ID: 1139752972

View in Genome Browser
Species Human (GRCh38)
Location 16:69120320-69120342
Sequence CAGGACCCCCCTGTGGTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752970_1139752972 -10 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279
1139752962_1139752972 28 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279
1139752968_1139752972 1 Left 1139752968 16:69120296-69120318 CCAGTGGGTGGCCTGTGTTCAGA 0: 2
1: 0
2: 0
3: 18
4: 199
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279
1139752967_1139752972 2 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279
1139752965_1139752972 13 Left 1139752965 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 2
3: 16
4: 134
Right 1139752972 16:69120320-69120342 CAGGACCCCCCTGTGGTCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752972 Original CRISPR CAGGACCCCCCTGTGGTCCC AGG Exonic