ID: 1139751920

View in Genome Browser
Species Human (GRCh38)
Location 16:69114140-69114162
Sequence TAGGGAGGTAGAGCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139751915_1139751920 17 Left 1139751915 16:69114100-69114122 CCACTTAGTGGGGAAAATCTCTG 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1139751920 16:69114140-69114162 TAGGGAGGTAGAGCTGGTGCTGG 0: 1
1: 1
2: 0
3: 23
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139751920 Original CRISPR TAGGGAGGTAGAGCTGGTGC TGG Intronic
900725225 1:4212079-4212101 TCTGGAAGTAGAGCTGCTGCAGG + Intergenic
900998664 1:6136474-6136496 TAGGGAGGTGGTGGTGGGGCTGG - Intronic
901510686 1:9716800-9716822 TTGGGAGGTGGAGGTGGGGCAGG + Intronic
901773342 1:11542483-11542505 TATGGAGGTGTAGCAGGTGCAGG - Intergenic
902206720 1:14873718-14873740 TAGGGAGGAAAGGCAGGTGCCGG + Intronic
902238058 1:15070372-15070394 GAGGAAGGGAGAGCTGGTGCTGG - Intronic
902692431 1:18118256-18118278 AAAGGAGGAAGAGATGGTGCTGG - Intronic
905244898 1:36605937-36605959 GAGGGAGGCAGAGATGGGGCAGG + Intergenic
905461714 1:38126576-38126598 CAGGGAAGTAGAGCTGGGGCTGG + Intergenic
907290069 1:53407974-53407996 GAGGGAGATAGAGATGGTGTAGG + Intergenic
907474788 1:54698504-54698526 TGGGGAGGCAGAGCTGGAGGAGG - Intronic
910857354 1:91708832-91708854 TGTGCAGGTAGAGCTGGTGAAGG - Intronic
911047416 1:93639802-93639824 GAGGGAGGGAGACCTGGGGCTGG + Intronic
911271585 1:95808168-95808190 TAGGGAGGCAGTGCGGGTTCTGG - Intergenic
912801544 1:112722743-112722765 TGGGGAGGCGGGGCTGGTGCGGG + Intronic
912968914 1:114261988-114262010 TAGGTAGGTAGAGTGGGTGAGGG - Intergenic
914704043 1:150157116-150157138 TAAAGAAGTAGAGCTGGTGGAGG - Intronic
915079021 1:153338582-153338604 GAGTGTGGTAGAGCTGATGCTGG - Intronic
915226604 1:154416535-154416557 GAGGGAGGAGGAGCTGGGGCAGG + Intronic
917169186 1:172150823-172150845 TATGCAGGTAGGGCTGCTGCGGG + Intronic
917824012 1:178797348-178797370 TTGAGAGGTAGAGGTGGGGCAGG + Intronic
919850006 1:201666210-201666232 GAGGGAGGTAGAGATGGAGAAGG - Intronic
920002466 1:202809059-202809081 TTGGGAGGTGGAGATGTTGCAGG + Exonic
920412563 1:205773981-205774003 TAGCTAGGAAGAGCTGGTGATGG - Intronic
920443650 1:205999187-205999209 TAGGAAGGGAAAGCTGGGGCAGG + Intronic
922617282 1:226968665-226968687 CAGGGAGGTAGGGCTGCTGCAGG + Intronic
923040684 1:230318000-230318022 TAGGGCGGTGGTGCTGGCGCTGG - Intergenic
923143997 1:231185263-231185285 GTGGGAGGGAGAGCTGGTCCAGG - Intronic
1062891745 10:1066882-1066904 CAGAGAGGGAGAGCTTGTGCAGG + Intronic
1063008700 10:2000703-2000725 TAGCAAGGTACAGGTGGTGCTGG + Intergenic
1063811449 10:9713479-9713501 TAGGGAGATAGGGCTGTTTCTGG + Intergenic
1064229463 10:13517311-13517333 TAAGGAAGGAGAGCTGCTGCAGG + Intronic
1065853878 10:29814183-29814205 CTGGGAGGCAGAGATGGTGCCGG - Intergenic
1067552902 10:47247649-47247671 TATGGAGGCAGAGATGGTGACGG + Intergenic
1068029455 10:51689019-51689041 TAGGCAGAGAGAGCTTGTGCAGG - Intronic
