ID: 1139752953

View in Genome Browser
Species Human (GRCh38)
Location 16:69120228-69120250
Sequence GAAATCTGACCCCATTTCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752953_1139752959 8 Left 1139752953 16:69120228-69120250 CCTTGGAAATGGGGTCAGATTTC 0: 1
1: 1
2: 0
3: 13
4: 206
Right 1139752959 16:69120259-69120281 GAACCGGCCGCCATAAGGAAGGG 0: 1
1: 0
2: 1
3: 1
4: 26
1139752953_1139752954 -8 Left 1139752953 16:69120228-69120250 CCTTGGAAATGGGGTCAGATTTC 0: 1
1: 1
2: 0
3: 13
4: 206
Right 1139752954 16:69120243-69120265 CAGATTTCCACCAAGAGAACCGG 0: 1
1: 0
2: 0
3: 27
4: 151
1139752953_1139752957 3 Left 1139752953 16:69120228-69120250 CCTTGGAAATGGGGTCAGATTTC 0: 1
1: 1
2: 0
3: 13
4: 206
Right 1139752957 16:69120254-69120276 CAAGAGAACCGGCCGCCATAAGG 0: 1
1: 0
2: 1
3: 1
4: 29
1139752953_1139752958 7 Left 1139752953 16:69120228-69120250 CCTTGGAAATGGGGTCAGATTTC 0: 1
1: 1
2: 0
3: 13
4: 206
Right 1139752958 16:69120258-69120280 AGAACCGGCCGCCATAAGGAAGG 0: 1
1: 0
2: 1
3: 1
4: 34
1139752953_1139752964 30 Left 1139752953 16:69120228-69120250 CCTTGGAAATGGGGTCAGATTTC 0: 1
1: 1
2: 0
3: 13
4: 206
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354
1139752953_1139752963 29 Left 1139752953 16:69120228-69120250 CCTTGGAAATGGGGTCAGATTTC 0: 1
1: 1
2: 0
3: 13
4: 206
Right 1139752963 16:69120280-69120302 GGATCCGAGTTCACACCCAGTGG 0: 2
1: 0
2: 0
3: 9
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752953 Original CRISPR GAAATCTGACCCCATTTCCA AGG (reversed) Exonic