ID: 1139757780

View in Genome Browser
Species Human (GRCh38)
Location 16:69158896-69158918
Sequence GGCAACACGACAACTAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139757780_1139757784 11 Left 1139757780 16:69158896-69158918 CCCACACTAGTTGTCGTGTTGCC 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1139757784 16:69158930-69158952 AAGTCTCTAGATGACAAAGATGG 0: 1
1: 0
2: 2
3: 13
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139757780 Original CRISPR GGCAACACGACAACTAGTGT GGG (reversed) Intronic
901804941 1:11732628-11732650 TGCCACACGACAACTACTGTTGG + Intergenic
1074492688 10:113953417-113953439 GGTAACAGGACAACAAGGGTAGG - Intergenic
1097833355 12:64248986-64249008 GCCAACACAAAAACTTGTGTAGG - Intergenic
1110555566 13:76855741-76855763 GGCAAAAAGACAAATACTGTTGG + Intergenic
1113206106 13:107918119-107918141 TGCAACAGGAAAACAAGTGTTGG - Intergenic
1119967496 14:78933142-78933164 GGCAACACACAATCTAGTGTTGG - Intronic
1131613202 15:93986629-93986651 AGCAACAGGACAACAAATGTTGG - Intergenic
1136103911 16:28015195-28015217 GGCAACACCATATCTAATGTGGG + Intronic
1139757780 16:69158896-69158918 GGCAACACGACAACTAGTGTGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1153939246 18:9963196-9963218 GGCAGCAGGACAAACAGTGTGGG + Intergenic
1156356187 18:36343006-36343028 GGGCAAACAACAACTAGTGTTGG + Intronic
936973585 2:118197633-118197655 GGCTACATGATAACTGGTGTGGG + Intergenic
1169474196 20:5916227-5916249 GGAAAAACAACAACTAATGTGGG + Intronic
965898158 3:173604573-173604595 GACAACTAGACAACTAATGTGGG + Exonic
968764262 4:2459849-2459871 TGCAACACTACACCTTGTGTGGG - Intronic
977349913 4:95870172-95870194 GGCAACATCACAGCTAGTGAAGG + Intergenic
978016471 4:103752358-103752380 TGCAACAGGTCAATTAGTGTTGG + Intergenic
989462137 5:41712996-41713018 GGAGACAGGACAACTAGAGTAGG + Intergenic
995099614 5:108283442-108283464 GGCAAAAAGACAAATAGTGCTGG + Intronic
1004407594 6:15348767-15348789 TGCAACAGGAGAACTAGCGTGGG + Intronic
1016983909 6:149879968-149879990 TTCAACAGGATAACTAGTGTGGG - Intergenic
1024435846 7:49353932-49353954 GGGAACTTGACAACTAGAGTTGG + Intergenic
1046317272 8:112520995-112521017 AGCAACACAAGAACTAGGGTTGG - Intronic
1048247663 8:132826321-132826343 GGCAACTACACAACTACTGTGGG + Intronic
1048632483 8:136259191-136259213 GGCAACACCTAAACTAGTGTTGG - Intergenic
1052552840 9:29972536-29972558 GGCAACACGAATACATGTGTTGG - Intergenic
1053779501 9:41590481-41590503 GACAACATGACAACTTTTGTAGG - Intergenic
1054167457 9:61800722-61800744 GACAACATGACAACTTTTGTAGG - Intergenic
1054670085 9:67780178-67780200 GACAACATGACAACTTTTGTAGG + Intergenic
1186515719 X:10165012-10165034 GGCAACAAGGGAACAAGTGTGGG - Intronic
1195911559 X:109893086-109893108 GGCAACACCACTATTAGTGAAGG - Intergenic