1068220860 10:54043751-54043773 TAGGGAAGGAGAGCTGGTCTGGG + Intronic
1068567501 10:58592295-58592317 TAGGGAGGCAGAGGTGGTGGTGG + Intronic
1069374572 10:67781046-67781068 TAGGGTGGAAGCCCTGGTGCTGG + Intergenic
1070563400 10:77584886-77584908 TAGGGAGCTGGAGGTGATGCTGG - Intronic
1070607425 10:77908622-77908644 GAGGGAGGTAGACCTGGCGAGGG - Intronic
1071597780 10:86940680-86940702 TAGGGAGGGTCAGCTGGGGCAGG + Intronic
1071917046 10:90305130-90305152 TGGAGAGGTAGAGCTGGAGAAGG - Intergenic
1072924699 10:99606759-99606781 TAGGGTGGCAGAGGTGGTGGTGG + Intergenic
1073199524 10:101723842-101723864 TAGTGAGGGAAAGCTGGGGCAGG - Intergenic
1073459462 10:103658307-103658329 CAGGGAGGTGGGGATGGTGCTGG + Intronic
1073675227 10:105639053-105639075 GAGGGAGCTGGAGCTTGTGCAGG - Intergenic
1073985576 10:109204510-109204532 TAGACAGGTAGAGCAGGTCCTGG - Intergenic
1074274668 10:111989895-111989917 TAGGGAGAGAGAGCTTCTGCTGG - Intergenic
1076414430 10:130275426-130275448 CAGGGAGGTAGAGCTGGCAGTGG - Intergenic
1077257976 11:1597599-1597621 TGGTGAGCTAGAGCAGGTGCAGG + Exonic
1077985608 11:7348239-7348261 GAGGGGGGTAGAGTTGGTACAGG - Intronic
1078171671 11:8933080-8933102 TTGGGAGGTAGGGGTGGGGCAGG + Intergenic
1079495843 11:21043140-21043162 TGGGGAGAAAGAGCTGGTGTGGG + Intronic
1080640228 11:34154383-34154405 TAGGGAGGCAGAGCAGGTCTTGG + Intronic
1083729729 11:64646257-64646279 GAGGGAGGGAGAGTTGGGGCTGG - Intronic
1083777563 11:64901772-64901794 TAGGGAGGCAGCCCTGATGCTGG - Intronic
1084153789 11:67303188-67303210 TAGGGAGGCAGAGCTGAGGTGGG - Intergenic
1084707198 11:70822431-70822453 AAGGGGGATAGAGGTGGTGCTGG + Intronic
1084770450 11:71339690-71339712 TTTGGAGGTAGAGCCTGTGCTGG - Intergenic
1085849170 11:80099686-80099708 AGGGGAGGAAGAGCTGGTGTGGG + Intergenic
1087242228 11:95791869-95791891 TACGGAGGTAGAGCTGGATGAGG + Intronic
1088931100 11:114351525-114351547 TAAGGTGATGGAGCTGGTGCAGG - Intergenic
1089003466 11:115071038-115071060 TGAGGAGGAAGAGCTGATGCGGG + Intergenic
1090967490 11:131611693-131611715 TAGGAAGGAAGACCTCGTGCTGG + Intronic
1091232612 11:133998456-133998478 GAGGGAGGTAGAGCTGCCCCTGG + Intergenic
1091292069 11:134446363-134446385 TAGTGAGGAAGAACTGGAGCTGG + Intergenic
1091753514 12:3037300-3037322 AAGGGAGGGACAGCTGGTGCTGG + Intronic
1092056702 12:5513557-5513579 AAGGGAGGAGGAGATGGTGCTGG + Intronic
1092153184 12:6265229-6265251 CAGGCAGGCAGTGCTGGTGCTGG - Intergenic
1094414308 12:30201464-30201486 TGGGGAGGAAGAGGTGCTGCTGG + Intergenic
1096559278 12:52424216-52424238 GAGGGAGGTGGAGCTGGAGGAGG + Exonic
1096570471 12:52520192-52520214 CACGGAGGTGAAGCTGGTGCGGG + Exonic
1096572257 12:52530355-52530377 AGGGGAGGAAGAACTGGTGCTGG + Intergenic
1096665378 12:53160723-53160745 GAGAGAGGTGGGGCTGGTGCAGG + Intronic
1096716770 12:53496070-53496092 TAGGGTGATAGAGGGGGTGCAGG + Intronic
1096935305 12:55267864-55267886 GAGAGAGGGAGAGCTTGTGCAGG - Intergenic
1099071879 12:78054869-78054891 TAGAGATGTAGAGCTGGAGACGG + Intronic
