ID: 1139752986

View in Genome Browser
Species Human (GRCh38)
Location 16:69120358-69120380
Sequence CGTGCTCCGCTGCCACCTCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139752986_1139752990 4 Left 1139752986 16:69120358-69120380 CCTCGAGGTGGCAGCGGAGCACG 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1139752990 16:69120385-69120407 CAAGGAGTTGGCCGCTCTCTAGG 0: 2
1: 0
2: 0
3: 5
4: 84
1139752986_1139752991 5 Left 1139752986 16:69120358-69120380 CCTCGAGGTGGCAGCGGAGCACG 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1139752991 16:69120386-69120408 AAGGAGTTGGCCGCTCTCTAGGG 0: 2
1: 0
2: 0
3: 5
4: 59
1139752986_1139752993 16 Left 1139752986 16:69120358-69120380 CCTCGAGGTGGCAGCGGAGCACG 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1139752993 16:69120397-69120419 CGCTCTCTAGGGAAAATCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 28
1139752986_1139752988 -8 Left 1139752986 16:69120358-69120380 CCTCGAGGTGGCAGCGGAGCACG 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1139752988 16:69120373-69120395 GGAGCACGAGTCCAAGGAGTTGG 0: 1
1: 1
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139752986 Original CRISPR CGTGCTCCGCTGCCACCTCG AGG (reversed) Exonic
900099560 1:955778-955800 CGTGCCCCGCTGCCTTCTCAGGG + Intronic
900208532 1:1441755-1441777 GGTGCCCCGCTGCCACCTGCAGG - Exonic
900498256 1:2986703-2986725 CGTGCAAGGCTGCCCCCTCGGGG + Intergenic
900886792 1:5420946-5420968 CATGCTCCTCTGCACCCTCGCGG - Intergenic
903387139 1:22934698-22934720 CAAGCTCCGCTGACACCTTGAGG - Intergenic
903685838 1:25131244-25131266 AGTGTTCTGCTGCCTCCTCGGGG - Intergenic
907179097 1:52553688-52553710 CGGGCTCGGCTTCCAGCTCGGGG - Intergenic
908249942 1:62257449-62257471 CTTGCTCCTCTGTCACCTCCAGG - Intronic
908595813 1:65687847-65687869 TGTGCTCTGCTGCCACCTGCTGG + Intergenic
912752683 1:112298753-112298775 GGTGCTCTGCTGCCCCCTGGGGG - Intergenic
913349686 1:117843322-117843344 AGTGCTCAGCTCCCACCTCCTGG - Intergenic
1072783997 10:98268249-98268271 CCTCCTCCGCGGCCAGCTCGGGG - Exonic
1073266177 10:102229932-102229954 GGTGCTGCGGCGCCACCTCGTGG - Intergenic
1077107916 11:849895-849917 CGCGACCCGCTGCCACCGCGGGG + Intronic
1077198589 11:1293785-1293807 CGTCCTCAGCCGCCACCTCCTGG - Intronic
1080247564 11:30196781-30196803 TGTGCACCACTGCCACCTCGTGG + Intergenic
1084837601 11:71813928-71813950 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1092401099 12:8180141-8180163 CGTCCTGTGCTGCCACCTCATGG + Intronic
1106248871 13:27969134-27969156 GGTGCTCCGCTGGCTCCTCGCGG + Exonic
1114272070 14:21107020-21107042 TGTCCTCTGCTGCCATCTCGTGG + Intergenic
1117254388 14:53963470-53963492 CGTGCTCCGCTGATACCCCAGGG + Intergenic
1118908922 14:70045307-70045329 CATGCTCTCCTGCCACCTCTTGG - Exonic
1121325142 14:93015509-93015531 CGGGCTCCTCTGTGACCTCGTGG - Intronic
1121336328 14:93079578-93079600 AGTTTTCCGCTGCCACCTCCTGG - Intronic
1126109836 15:45168683-45168705 AGTGCTCAGCTGCCTCCTCCTGG + Intronic
1128935631 15:71744105-71744127 CTTTCTCTGCTGCCACCTGGTGG - Intronic
