ID: 1139752969

View in Genome Browser
Species Human (GRCh38)
Location 16:69120301-69120323
Sequence GGGTGGCCTGTGTTCAGAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1245
Summary {0: 2, 1: 0, 2: 0, 3: 33, 4: 1210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752960_1139752969 16 Left 1139752960 16:69120262-69120284 CCGGCCGCCATAAGGAAGGGATC 0: 2
1: 0
2: 0
3: 4
4: 57
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752955_1139752969 28 Left 1139752955 16:69120250-69120272 CCACCAAGAGAACCGGCCGCCAT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752965_1139752969 -6 Left 1139752965 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 2
3: 16
4: 134
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752956_1139752969 25 Left 1139752956 16:69120253-69120275 CCAAGAGAACCGGCCGCCATAAG 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752961_1139752969 12 Left 1139752961 16:69120266-69120288 CCGCCATAAGGAAGGGATCCGAG 0: 2
1: 0
2: 1
3: 5
4: 68
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210
1139752962_1139752969 9 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752969 16:69120301-69120323 GGGTGGCCTGTGTTCAGAACAGG 0: 2
1: 0
2: 0
3: 33
4: 1210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752969 Original CRISPR GGGTGGCCTGTGTTCAGAAC AGG Exonic