1100291247 12:93216774-93216796 AAGAGAGATAGAGCTTGTGCAGG - Intergenic
1100351567 12:93788726-93788748 AAGAGAGGCAGAGCTGGGGCTGG - Intronic
1100661805 12:96707733-96707755 AAGGAAGGTAGAGCTGTTGGGGG + Intronic
1101838519 12:108311677-108311699 TAGAGGGGGAGAGCTGGTGGAGG + Intronic
1102775607 12:115516029-115516051 CAGGCAAGGAGAGCTGGTGCAGG + Intergenic
1102851164 12:116246734-116246756 TAAGGAGTTAGAGGTGGTGGCGG + Intronic
1103209273 12:119154670-119154692 CGGGGAGGTGGAGCTGGGGCCGG + Intronic
1103786661 12:123437668-123437690 TAGGGAGGAATTGCTGGTGTTGG + Intergenic
1103900335 12:124300536-124300558 TAGGGAGGTAGTGCTGGGGTTGG + Intronic
1104857992 12:131910763-131910785 GTGGGAGGTGGAGCTGCTGCTGG - Exonic
1105896140 13:24718643-24718665 TGGGAAGGCAGGGCTGGTGCGGG + Intergenic
1106078377 13:26480297-26480319 AAAGGAGGCAGAGCTGCTGCAGG - Intergenic
1106480706 13:30135146-30135168 TGGGGAGGCAGCGCTGGTGTGGG + Intergenic
1107864092 13:44686701-44686723 TAGGGTGGTAGAGGTGGAGGCGG - Intergenic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1112470744 13:99686341-99686363 AGGGGAGGTGGTGCTGGTGCTGG - Intronic
1113634557 13:111910600-111910622 CAGGGAGGGAGAGCTGGTGGGGG + Intergenic
1113892447 13:113743525-113743547 GAGGGTGGCAGAGCTGGAGCAGG + Intergenic
1114515151 14:23294536-23294558 CAGGGAGCTAGAGATGGTCCTGG - Intronic
1117285614 14:54283116-54283138 TGGGGAGGCACAGCTGGGGCTGG - Intergenic
1118732456 14:68677942-68677964 TATGGAGGTGGAGGTGGAGCTGG - Intronic
1120626374 14:86831789-86831811 TGGGGAGGTAGAGCTGGGCTGGG - Intergenic
1120977797 14:90264859-90264881 TAGGGAGATGGAACGGGTGCGGG + Intronic
1121814718 14:96920454-96920476 TAGGAAGGTGGAGCTGGGGCTGG + Intronic
1122048922 14:99042121-99042143 GTGGGAGGTGGAGCAGGTGCAGG - Intergenic
1122091192 14:99341751-99341773 AAGGCTGGTAGGGCTGGTGCTGG + Intergenic
1122172163 14:99885875-99885897 TAAGGAGGTTAAGCTGGTGGAGG + Intronic
1122305301 14:100762190-100762212 AAGGGAGGAAGTGCTGATGCAGG + Intergenic
1123433402 15:20237302-20237324 TTTGGAGGTAGAGCTGATGGGGG - Intergenic
1123627622 15:22238628-22238650 GAGGGAGGGAGAGCTTGGGCAGG - Intergenic
1124100759 15:26690574-26690596 TGGGGACATAGAGCTGGTGATGG + Intronic
1124460917 15:29890977-29890999 CAGGGAGGTAGAGCTTGGCCTGG - Intronic
1128010991 15:64296005-64296027 TAAGGAAGAAGAGCTTGTGCAGG - Intronic
1129186496 15:73910530-73910552 TAGGGAGGCGGATCTGGAGCTGG - Intergenic
1129346275 15:74921860-74921882 CAGGGAGGTTGTGCTGGTGAGGG + Intronic
1130878882 15:88037992-88038014 CAGGGAGGCAGTGCTGGTGGAGG - Intronic
1131650127 15:94389148-94389170 TAGGGAGTTTGAGCTGGGTCAGG + Intronic
1132236883 15:100228823-100228845 TAGGCAGGGAGAGCTGGGGTTGG - Intronic
1132659879 16:1056627-1056649 GAGGGAGGGAGAGCTGGAGAGGG + Intergenic
1132763602 16:1523529-1523551 GAGGGCGGTAGAGCTGCTGCTGG - Exonic
1133634698 16:7653978-7654000 TGGGGAGGGAGGGCTGGTGCAGG - Intronic
1136851223 16:33613826-33613848 TTTGGAGGTAGAGCTGATGGGGG + Intergenic
