ID: 1139752973

View in Genome Browser
Species Human (GRCh38)
Location 16:69120321-69120343
Sequence AGGACCCCCCTGTGGTCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752970_1139752973 -9 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169
1139752965_1139752973 14 Left 1139752965 16:69120284-69120306 CCGAGTTCACACCCAGTGGGTGG 0: 2
1: 0
2: 2
3: 16
4: 134
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169
1139752962_1139752973 29 Left 1139752962 16:69120269-69120291 CCATAAGGAAGGGATCCGAGTTC 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169
1139752968_1139752973 2 Left 1139752968 16:69120296-69120318 CCAGTGGGTGGCCTGTGTTCAGA 0: 2
1: 0
2: 0
3: 18
4: 199
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169
1139752967_1139752973 3 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752973 16:69120321-69120343 AGGACCCCCCTGTGGTCCCAGGG 0: 1
1: 1
2: 0
3: 22
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752973 Original CRISPR AGGACCCCCCTGTGGTCCCA GGG Exonic