ID: 1139754026

View in Genome Browser
Species Human (GRCh38)
Location 16:69128523-69128545
Sequence TAGTTCATTTAGCTGCGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139754026 Original CRISPR TAGTTCATTTAGCTGCGTGA AGG (reversed) Intronic
902603377 1:17555115-17555137 AAGTTCCTTTAGCTGCGTCATGG + Intronic
904062390 1:27721858-27721880 TGGTTCAATTAGCTTTGTGAAGG + Intergenic
904297721 1:29532481-29532503 CAGTCCATTCAGCTGTGTGATGG - Intergenic
913376144 1:118154686-118154708 GACTTCATTTAGCTGCATGTTGG - Intronic
921563305 1:216684897-216684919 TAGTTAATTAAGCTGCATTAGGG - Intronic
923451272 1:234119825-234119847 TAGTGCATATTGCTGCGTGATGG - Intronic
923645193 1:235813446-235813468 TTTTTCATTTAACTGCATGAAGG - Intronic
1067241073 10:44494237-44494259 GAGTTCACTGAGCTTCGTGAAGG - Intergenic
1068742051 10:60484499-60484521 TTGGTCATTAAGCTGGGTGATGG + Intronic
1068939866 10:62670287-62670309 TATTTCTGTTAGCTGCTTGAAGG - Exonic
1075928888 10:126277019-126277041 TACTTCATTTAGCTTCATAATGG - Intronic
1078038315 11:7832390-7832412 TAGTTCACTTTGCTGGGTGAGGG + Intergenic
1080123983 11:28709857-28709879 TAGTTCCTTTATCTGCGAAATGG + Intergenic
1086257182 11:84891086-84891108 TAGTTATTTTAGCTACGTGGTGG + Intronic
1086371624 11:86161070-86161092 TTTTTCATTTAGCTTGGTGAAGG + Intergenic
1091877570 12:3948952-3948974 AAATTAATTTAGCTCCGTGAAGG - Intergenic
1109937973 13:69318395-69318417 TAGTTAATTTAGCTTAGAGAAGG - Intergenic
1111905464 13:94250782-94250804 TAATTGATTAAGCTGGGTGAAGG + Intronic
1113715765 13:112506012-112506034 TATTTCATTTAGGTGAGTGCTGG - Intronic
1122570047 14:102691178-102691200 AAGTTCATTGAGCGCCGTGAAGG + Intronic
1125805916 15:42493541-42493563 TAGTTCATTTAGGGTTGTGATGG - Intronic
1129769833 15:78195880-78195902 TAGTTCATTTGTCTGCCTCAGGG - Intronic
1139754026 16:69128523-69128545 TAGTTCATTTAGCTGCGTGAAGG - Intronic
1144514632 17:15908720-15908742 AAGTCCATCTAGCTGGGTGATGG - Intergenic
1144612453 17:16733984-16734006 AAATACATTTAGCTGCGTGTGGG + Intronic
1145132167 17:20364376-20364398 AAATACATTTAGCTGCGTGTGGG + Intergenic
1150517270 17:65826757-65826779 TAGTTCATTTCTCTGTGAGATGG - Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1167693020 19:50998827-50998849 TAGATTTTTTAGCTACGTGAGGG - Intronic
925707475 2:6700614-6700636 TAATTCATTAAGCTCCATGAAGG - Intergenic
928724815 2:34160190-34160212 AATTTTATTTAACTGCGTGATGG - Intergenic
943067035 2:183099340-183099362 TAGTTGATTTTTCTGCCTGAAGG + Exonic
1172840637 20:37901241-37901263 TAGTTCATTTCGCTGGGAGCGGG + Intergenic
1174948346 20:55013843-55013865 TTGTTCATGCAGCTGCGAGATGG - Intergenic
1175253057 20:57621297-57621319 CAGAACATTTAGGTGCGTGAAGG + Intergenic
1183643312 22:39106309-39106331 AGGTACATTTGGCTGCGTGATGG + Intergenic
958542355 3:95495280-95495302 TAGGTCATTTTGTTGTGTGAAGG - Intergenic
964374361 3:156035224-156035246 TAGAGCATTTAGCTGGGTGGAGG - Intergenic
965846162 3:172964636-172964658 TATTTCATTTAGTTGTATGAAGG + Intronic
971408172 4:26341674-26341696 CACTACATTTAGCTGCGTGGAGG + Intronic
971935727 4:33144411-33144433 TAATTCATTAAGTTGCCTGAGGG + Intergenic
979004994 4:115282921-115282943 TATTTCTTTTAGCTGCTTGCAGG - Intergenic
980835873 4:138191567-138191589 TAGTTCATTTCTCTGTGTGGTGG - Intronic
982423918 4:155234290-155234312 TAGTTCAATTACCTGCGTTCTGG + Intergenic
986838352 5:11667734-11667756 TAGTTTATTTTGCTGTGTGGAGG + Intronic
993421800 5:87712140-87712162 TATTTCATTTAGCTGTGTTTGGG + Intergenic
993631529 5:90292152-90292174 TACTTCATTTAGCTCCATCATGG + Intergenic
1008626448 6:53321317-53321339 TGGATCATTTACCTGCATGAAGG + Intronic
1011238505 6:85244737-85244759 TAGTTCATGTAGGTGCTTGTTGG - Intergenic
1013184745 6:107747812-107747834 TAGCTCAGTTAGTTGGGTGAGGG + Intronic
1014549268 6:122770817-122770839 ATGTTCATTTATCTGTGTGATGG + Intergenic
1014817631 6:125953047-125953069 CAGTTCATTGAGCTGCGGGTGGG + Intergenic
1019353553 7:567146-567168 TAGGTCATTTTGCTGTGTGGCGG - Intronic
1036192766 8:6685945-6685967 TATTTCAGTTAGCTGCATTAGGG - Intergenic
1042776099 8:72433004-72433026 TAGTTCATTTCGTTGTTTGAAGG - Intergenic
1043157479 8:76802046-76802068 AAGTCCATATAGCTGCTTGAGGG + Intronic
1044722683 8:95166197-95166219 TCATTCATTCACCTGCGTGAGGG + Intergenic
1044825733 8:96195183-96195205 TAGCTGAGTTAGCTGCTTGAGGG + Intergenic
1047011389 8:120676572-120676594 TAGTTCATTTAGCTAAATGCTGG + Intronic
1048339965 8:133530855-133530877 GTCTTCATTTAGCTGCCTGATGG - Intronic
1050621637 9:7458851-7458873 TAGATCATTTAGCTGCCTGGTGG - Intergenic
1056653627 9:88490641-88490663 TAGTTCTTTAACCTGAGTGATGG - Intergenic
1057492527 9:95532372-95532394 TAGTTCAGTGAGCTGTGTGTTGG + Intergenic
1194801901 X:98284201-98284223 AAGTGCATTTAGCTGTGTGGTGG - Intergenic
1201377094 Y:13334297-13334319 TAGTTTCTTTTGCTGCGTGTTGG - Intronic
1201530841 Y:14988433-14988455 TAGTTCTGTTAGCTGGGTGCTGG - Intergenic