1139387089 16:66579644-66579666 GGTGGAGGTGGAGCTGGTGCTGG - Exonic
1139391264 16:66607252-66607274 TAGGTGGGAAGAGCTGATGCAGG - Intronic
1139545155 16:67646551-67646573 TGGGGAGGCAGAGGTGGGGCAGG - Intronic
1139751920 16:69114140-69114162 TAGGGAGGTAGAGCTGGTGCTGG + Intronic
1203112827 16_KI270728v1_random:1462287-1462309 TTTGGAGGTAGAGCTGATGGGGG + Intergenic
1142592392 17:1012086-1012108 TTGGGATGGAGAGCTGGGGCGGG + Intronic
1143665844 17:8359593-8359615 TAGGTAAGGAGAGCTGGTCCAGG + Intergenic
1145354303 17:22125100-22125122 TAGGGAAGTAGAGTTGGGACAGG + Intergenic
1145797723 17:27665660-27665682 CAGGGAGGCACAGCTGTTGCTGG - Intergenic
1145813788 17:27781235-27781257 GAGGGAGGTAGGGCCAGTGCAGG - Intronic
1146619981 17:34389617-34389639 TGGGGAGGCAGAGCTGCTGTAGG + Intergenic
1146744457 17:35314981-35315003 GAGAGAGGCAGAGCTGGAGCAGG - Intergenic
1146787306 17:35731664-35731686 TCCGGAGGGAGAGCTGGGGCTGG + Exonic
1148080289 17:44964184-44964206 TAGGGAGGCAGAGCTGAATCTGG - Intronic
1148215212 17:45830406-45830428 TGGGGTGGCAGGGCTGGTGCAGG + Exonic
1148228066 17:45913242-45913264 CAGGGAGAGAGAGCTTGTGCAGG + Intronic
1149626302 17:58083212-58083234 TGGGGAGGAGGAGCTGGAGCGGG - Intergenic
1150227486 17:63531817-63531839 TAGGCAGGTTGGGCAGGTGCCGG - Intronic
1150431263 17:65119341-65119363 TAGCTAGGTAGTGCTGGCGCAGG - Intergenic
1151145488 17:72036593-72036615 TAAAGAGGGAGAGCTTGTGCAGG + Intergenic
1151337608 17:73449205-73449227 GAGGGAGGAAGAGCCGGTGTGGG - Intronic
1151577250 17:74958982-74959004 TAGGCAGGTAGGTCTGGAGCAGG + Exonic
1151681980 17:75627133-75627155 GAGGGTGGTGGAGCTGCTGCTGG - Exonic
1152045233 17:77930812-77930834 CAGGGAGGTAGGGCTGGGGTGGG - Intergenic
1152217972 17:79045450-79045472 CAGAGAGGATGAGCTGGTGCGGG + Intronic
1152586681 17:81192463-81192485 TCCGGTGGTAGACCTGGTGCCGG + Exonic
1152755311 17:82084726-82084748 CAGGGAGGTGGGGCTGCTGCGGG + Intronic
1159044536 18:63356597-63356619 AAGGGAGATAGGGCTGGGGCAGG - Intronic
1161001218 19:1912206-1912228 AGGGGACGTGGAGCTGGTGCTGG + Exonic
1161279056 19:3435201-3435223 GAAGGAGGTAGGGCTGGTGGCGG + Exonic
1163578403 19:18123804-18123826 TCGGGTGGGAGGGCTGGTGCAGG - Intronic
1164477393 19:28586013-28586035 TAGGGAGGGAGAAGTGGTGTAGG - Intergenic
1165029605 19:32988362-32988384 TTTGGAGGTAGAGCTGATGGGGG - Intronic
1165305121 19:34999000-34999022 GAGTGAGGTACAGCTGGGGCAGG + Intronic
1166531485 19:43546036-43546058 TGAGGAGGTAGGGCTGGGGCTGG - Exonic
1166685426 19:44793599-44793621 CAGGGAGTTGGAGCTGGGGCAGG + Exonic
1166956848 19:46470636-46470658 TGGGGTGGTTGAGCTGGAGCAGG + Exonic
1166994461 19:46713710-46713732 TTGGGAGGCTGAGCTGGAGCTGG - Intronic
1167222872 19:48214486-48214508 TACGGAGGTTGAGCTGGTAAGGG + Intronic
1167272118 19:48511591-48511613 CAGGGAGGTGGAGGTGGTGGCGG + Exonic
924963610 2:56898-56920 TGGGGAGGTGGAGCTGGGGCTGG + Intergenic
927358029 2:22196412-22196434 TAGGGCAGGGGAGCTGGTGCAGG + Intergenic
927572042 2:24168315-24168337 CAAGGAGGCAGAGCTGGTGAAGG + Intronic
