ID: 1139752976

View in Genome Browser
Species Human (GRCh38)
Location 16:69120327-69120349
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752976_1139752984 2 Left 1139752976 16:69120327-69120349 CCCCTGTGGTCCCAGGGAACCGT 0: 1
1: 1
2: 0
3: 12
4: 152
Right 1139752984 16:69120352-69120374 AGCCGTCCTCGAGGTGGCAGCGG 0: 1
1: 0
2: 2
3: 9
4: 151
1139752976_1139752981 -7 Left 1139752976 16:69120327-69120349 CCCCTGTGGTCCCAGGGAACCGT 0: 1
1: 1
2: 0
3: 12
4: 152
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752976_1139752988 23 Left 1139752976 16:69120327-69120349 CCCCTGTGGTCCCAGGGAACCGT 0: 1
1: 1
2: 0
3: 12
4: 152
Right 1139752988 16:69120373-69120395 GGAGCACGAGTCCAAGGAGTTGG 0: 1
1: 1
2: 0
3: 10
4: 152
1139752976_1139752987 17 Left 1139752976 16:69120327-69120349 CCCCTGTGGTCCCAGGGAACCGT 0: 1
1: 1
2: 0
3: 12
4: 152
Right 1139752987 16:69120367-69120389 GGCAGCGGAGCACGAGTCCAAGG 0: 1
1: 1
2: 0
3: 7
4: 90
1139752976_1139752983 -4 Left 1139752976 16:69120327-69120349 CCCCTGTGGTCCCAGGGAACCGT 0: 1
1: 1
2: 0
3: 12
4: 152
Right 1139752983 16:69120346-69120368 CCGTCGAGCCGTCCTCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752976 Original CRISPR ACGGTTCCCTGGGACCACAG GGG (reversed) Exonic