1131120975 15:89823368-89823390 CCTGCCCTGCTGCCACCTCAGGG - Intergenic
1132879147 16:2153688-2153710 GGTGCTCTGCTGCCCCCTCCTGG + Exonic
1132978101 16:2720468-2720490 CGTGCACCGCGGTCAGCTCGGGG - Intronic
1133090507 16:3400747-3400769 CGTGCCCCGCTCCCACCGTGCGG - Intronic
1133240986 16:4414350-4414372 CGTGCTCCTCTGCCTCCCCTTGG - Intronic
1133282100 16:4672466-4672488 GGTGCTCCGCTCCCGCCACGTGG - Intronic
1136021028 16:27440106-27440128 TGTGCACCTCTGTCACCTCGGGG + Intronic
1138514491 16:57528637-57528659 CGCGCTCCGCTTCCGGCTCGGGG + Exonic
1139752986 16:69120358-69120380 CGTGCTCCGCTGCCACCTCGAGG - Exonic
1141569422 16:84925319-84925341 GGTGCTCTGCTGCCCCCTGGTGG - Intergenic
1143448434 17:7022137-7022159 AGTGCTCGGCCGCCCCCTCGTGG + Intergenic
1144806553 17:17971956-17971978 CGGGCGCCGGTGCCACCTCCCGG - Intronic
1152870838 17:82752226-82752248 CGTCCTCCGCCTCCTCCTCGGGG - Exonic
1154377910 18:13824059-13824081 CGGCCTCCGCTGCCACCTAGTGG - Intergenic
1156527280 18:37778700-37778722 TGTGCTCCACTGCCCCCTGGTGG - Intergenic
1160190371 18:76709959-76709981 TATGCTCCGCTGCCATCTGGTGG + Intergenic
1160380140 18:78448341-78448363 CCTGCTCTGCTGCCGCCTTGTGG - Intergenic
1160940748 19:1619414-1619436 CGTGCTCCGCAGCCACGCCGTGG - Exonic
1162573720 19:11486865-11486887 CTTGCTCCGCCGCCTCCTGGAGG + Exonic
1163834213 19:19563364-19563386 CATGCTGCGCGGCCACCTCTGGG - Intronic
1166071302 19:40389804-40389826 CGTGCTCCGCCGCCAGCCCTTGG + Exonic
1166549346 19:43654862-43654884 CCTGCTCCACTGCCACCACCTGG - Intronic
1168146114 19:54420795-54420817 CGTTCTCCGCCCCCACCTCCTGG - Intronic
925271679 2:2614255-2614277 CGTGCACCACAGCCACCTCCTGG - Intergenic
925271783 2:2615033-2615055 CGTGCACCACAGCCACCTCCTGG + Intergenic
935765744 2:106366274-106366296 CGTGCTCTGCTGCAGCCTCAGGG - Intergenic
937255438 2:120552216-120552238 CGTGCTCCGGCGCTACCTCCAGG + Intergenic
938909902 2:135876338-135876360 CCGGCTCCGCTGCCGCCGCGAGG + Exonic
944905733 2:204260279-204260301 TGTGCTCGTCTGCCACCTCGTGG - Intergenic
947118775 2:226797039-226797061 CGGCCTCCACTGCCACCTCCTGG + Exonic
947156026 2:227164083-227164105 CGCGCCCCGCTGCCTCTTCGCGG + Exonic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1175108416 20:56630011-56630033 CCTGCCCCGCTACCTCCTCGGGG + Intronic
1175988051 20:62773999-62774021 CCTGCTCCACTGTCCCCTCGGGG - Intergenic
1176429932 21:6569318-6569340 AGTCCTCTGCTGCCACCTGGTGG - Intergenic
1179705326 21:43176780-43176802 AGTCCTCTGCTGCCACCTGGTGG - Intergenic
1180129918 21:45820732-45820754 GGACCTCTGCTGCCACCTCGTGG + Intronic
1182049606 22:27302652-27302674 CGTGTTCCGTTACCACCTTGGGG - Intergenic
1183583561 22:38739469-38739491 CGTGTCCCCCTGTCACCTCGTGG + Intronic
1185398531 22:50604487-50604509 CGGGCCCCGCGGCCGCCTCGGGG - Exonic
952666297 3:35908562-35908584 TGTGCGCTACTGCCACCTCGTGG + Intergenic
953982156 3:47418320-47418342 TGTGCTGCGCGGCCACCTCATGG - Exonic
953996321 3:47522722-47522744 CGTGCTCTGCAGACACCTGGGGG - Intergenic
954334160 3:49906466-49906488 AGTTCTCCGCTGCCACCGTGTGG + Intronic