928198087 2:29229163-29229185 CCGGGAGCTGGAGCTGGTGCGGG - Intronic
928925947 2:36579590-36579612 GTGGGAGGCAGAGCTGGAGCAGG - Intronic
930087301 2:47506843-47506865 GAGAGAGGTAGGGGTGGTGCAGG + Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933405530 2:81853283-81853305 AAGGGAGATAGAGATGGTACAGG - Intergenic
933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG + Intronic
936045782 2:109186814-109186836 TGGGGAGGTGAGGCTGGTGCTGG - Intronic
936267314 2:111020398-111020420 TGGGGATGGAGAGCTGGTGGGGG + Intronic
936288337 2:111198952-111198974 GAGGGAAGTGGAGATGGTGCTGG - Intergenic
936855825 2:116956250-116956272 TAAGGAAGAAGAGTTGGTGCAGG - Intergenic
937017152 2:118616651-118616673 TGGGGGTGTAGAGCTGGAGCAGG + Intergenic
937768968 2:125696424-125696446 TAAAGACGTAGATCTGGTGCTGG - Intergenic
938381199 2:130837398-130837420 TTGGGAAGGAGGGCTGGTGCCGG + Intronic
940000392 2:148961581-148961603 TAGGCAGGTAAATCTGGTGATGG + Intronic
942122480 2:172792136-172792158 CCGGGAGGCAGAGCTGGTGCTGG - Intronic
942717205 2:178906795-178906817 GAGCAAGGTTGAGCTGGTGCTGG + Intronic
942911529 2:181250452-181250474 TTGGGGGGCAGAGCTGGAGCTGG - Intergenic
945114085 2:206393826-206393848 AAGGGAGAGAGAGCTTGTGCAGG - Intergenic
946308226 2:218868212-218868234 TCAGGAGGTAGGGCTGGGGCTGG - Intronic
947745319 2:232504166-232504188 TGGGGAGGCAGAGCTGCCGCGGG + Intergenic
948771149 2:240251827-240251849 GAGGGAGGGAGAGCTGGGGCGGG - Intergenic
949011129 2:241679182-241679204 AAGGGAGGGAGAGAGGGTGCTGG - Intronic
1168895360 20:1320102-1320124 GAGGGAGGGAGAGCTGGGCCTGG + Intronic
1170387105 20:15831519-15831541 GGTGGAGGAAGAGCTGGTGCAGG - Intronic
1172331207 20:34077230-34077252 CAGCGAGGAAGAGCTGGTGAGGG + Exonic
1173851772 20:46222967-46222989 TGGGGAACTAGAGCTGGGGCTGG + Intronic
1175124668 20:56742386-56742408 TTGAGAGGGAGAGCTGGGGCTGG + Intergenic
1177893749 21:26837521-26837543 AAGTGAGGAAGGGCTGGTGCAGG - Exonic
1179589294 21:42395450-42395472 TAAGGAGGTAGAGGTGGAGGCGG - Exonic
1179876695 21:44272402-44272424 TCTGGAGGAAGAGCAGGTGCTGG + Intergenic
1180156868 21:45982197-45982219 TGGCGAGGGGGAGCTGGTGCGGG + Intronic
1180615404 22:17122758-17122780 GGGGGAGGTGGAGATGGTGCAGG - Intronic
1180908490 22:19431957-19431979 TGGCGAGGCAGAGCTGGTGACGG - Exonic
1181676392 22:24456427-24456449 GAGGGAGGTGGAGCTGGTGAAGG + Intergenic
1182431640 22:30302363-30302385 CAGGGAGGCAGGGCTGGGGCTGG - Intronic
1183090345 22:35518170-35518192 AAGGGAGGGAGAGCTTGGGCTGG + Intergenic
1183355280 22:37355475-37355497 TGGCGAGGTGGAGGTGGTGCTGG + Intergenic
1183476720 22:38039642-38039664 TGTGGAGGCAGGGCTGGTGCAGG - Intronic
1183489703 22:38109800-38109822 GAGGGAGGAAGAGGTGCTGCTGG - Intronic
1184078594 22:42201135-42201157 GAGGGAGGTAGAGGGGGAGCAGG - Intronic
1184654520 22:45934405-45934427 TAGGGAGGCTGAGCTGGCTCTGG + Intronic
952216102 3:31279248-31279270 TAGGGAGTTAGAGGGGTTGCGGG - Intergenic
953125542 3:40088611-40088633 TACAGAGCTAGTGCTGGTGCTGG + Intronic
