ID: 1139752970

View in Genome Browser
Species Human (GRCh38)
Location 16:69120307-69120329
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 2, 1: 0, 2: 2, 3: 14, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752970_1139752981 13 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752970_1139752972 -10 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279
1139752970_1139752973 -9 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169
1139752970_1139752983 16 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752983 16:69120346-69120368 CCGTCGAGCCGTCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1139752970_1139752984 22 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752984 16:69120352-69120374 AGCCGTCCTCGAGGTGGCAGCGG 0: 1
1: 0
2: 2
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752970 Original CRISPR GGGGGTCCTGTTCTGAACAC AGG (reversed) Exonic