ID: 1139759880

View in Genome Browser
Species Human (GRCh38)
Location 16:69176317-69176339
Sequence CTCGAGTAGCTAGGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139759880_1139759886 8 Left 1139759880 16:69176317-69176339 CCTGTGTTTCCTAGCTACTCGAG 0: 1
1: 0
2: 1
3: 26
4: 237
Right 1139759886 16:69176348-69176370 GTGGGAGACTTGCTTGAGCCTGG 0: 2
1: 353
2: 4095
3: 13753
4: 59855
1139759880_1139759887 9 Left 1139759880 16:69176317-69176339 CCTGTGTTTCCTAGCTACTCGAG 0: 1
1: 0
2: 1
3: 26
4: 237
Right 1139759887 16:69176349-69176371 TGGGAGACTTGCTTGAGCCTGGG 0: 4
1: 339
2: 4724
3: 21454
4: 72610
1139759880_1139759889 18 Left 1139759880 16:69176317-69176339 CCTGTGTTTCCTAGCTACTCGAG 0: 1
1: 0
2: 1
3: 26
4: 237
Right 1139759889 16:69176358-69176380 TGCTTGAGCCTGGGAGGTTGAGG 0: 655
1: 3014
2: 17397
3: 57273
4: 114126
1139759880_1139759885 -10 Left 1139759880 16:69176317-69176339 CCTGTGTTTCCTAGCTACTCGAG 0: 1
1: 0
2: 1
3: 26
4: 237
Right 1139759885 16:69176330-69176352 GCTACTCGAGAGGCTGAGGTGGG 0: 471
1: 12627
2: 142155
3: 287664
4: 191799
1139759880_1139759888 12 Left 1139759880 16:69176317-69176339 CCTGTGTTTCCTAGCTACTCGAG 0: 1
1: 0
2: 1
3: 26
4: 237
Right 1139759888 16:69176352-69176374 GAGACTTGCTTGAGCCTGGGAGG 0: 6
1: 1343
2: 26557
3: 75391
4: 150859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139759880 Original CRISPR CTCGAGTAGCTAGGAAACAC AGG (reversed) Intronic
900271582 1:1792571-1792593 CCCGAGTAGCTGGGAACTACAGG - Intronic
903787747 1:25872635-25872657 CTTGAGTAGTTGGGAATCACAGG + Intergenic
904822103 1:33252225-33252247 CCCGAGTAGCTGGGAATTACAGG - Intergenic
905624441 1:39478324-39478346 CTTGAGGAGGAAGGAAACACTGG + Intronic
907287768 1:53392974-53392996 CCCGAGTAGCTGGGAACTACAGG - Intergenic
908052514 1:60248166-60248188 CTCCCGTAGCTAGGATTCACAGG + Intergenic
908322785 1:62994324-62994346 CTAGAATAGCTATGAAACACAGG + Intergenic
909618941 1:77645844-77645866 CCCGAGTAGCTGGGAATTACAGG - Intronic
912357195 1:109064031-109064053 CTCGAGTAGCTGGGAAGTACAGG - Intronic
913023166 1:114807546-114807568 CTCGAGTAGCTGGGGACGACAGG - Intergenic
914724153 1:150313344-150313366 CTCGAGTAGCTGGGATTAACAGG + Intergenic
915441641 1:155949126-155949148 CTCGAGTAGCTGGGATTTACAGG - Intronic
915612929 1:157009405-157009427 CTTGAGGAGTTAGGAGACACAGG + Intronic
917157545 1:172020597-172020619 CCCGAGTAGCTGGGAACTACAGG - Intronic
917759146 1:178136432-178136454 ATAGAGTATCTAAGAAACACTGG - Intronic
920503913 1:206502985-206503007 CTTGGTTAGCTATGAAACACAGG - Intergenic
921637472 1:217513164-217513186 CTCGAGTAGCTTGGGACTACAGG - Intronic
1063410263 10:5831834-5831856 CTGGAGTAGCTGGGAATAACAGG + Intronic
1063959821 10:11297855-11297877 CCCGAGTAGCTGGGAACCACAGG - Intronic
1064115074 10:12570825-12570847 CCTGAGTAGCTGGGAAGCACAGG - Intronic
1065719181 10:28609236-28609258 CCCGAGTAGCTGGGATTCACAGG - Intronic
1066804216 10:39227711-39227733 ATTCAGTAGTTAGGAAACACTGG + Intergenic
1066809885 10:39315816-39315838 ATTGAGTAGTTTGGAAACACTGG - Intergenic
1067498561 10:46781166-46781188 CGTGAGTAGCTAGGAAATACAGG - Intergenic
1068388345 10:56360384-56360406 CTGGAGGGGCAAGGAAACACAGG + Intronic
1068694438 10:59950852-59950874 CTCGAGTAGCTGGGGACTACAGG + Intergenic