953464468 3:43106618-43106640 TATGGAGGTGGAGTTGGTGGTGG - Intergenic
953718309 3:45334421-45334443 TGAGGAGGTAGAACTGGAGCGGG - Intergenic
954264006 3:49459539-49459561 TGGGAAAGGAGAGCTGGTGCGGG + Intergenic
954286352 3:49622143-49622165 TAGGGAGGCTGAGGTTGTGCAGG + Intronic
954933690 3:54307183-54307205 TTGGGAGAAAGTGCTGGTGCTGG + Intronic
957595903 3:82265424-82265446 TACTGAAGCAGAGCTGGTGCTGG + Intergenic
957927413 3:86832584-86832606 TGGGGAGCTAGGGCTGCTGCTGG - Intergenic
960047274 3:113210904-113210926 TGGGGAGGGAGAGCTGGGGCTGG - Intergenic
961451076 3:127002542-127002564 TGGAGAGGTAGAGCGGGAGCAGG + Intronic
961831556 3:129625572-129625594 TCGTGGGGTAGAGCTGGGGCTGG + Intergenic
962628141 3:137248167-137248189 CAGGGAGGTGGGGCTGCTGCTGG + Intergenic
963704690 3:148671135-148671157 TAGGAAGGTAGAGAAGCTGCTGG + Intergenic
964514513 3:157493353-157493375 TAGAGAGGAATAGCTGGGGCTGG + Intronic
965946665 3:174250661-174250683 TAGTGAAGCAGAGTTGGTGCTGG + Intronic
966890079 3:184400874-184400896 CAGGGAGCTGGAGCTGGAGCTGG - Intronic
967608091 3:191471959-191471981 TAGGGAAGAAGAGTTGGTGGTGG + Intergenic
968381822 4:103043-103065 AAGGGAGGTTGTGCTGGGGCTGG - Intergenic
968416814 4:444700-444722 TGGGGAGGAAGAGCTGTTGGTGG - Intronic
968977922 4:3831408-3831430 CAGGGAGGCAGGGGTGGTGCTGG - Intergenic
969355084 4:6620499-6620521 TGGGGAGCTTGAGCAGGTGCTGG - Intronic
969491775 4:7503523-7503545 GACAGAGGTAGAGATGGTGCAGG + Intronic
973104822 4:46322391-46322413 TAGAGAGGAAGAGATCGTGCAGG - Intronic
975102854 4:70534351-70534373 TAGGGAGGAAGATATGGTGCTGG - Intergenic
979629012 4:122879749-122879771 TAGGCAGAGAGAGCTTGTGCAGG + Intronic
980119107 4:128709423-128709445 CAGGGAGGAAGAGGTGTTGCTGG + Intergenic
981178251 4:141707972-141707994 TGGAGAGGCAGAGCTGCTGCAGG + Intronic
983115361 4:163808984-163809006 TGAGGTGGTAGAGGTGGTGCTGG - Intronic
984916864 4:184733256-184733278 TAGGGTGGAAAAGCTGGAGCAGG - Intronic
986141572 5:5035683-5035705 TGTGGAGGTTGGGCTGGTGCTGG + Intergenic
987126029 5:14813711-14813733 CTGAGAGGTAGAGCTGGAGCTGG - Intronic
987190966 5:15478008-15478030 AAGGGAGAGAGAGCTTGTGCAGG - Intergenic
987380343 5:17279183-17279205 TATGGAGGCAGAGGTGGTACTGG + Intergenic
988898794 5:35708671-35708693 GATGGAGGTAGAGGTGGTGATGG - Intronic
993687689 5:90960177-90960199 TAGGGTGGTAGGGGTGGTGGTGG + Intronic
995437633 5:112155586-112155608 TAGGGAGGAAGATGTGGTGGTGG - Intronic
998514423 5:142739843-142739865 TAGGGAGGTGTAGGTGCTGCTGG - Intergenic
998813810 5:145992640-145992662 CAGGGAGAGAGAGCTTGTGCAGG + Intronic
999199859 5:149808263-149808285 TTGGGAGGTGGAGCTGGGGCTGG - Intronic
1000035428 5:157444087-157444109 TATGGAGGTAGGGCTGAGGCAGG + Intronic
1000520378 5:162287666-162287688 TAGGAAGGAAGTGCTGGCGCTGG - Intergenic
1000978297 5:167788979-167789001 TAGTGGGGTAGAGCTGCAGCAGG - Intronic
1002465315 5:179405463-179405485 TAGGGAGGCCGAGCTGGTCCTGG - Intergenic
1002618961 5:180473149-180473171 AAGGGAGGTAGGGGTGGAGCAGG - Intergenic
1005994432 6:30922794-30922816 TGGTGAGCTAGAGCTGGTGGGGG - Intronic
1006597130 6:35201698-35201720 TGGGGAGGGAGTGCTGCTGCTGG + Intergenic
1006788609 6:36684317-36684339 TGGGAAGGTAGAGCTTGGGCAGG - Exonic
1007472771 6:42101716-42101738 TAGAGAGCTAGTGCTGGGGCTGG + Exonic
1007757724 6:44111261-44111283 TAGGGAGGAAGAGCAGTTGTGGG - Intergenic
1008428259 6:51384246-51384268 GTGGGAGGTAGAGTTGTTGCTGG - Intergenic
1009833972 6:68973227-68973249 TAAGGAGACAGAGCTGGTGGAGG - Intronic
1012514960 6:100048709-100048731 GAGAGTGGTAGAGATGGTGCAGG + Intergenic
1012880591 6:104783265-104783287 AAGGGAGGAAGAGCTGGCTCTGG - Intronic
1013994910 6:116296949-116296971 TAGGGAGGAAGAGTTGAGGCAGG + Intronic
1014982714 6:127964405-127964427 CAGGAAGGTAGTGCTGCTGCAGG + Intergenic
1016277008 6:142365684-142365706 TAGGGAGGAAGAGCAGGAGGAGG + Intronic
1016289986 6:142518454-142518476 TGGGGAGGAACAGCTGGTGTGGG + Intergenic
1018045250 6:159960140-159960162 TAGGGAGATGGAGCTAGTGAGGG - Intergenic
1018370414 6:163162936-163162958 CAGGGAGGTGGAGCTGCTGTAGG + Intronic
1018932439 6:168250152-168250174 TAGGTAGGTAGAGCAGGTTCTGG - Intergenic
1018936825 6:168279219-168279241 TAGGGAGCAAGAGCTCGTGAGGG + Intergenic
1018970676 6:168526492-168526514 TAGGGAGGGAGATGTGGAGCGGG + Intronic
1019114829 6:169751657-169751679 TATGGAGGTAGGGCGGGTGTAGG + Exonic
1019129297 6:169861901-169861923 TGGGGACACAGAGCTGGTGCTGG + Intergenic
1021807343 7:24370442-24370464 TAGGCAGGTAGATGTGGTTCTGG + Intergenic
1022487298 7:30789540-30789562 AAGGGAGCTGGAGCTGCTGCAGG - Intronic
1022896072 7:34751505-34751527 TATGGAGGAGGAGCTGGGGCTGG - Intronic
1022976027 7:35557667-35557689 TAGGGTGGTAGAGTGAGTGCAGG - Intergenic
1023176532 7:37440907-37440929 TTGGGAGGTAGAGCTAGTGGAGG - Intronic
1026314086 7:69212735-69212757 TGGGGAGGTATTGCTAGTGCAGG - Intergenic
1027186200 7:75972189-75972211 TGGGAAGGGTGAGCTGGTGCGGG + Intronic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1029480418 7:100809063-100809085 TAGGGAGCAAGAGCAGGAGCTGG - Intronic
1030142264 7:106317302-106317324 TAGAGACATAGAGCTGGTGGTGG + Intergenic
1032392692 7:131566373-131566395 TAGGGAGTTTGGGCAGGTGCGGG - Intergenic
1032501246 7:132401816-132401838 CAGGGACTTAGAGCTGGTTCAGG - Intronic
1032965666 7:137094023-137094045 TAGAGAGGTAGAGGTGTTCCGGG - Intergenic
1033078027 7:138267849-138267871 TCTGGTGGTAGAGCTGGGGCTGG - Intergenic
1033529670 7:142249059-142249081 TAGGGAGATGGGGCTGGGGCTGG + Intergenic
1034196676 7:149253806-149253828 TAGGCAGGTACAGCTGGACCAGG + Exonic
1034450383 7:151134166-151134188 GAGGGAGGTAGAGTTGGGGGCGG - Intronic
1034535705 7:151724541-151724563 TTGGAGGGTAGAGCTGGTGCTGG + Intronic
1034754959 7:153607570-153607592 GACGGAGGTAGGGCTGGTACAGG + Intergenic
1037486274 8:19350280-19350302 CAGTGATGCAGAGCTGGTGCAGG - Intronic
1037730245 8:21517912-21517934 CAGGCAGGAAGAGGTGGTGCTGG - Intergenic
1038945988 8:32360903-32360925 TTCGGAGGTAGAGCTGGCCCTGG + Intronic
