ID: 1139752967

View in Genome Browser
Species Human (GRCh38)
Location 16:69120295-69120317
Sequence CTGAACACAGGCCACCCACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752967_1139752971 -5 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1139752967_1139752981 25 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752967_1139752972 2 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279
1139752967_1139752973 3 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169
1139752967_1139752983 28 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752983 16:69120346-69120368 CCGTCGAGCCGTCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752967 Original CRISPR CTGAACACAGGCCACCCACT GGG (reversed) Exonic