ID: 1139752964

View in Genome Browser
Species Human (GRCh38)
Location 16:69120281-69120303
Sequence GATCCGAGTTCACACCCAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 2, 1: 0, 2: 3, 3: 32, 4: 354}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752960_1139752964 -4 Left 1139752960 16:69120262-69120284 CCGGCCGCCATAAGGAAGGGATC 0: 2
1: 0
2: 0
3: 4
4: 57
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354
1139752955_1139752964 8 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354
1139752953_1139752964 30 Left 1139752953 16:69120228-69120250 CCTTGGAAATGGGGTCAGATTTC 0: 1
1: 1
2: 0
3: 13
4: 206
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354
1139752956_1139752964 5 Left 1139752956 16:69120253-69120275 CCAAGAGAACCGGCCGCCATAAG 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354
1139752961_1139752964 -8 Left 1139752961 16:69120266-69120288 CCGCCATAAGGAAGGGATCCGAG 0: 2
1: 0
2: 1
3: 5
4: 68
Right 1139752964 16:69120281-69120303 GATCCGAGTTCACACCCAGTGGG 0: 2
1: 0
2: 3
3: 32
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752964 Original CRISPR GATCCGAGTTCACACCCAGT GGG Exonic