ID: 1139747638

View in Genome Browser
Species Human (GRCh38)
Location 16:69087331-69087353
Sequence CTGAAAAAGCAGTTGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139747638_1139747640 0 Left 1139747638 16:69087331-69087353 CCAAGCTTCAACTGCTTTTTCAG No data
Right 1139747640 16:69087354-69087376 GTTAGACTTCCTGAACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139747638 Original CRISPR CTGAAAAAGCAGTTGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr