ID: 1139752966

View in Genome Browser
Species Human (GRCh38)
Location 16:69120284-69120306
Sequence CCGAGTTCACACCCAGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752962_1139752966 -8 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88
1139752955_1139752966 11 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88
1139752956_1139752966 8 Left 1139752956 16:69120253-69120275 CCAAGAGAACCGGCCGCCATAAG 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88
1139752960_1139752966 -1 Left 1139752960 16:69120262-69120284 CCGGCCGCCATAAGGAAGGGATC 0: 2
1: 0
2: 0
3: 4
4: 57
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88
1139752961_1139752966 -5 Left 1139752961 16:69120266-69120288 CCGCCATAAGGAAGGGATCCGAG 0: 2
1: 0
2: 1
3: 5
4: 68
Right 1139752966 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752966 Original CRISPR CCGAGTTCACACCCAGTGGG TGG Exonic