ID: 1139752956

View in Genome Browser
Species Human (GRCh38)
Location 16:69120253-69120275
Sequence CTTATGGCGGCCGGTTCTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752956_1139752964 5 Left 1139752956 16:69120253-69120275 CCAAGAGAACCGGCCGCCATAAG 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354
1139752956_1139752969 25 Left 1139752956 16:69120253-69120275 CCAAGAGAACCGGCCGCCATAAG 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752956_1139752966 8 Left 1139752956 16:69120253-69120275 CCAAGAGAACCGGCCGCCATAAG 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88
1139752956_1139752963 4 Left 1139752956 16:69120253-69120275 CCAAGAGAACCGGCCGCCATAAG 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1139752963 16:69120280-69120302 GGATCCGAGTTCACACCCAGTGG 0: 2
1: 0
2: 0
3: 9
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752956 Original CRISPR CTTATGGCGGCCGGTTCTCT TGG (reversed) Exonic