ID: 1139752955

View in Genome Browser
Species Human (GRCh38)
Location 16:69120250-69120272
Sequence ATGGCGGCCGGTTCTCTTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752955_1139752964 8 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354
1139752955_1139752969 28 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752955_1139752963 7 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752963 16:69120280-69120302 GGATCCGAGTTCACACCCAGTGG 0: 2
1: 0
2: 0
3: 9
4: 55
1139752955_1139752966 11 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752955 Original CRISPR ATGGCGGCCGGTTCTCTTGG TGG (reversed) Exonic