1042430428 8:68700248-68700270 TGGGGAGGTAGAGCTGTGTCTGG + Intronic
1042510493 8:69606231-69606253 TAGGGAGGGAGAGCTGTTGAAGG + Intronic
1042903043 8:73747011-73747033 AGTGGAGGTAGAGCCGGTGCCGG - Intronic
1043482625 8:80668546-80668568 AAGGCAGGTTGAGCTGCTGCTGG + Intronic
1043839674 8:85087837-85087859 CAGGCAGATAGAGCTTGTGCAGG - Intergenic
1044120136 8:88384219-88384241 TAGGTTGGTGGAACTGGTGCAGG - Intergenic
1044939049 8:97321899-97321921 TATTGAGGTGGAGCTGATGCTGG + Intergenic
1045294256 8:100860226-100860248 TAAGGAGGTGAAGCTGCTGCAGG + Intergenic
1045496821 8:102716364-102716386 TGAGGAAGTAGAACTGGTGCTGG - Intergenic
1047498824 8:125427314-125427336 CTGGGAAGTAGAGCTGGTGAGGG + Intergenic
1047966089 8:130047999-130048021 TTGGGAGCTAGAGGTGGAGCTGG - Intergenic
1049426164 8:142538784-142538806 TGGGGAGGGAGAGGTGGTGGGGG - Intronic
1049487807 8:142875572-142875594 GGGGGAGGAAGAGCAGGTGCAGG + Intronic
1049492582 8:142913145-142913167 GGGGGAGGAAGAGCAGGTGCAGG + Intronic
1049766574 8:144358016-144358038 TGGGCAGGTAACGCTGGTGCCGG - Exonic
1053308143 9:36998157-36998179 TCTGGAGGAAGAGCTGGGGCTGG - Intronic
1055665981 9:78553575-78553597 TAGGGAGGAAGAGATGGCGACGG + Intergenic
1055963665 9:81844450-81844472 TAGGAAGGGACAGCTGGTCCAGG + Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1056534247 9:87514141-87514163 TAGGAGGCTAGAGCTGGTGTAGG + Intronic
1056689043 9:88790346-88790368 AAAGGAAGTAGAGATGGTGCTGG + Intergenic
1057228698 9:93305918-93305940 TAGGCAGGCAGAGCTGGGACGGG - Intronic
1057302680 9:93895840-93895862 TAGGGAGGGAGCAATGGTGCTGG + Intergenic
1058914899 9:109556312-109556334 TAGGGAGGTAGAACTGGGACAGG - Intergenic
1062202328 9:135310057-135310079 CAGGGAGGAAGAGCTGCAGCGGG + Intergenic
1062288388 9:135783815-135783837 TGGGAAGATAGAGCTGGTTCAGG + Intronic
1062334100 9:136057370-136057392 TGGGGAGGGACAGCTGGGGCTGG + Intronic
1062428324 9:136516222-136516244 GAGGCAGGGAGAGCTGGAGCTGG - Intronic
1062555769 9:137112842-137112864 CAGGGAGGCGGAGCTGGTGGAGG - Intronic
1186781269 X:12914615-12914637 AAGGGAGGTAGAGGTTGTGAGGG - Intronic
1187126762 X:16461700-16461722 TCGGGAGCTAGGGGTGGTGCAGG + Intergenic
1188315707 X:28670581-28670603 GAGGGTGGTAGAGCTGTGGCAGG - Intronic
1190136764 X:47805491-47805513 AAGGCATGTAGAGGTGGTGCTGG - Intergenic
1193698808 X:84739796-84739818 GAGAGAGGTAGAGCTGGAGTGGG - Intergenic
1194236056 X:91384191-91384213 TAGGAAGGTAAAGCAGGAGCAGG - Intergenic
1197882264 X:131179205-131179227 TTGGGAGGCAGTGCTGGGGCTGG - Intergenic
1197966060 X:132063214-132063236 TAGGGAGGGGGAGTTGGTGATGG - Intergenic
1198392808 X:136193564-136193586 ATGGGAGGCAGAGCTGGTGTAGG - Intronic
1198489038 X:137119994-137120016 CAGGGAGCTGGAGCTGGAGCTGG - Intergenic
1201973597 Y:19821741-19821763 TTGTGAGGTAGATCTGGTGGAGG - Intergenic
1202379372 Y:24262267-24262289 TGGGCAGGTGGAGGTGGTGCAGG + Intergenic
1202491410 Y:25407854-25407876 TGGGCAGGTGGAGGTGGTGCAGG - Intergenic