ID: 1139752974

View in Genome Browser
Species Human (GRCh38)
Location 16:69120325-69120347
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 319}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752974_1139752984 4 Left 1139752974 16:69120325-69120347 CCCCCCTGTGGTCCCAGGGAACC 0: 1
1: 1
2: 2
3: 30
4: 319
Right 1139752984 16:69120352-69120374 AGCCGTCCTCGAGGTGGCAGCGG 0: 1
1: 0
2: 2
3: 9
4: 151
1139752974_1139752983 -2 Left 1139752974 16:69120325-69120347 CCCCCCTGTGGTCCCAGGGAACC 0: 1
1: 1
2: 2
3: 30
4: 319
Right 1139752983 16:69120346-69120368 CCGTCGAGCCGTCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1139752974_1139752987 19 Left 1139752974 16:69120325-69120347 CCCCCCTGTGGTCCCAGGGAACC 0: 1
1: 1
2: 2
3: 30
4: 319
Right 1139752987 16:69120367-69120389 GGCAGCGGAGCACGAGTCCAAGG 0: 1
1: 1
2: 0
3: 7
4: 90
1139752974_1139752981 -5 Left 1139752974 16:69120325-69120347 CCCCCCTGTGGTCCCAGGGAACC 0: 1
1: 1
2: 2
3: 30
4: 319
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752974_1139752988 25 Left 1139752974 16:69120325-69120347 CCCCCCTGTGGTCCCAGGGAACC 0: 1
1: 1
2: 2
3: 30
4: 319
Right 1139752988 16:69120373-69120395 GGAGCACGAGTCCAAGGAGTTGG 0: 1
1: 1
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752974 Original CRISPR GGTTCCCTGGGACCACAGGG GGG (reversed) Exonic