ID: 1139752981

View in Genome Browser
Species Human (GRCh38)
Location 16:69120343-69120365
Sequence GAACCGTCGAGCCGTCCTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 7}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752978_1139752981 -9 Left 1139752978 16:69120329-69120351 CCTGTGGTCCCAGGGAACCGTCG 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752970_1139752981 13 Left 1139752970 16:69120307-69120329 CCTGTGTTCAGAACAGGACCCCC 0: 2
1: 0
2: 2
3: 14
4: 143
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752974_1139752981 -5 Left 1139752974 16:69120325-69120347 CCCCCCTGTGGTCCCAGGGAACC 0: 1
1: 1
2: 2
3: 30
4: 319
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752976_1139752981 -7 Left 1139752976 16:69120327-69120349 CCCCTGTGGTCCCAGGGAACCGT 0: 1
1: 1
2: 0
3: 12
4: 152
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752975_1139752981 -6 Left 1139752975 16:69120326-69120348 CCCCCTGTGGTCCCAGGGAACCG 0: 1
1: 1
2: 1
3: 14
4: 215
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752977_1139752981 -8 Left 1139752977 16:69120328-69120350 CCCTGTGGTCCCAGGGAACCGTC 0: 1
1: 1
2: 0
3: 12
4: 101
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752968_1139752981 24 Left 1139752968 16:69120296-69120318 CCAGTGGGTGGCCTGTGTTCAGA 0: 2
1: 0
2: 0
3: 18
4: 199
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1139752967_1139752981 25 Left 1139752967 16:69120295-69120317 CCCAGTGGGTGGCCTGTGTTCAG 0: 2
1: 0
2: 0
3: 16
4: 181
Right 1139752981 16:69120343-69120365 GAACCGTCGAGCCGTCCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752981 Original CRISPR GAACCGTCGAGCCGTCCTCG AGG Exonic