954392056 3:50273075-50273097 CGGTCTCTGCTGCCCCCTCGCGG + Intronic
954419131 3:50409331-50409353 CTTGCTCTGCTGCCTCCTCCAGG - Intronic
954445204 3:50542608-50542630 CTTGCACTGCTGCCACCTGGTGG + Intergenic
954447554 3:50554781-50554803 CCTGCTCCTCTGCCTCCTCCAGG + Intergenic
960281402 3:115784655-115784677 CGCGCACTGCTGCCCCCTCGTGG + Intergenic
961268795 3:125671893-125671915 CGGGCTCAGCTGCCTCCCCGCGG + Intergenic
961402092 3:126654810-126654832 GGAGCTGCGCCGCCACCTCGTGG - Intronic
961821613 3:129578274-129578296 CGTGCTCCCCGGCCTCCTCCTGG + Intronic
969779018 4:9381439-9381461 CGTCCTGTGCTGCCACCTCATGG - Intergenic
979832322 4:125317218-125317240 CGTCCGCCGCCGCCACCTGGAGG - Exonic
983094419 4:163544568-163544590 CGTGTGCTGCTGCCACCTAGAGG + Intronic
986132266 5:4942452-4942474 GGTGCTGTGCTGCCACCTAGGGG + Intergenic
988536876 5:32076887-32076909 TGTGCTCTGCTGCCACCTTTGGG + Intronic
997988879 5:138527349-138527371 TGTGCTCTGCTGCCACCCCTTGG + Intronic
1006494887 6:34415429-34415451 TGTCATCAGCTGCCACCTCGTGG + Intronic
1015866335 6:137730499-137730521 CGTGCACCACTGTCACCTGGAGG - Intergenic
1019303650 7:322272-322294 GGCGCTCTGCTGCCACCTGGTGG - Intergenic
1019421695 7:953962-953984 CCGGCTCCGGGGCCACCTCGCGG - Intronic
1019748229 7:2712555-2712577 GAGGCTCCGCTGCCACCTGGGGG + Exonic
1026735311 7:72945326-72945348 CCTGCCCCGCAGCCACCTCGTGG - Intronic
1026785651 7:73300256-73300278 CCTGCCCCGCAGCCACCTCGTGG - Intergenic
1027108415 7:75419680-75419702 CCTGCCCCGCAGCCACCTCGTGG + Intronic
1032322378 7:130897133-130897155 TGTGCGAGGCTGCCACCTCGTGG - Intergenic
1032727722 7:134606495-134606517 GGGGCTCTGCTGCCACCTAGTGG + Intergenic
1034086120 7:148324251-148324273 CCTGCTCCTCTGCCACTTTGTGG - Intronic
1034457046 7:151176201-151176223 TGCGCTCCGCTCCCACCTGGAGG - Exonic
1034978220 7:155460003-155460025 GGGGATCCGCTGCCAGCTCGGGG - Intronic
1036276457 8:7355398-7355420 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1039547030 8:38417742-38417764 CCTGCTCCGCTGCCTGCTTGGGG - Intronic
1040471643 8:47738946-47738968 CGTCCTCCGCCGGCTCCTCGAGG + Exonic
1049425818 8:142537463-142537485 CCTGCTCAGCTGCCACCTAGGGG + Intronic
1049799362 8:144510622-144510644 GGTGCTGCGCTTCCGCCTCGGGG + Exonic
1050462180 9:5886282-5886304 GGTTCTCTGCTGCCACCTAGTGG - Intronic
1056246225 9:84697702-84697724 TGTGCTGCGCTGCCCCCTCCTGG - Intronic
1058110725 9:101028798-101028820 CTTCCTCCGCTGCCTCCTCCTGG - Exonic
1061289246 9:129641579-129641601 CCTGCTCCTCTGCCACGCCGGGG + Intronic
1061479048 9:130887520-130887542 CGTCCTGCCCTGCCCCCTCGGGG + Intronic
1062101018 9:134728628-134728650 CGGGCTCCGCTGCTTCCTCACGG + Intronic
1062540596 9:137040154-137040176 TGTGCTCCCCTGCCACCCCAGGG - Intronic
1062600642 9:137317335-137317357 CGTGCACCCCTGGCACCCCGAGG + Intronic
1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG + Intergenic
1190324332 X:49197607-49197629 CCTGCCCAGCTCCCACCTCGAGG - Intronic
1195579087 X:106481465-106481487 CATTCTCTGCTGCCACCTTGTGG - Intergenic