ID: 1139752962

View in Genome Browser
Species Human (GRCh38)
Location 16:69120269-69120291
Sequence GAACTCGGATCCCTTCCTTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752962_1139752972 28 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279
1139752962_1139752971 21 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1139752962_1139752973 29 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169
1139752962_1139752966 -8 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88
1139752962_1139752969 9 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752962 Original CRISPR GAACTCGGATCCCTTCCTTA TGG (reversed) Exonic