-132581506 CCACATAGAATATGCTCCCATGG + Intergenic
980758749 4:137200348-137200370 CTGCATTTAACAAGATCCCCAGG + Intergenic
980903396 4:138926346-138926368 CTCCACAGAACCAGCTTCCCGGG + Intergenic
986572072 5:9175968-9175990 CTACATAGAACATGAACACCAGG - Intronic
994564504 5:101424772-101424794 CTGCATAGAACAATTTCTCCTGG + Intergenic
994732009 5:103503168-103503190 CAACATAGAAAATGCTGCCCTGG - Intergenic
997524609 5:134544291-134544313 TGACAAAGGACAAGCTCCCCAGG - Intronic
998643691 5:144039827-144039849 CTAGAGAGAACCAGCTCCCGTGG + Intergenic
1003947017 6:11085191-11085213 CTACATAGAAAGAGCTTACCTGG - Intergenic
1004140365 6:13012597-13012619 GTACCTTTAACAAGCTCCCCAGG - Intronic
1004290942 6:14366616-14366638 CTGCATTGTACAAGATCCCCAGG + Intergenic
1006279292 6:33035744-33035766 AAACAAAGAAAAAGCTCCCCAGG - Intergenic
1006541794 6:34746036-34746058 CAACAAAGAACATGTTCCCCAGG + Intergenic
1009790461 6:68394930-68394952 CTGCATTGAACAAGATCCTCAGG - Intergenic
1011650266 6:89499714-89499736 CTACACAGAGCAAGCCACCCAGG + Intronic
1015307258 6:131723505-131723527 CCAGATAGAACAAGCTTCTCTGG - Intronic
1019514467 7:1433675-1433697 CTGCCCAGCACAAGCTCCCCAGG + Intronic
1024305709 7:47928000-47928022 CTACACAGAAAGAGCTTCCCTGG - Intronic
1030139229 7:106287725-106287747 CTACATGCTACAACCTCCCCGGG - Intergenic
1032735543 7:134689506-134689528 CTACAATGAATAAGCTCCCCTGG + Intergenic
1033108216 7:138550234-138550256 CTAGATAAAACAACCTACCCTGG - Intronic
1034202818 7:149293189-149293211 ATTCACAGACCAAGCTCCCCTGG + Intronic
1034300171 7:150008638-150008660 CTCCATAGCACTAGCTGCCCAGG + Intergenic
1034805879 7:154088670-154088692 CTCCATAGCACTAGCTGCCCAGG - Intronic
1036631996 8:10522469-10522491 CTGCACTGAACAAGCTCCCTAGG + Intergenic
1044501343 8:92962378-92962400 CTACATAGAAGAATGTCCACTGG + Intronic
1045473894 8:102537226-102537248 CTGCGTTTAACAAGCTCCCCAGG - Intronic
1046005882 8:108482988-108483010 CTACATTGAACTAGCTTCCATGG - Intronic
1047507270 8:125489672-125489694 CTAGTTTGAAAAAGCTCCCCAGG + Intergenic
1056186219 9:84137646-84137668 TTACATTTAATAAGCTCCCCAGG + Intergenic
1060902768 9:127275406-127275428 CAACTTAGAACAAGTTTCCCTGG + Intronic
1186847375 X:13544113-13544135 CTCCAGAGAACAAGCTGGCCTGG - Intergenic
1187154526 X:16711512-16711534 CTTCATAGAACAAGATCATCAGG - Exonic
1188059408 X:25582487-25582509 CCACATATTACAAGGTCCCCTGG + Intergenic
1188580744 X:31710027-31710049 GTATTTATAACAAGCTCCCCAGG - Intronic
1189752524 X:44237126-44237148 ATATATTTAACAAGCTCCCCAGG - Intronic
1198196462 X:134367769-134367791 ATATTTAAAACAAGCTCCCCAGG - Intergenic
1199066817 X:143429113-143429135 GTACATTGAACAAACTCCCACGG + Intergenic
1199870574 X:151894662-151894684 CTGCATTGAATAAGATCCCCAGG + Intergenic
1200744542 Y:6892346-6892368 CTTCATACCACAAGCTCGCCGGG + Intergenic