ID: 1139752955

View in Genome Browser
Species Human (GRCh38)
Location 16:69120250-69120272
Sequence ATGGCGGCCGGTTCTCTTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752955_1139752969 28 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752955_1139752966 11 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88
1139752955_1139752963 7 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752963 16:69120280-69120302 GGATCCGAGTTCACACCCAGTGG 0: 2
1: 0
2: 0
3: 9
4: 55
1139752955_1139752964 8 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752955 Original CRISPR ATGGCGGCCGGTTCTCTTGG TGG (reversed) Exonic
900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG + Intergenic
911094715 1:94045923-94045945 ATGGCGCTCGGGTCCCTTGGAGG + Intronic
919808598 1:201395520-201395542 AAGGCGGCCGGATCACTTGAGGG + Intronic
920845582 1:209590591-209590613 ATGACGGCCTGTTCTCCAGGAGG - Intronic
1075112969 10:119602840-119602862 CTTGCAGCAGGTTCTCTTGGAGG + Intergenic
1086119023 11:83286310-83286332 ATGGCCGCTGGCTATCTTGGGGG - Exonic
1090254316 11:125272694-125272716 AAGGCGGCTGTTCCTCTTGGAGG - Intronic
1101254783 12:102966217-102966239 AGGGCGGCTGCTTCTGTTGGGGG + Intergenic
1102646275 12:114405896-114405918 ATGGTTGCCGGTGCTCTTGGAGG - Intronic
1104074241 12:125375625-125375647 GTGGCTGCCGGCTCTCTTTGAGG + Intronic
1106898238 13:34328576-34328598 ATGTTGGCCGTTTCTCTTGCAGG + Intergenic
1115772736 14:36683234-36683256 ATGGCAGCCGGTTTTTTTGTGGG + Intronic
1118845699 14:69546437-69546459 ATGGCTCCCATTTCTCTTGGAGG - Intergenic
1131073442 15:89480098-89480120 ATGGCTGCCAGTTCTTTTTGGGG - Intronic
1132314780 15:100881640-100881662 ATGGTTGCCTGTTGTCTTGGTGG + Intronic
1139752955 16:69120250-69120272 ATGGCGGCCGGTTCTCTTGGTGG - Exonic
1140894699 16:79314650-79314672 ATGCCGGCTGGTTCCCCTGGAGG + Intergenic
1152791698 17:82283595-82283617 ATGGCTGCCGATTCACTGGGTGG - Intergenic
1156711181 18:39947862-39947884 ATGGGGTCCTGTTTTCTTGGTGG - Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1159369897 18:67516633-67516655 CGGGCGGCGGGTTCTCTCGGTGG + Exonic
1163228160 19:15979542-15979564 CTGGTAGCAGGTTCTCTTGGAGG - Intergenic
1164306044 19:24004286-24004308 ATGGCTGGCGGTTCCCTTGCAGG - Intergenic
931665850 2:64609229-64609251 GGGGCTGCCGGTGCTCTTGGGGG + Intergenic
938715104 2:134012189-134012211 ATGGGAGCGGATTCTCTTGGGGG - Intergenic
938943000 2:136185948-136185970 ATGACAGCCGCTTGTCTTGGGGG + Intergenic
944743633 2:202635221-202635243 ACGCCGGCCGGCTCCCTTGGGGG + Exonic
947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG + Exonic
948864997 2:240770759-240770781 AAGGCAGCCAGTTCACTTGGGGG - Intronic
1174460347 20:50678112-50678134 ATGGTGGCTGGTTCTCTTCTTGG - Intronic
1180657060 22:17430746-17430768 ATGGCTGCAGTGTCTCTTGGTGG + Intronic
954756144 3:52841174-52841196 ATGGAGGTCGGTTCCCCTGGAGG - Intronic
961894401 3:130155290-130155312 ATGGCCACATGTTCTCTTGGGGG - Intergenic
962247252 3:133806007-133806029 AAGGCGGCCGGTGGTCATGGCGG + Intronic
969688590 4:8690722-8690744 GTGGCTGCAGGTGCTCTTGGGGG + Intergenic
985592238 5:771446-771468 ATGGGGGCAGGGTCTCATGGGGG + Intergenic
1007779708 6:44245986-44246008 AGGGCAGCCGGAGCTCTTGGAGG - Intergenic
1008378546 6:50818901-50818923 ATGGCAGCCTGGTCTCTAGGAGG - Exonic
1018416539 6:163606667-163606689 ATGGCATCCATTTCTCTTGGGGG + Intergenic
1026786292 7:73303740-73303762 ATTGGGGCCGTTTCTCTTGCAGG - Exonic
1053885931 9:42645245-42645267 ATGGCGGCCGGAGCGCTAGGCGG + Intergenic
1054224949 9:62452694-62452716 ATGGCGGCCGGAGCGCTAGGCGG + Intergenic
1185633859 X:1537134-1537156 AAGGCGGCCGCTTCGCTGGGTGG + Intergenic
1189794437 X:44633847-44633869 ATGGCGGCTGGTTTTCTTGGTGG + Intergenic