ID: 1139752971

View in Genome Browser
Species Human (GRCh38)
Location 16:69120313-69120335
Sequence TTCAGAACAGGACCCCCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752968_1139752971 -6 Left 1139752968 16:69120296-69120318 CCAGTGGGTGGCCTGTGTTCAGA 0: 2
1: 0
2: 0
3: 18
4: 199
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1139752965_1139752971 6 Left 1139752965 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 2
3: 16
4: 134
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1139752967_1139752971 -5 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1139752961_1139752971 24 Left 1139752961 16:69120266-69120288 CCGCCATAAGGAAGGGATCCGAG 0: 2
1: 0
2: 1
3: 5
4: 68
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1139752960_1139752971 28 Left 1139752960 16:69120262-69120284 CCGGCCGCCATAAGGAAGGGATC 0: 2
1: 0
2: 0
3: 4
4: 57
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1139752962_1139752971 21 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752971 16:69120313-69120335 TTCAGAACAGGACCCCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752971 Original CRISPR TTCAGAACAGGACCCCCCTG TGG Exonic