1069115797 10:64504937-64504959 CCCGAGTAGCTGGGAATTACAGG + Intergenic
1069732231 10:70624674-70624696 CCCGAGTAGCTGGGAACTACAGG + Intergenic
1070232265 10:74580908-74580930 CTCAAGTAGCTAGAAACTACAGG - Intronic
1072545691 10:96435766-96435788 CTCGAGAAGCTAGGAAAGGATGG - Intronic
1072711814 10:97720634-97720656 CTCGAGTAGCTGGGGACTACAGG - Intergenic
1073370216 10:102981512-102981534 CCCGAGTAGCTGGGACCCACAGG + Intronic
1073582171 10:104678657-104678679 CTCTACTGGCTAGGAAATACTGG - Intronic
1080069158 11:28058535-28058557 CACAAGTAGCTAGGAATTACAGG - Intronic
1080469624 11:32532471-32532493 CTCCAGTAGCTAGGATTTACAGG + Intergenic
1080950258 11:37024106-37024128 CACGAGAAGCTAGGAAAGAGGGG + Intergenic
1081098216 11:38967523-38967545 CCCGAGTAGCTGGGAACTACAGG - Intergenic
1082010061 11:47443803-47443825 CTTGAGTAGCTTGGAACTACAGG - Intronic
1082049476 11:47759041-47759063 CCCGAGTAGCTAGGATTAACAGG + Intronic
1083559322 11:63659810-63659832 CCCGAGTAGCTAGGACTTACAGG - Intronic
1084076437 11:66781659-66781681 CTTGAGTAGCTAGGACCCACAGG + Intronic
1084404305 11:68962131-68962153 CTCTAGAAGCTGGGAAAGACAGG + Intergenic
1084520851 11:69661797-69661819 CCCGAGTAACTGGGAAATACAGG + Intronic
1088254961 11:107894771-107894793 CTCGGGTAGCTAGCTAGCACAGG - Intronic
1089215837 11:116834239-116834261 CTAGGGTAGCTAAGATACACTGG + Intergenic
1089595088 11:119573421-119573443 CACGAGTAGCTTGGGACCACAGG + Intergenic
1090050080 11:123370189-123370211 CTCAAGTAGCTAGGACTTACAGG - Intergenic
1090081275 11:123614489-123614511 CCCATGTAGCTAGGATACACAGG - Intronic
1091896322 12:4108097-4108119 CCCGAGTAGCTTGGGACCACAGG - Intergenic
1092615251 12:10211024-10211046 CTCGAGTAGCTGGGGACTACAGG + Intergenic
1094216012 12:27943567-27943589 CCTGAGTAGCTAGGACCCACAGG + Intergenic
1094862994 12:34491549-34491571 GTTGAGTAGTTTGGAAACACTGG - Intergenic
1095076600 12:37936138-37936160 ATGGAGCAGCTTGGAAACACTGG - Intergenic
1095995697 12:48082011-48082033 CCCGAGTAGCTAGGACTTACAGG + Intronic
1098267879 12:68740920-68740942 CCCAAGTAGCTAAGAACCACAGG - Intronic
1102383987 12:112491828-112491850 CTCGAGTAGCTGGAGACCACAGG + Intronic
1102934539 12:116885308-116885330 CCTGAGTAGCTGGGAACCACAGG - Intergenic
1102990280 12:117310767-117310789 CCTGAGTAGCTAGGAACTACAGG + Intronic
1103171111 12:118820863-118820885 CCTGAGTAGCTGGGAACCACAGG + Intergenic
1103357077 12:120329614-120329636 CTCGTGTAGCTGGGAATTACAGG + Intergenic
1104467535 12:129003112-129003134 CTCAAGTAGCTGGGGACCACAGG + Intergenic
1105382880 13:19903722-19903744 CCCAAGTAGCTGGGAACCACAGG - Intergenic
1106891735 13:34253496-34253518 CCTGAGTAGCTAGGATACAAGGG - Intergenic
1107224844 13:38035544-38035566 CTCAAGTAGCTGGGAAATACAGG - Intergenic
1108291746 13:48968570-48968592 CTCGTGTAGCTTGGGAAAACGGG + Intergenic
1109159986 13:58959294-58959316 CTCGAGTAGCTGGGGATTACAGG - Intergenic
1111298787 13:86319154-86319176 CTCTACTAGCTAGGTAACATTGG - Intergenic
1112468682 13:99668459-99668481 CCCGAGTAGCTGGGATTCACAGG - Intronic
1115685880 14:35795857-35795879 CCCGAGTAGCTGGGAACTACAGG - Intronic
1115698287 14:35923896-35923918 CCCGAGTAGCTGGGATCCACAGG - Intronic
1118187471 14:63550480-63550502 CCTGAGTAGCTAGGACACACAGG - Intergenic
1118795413 14:69139373-69139395 CCCAAGTAGCTAGGACACATAGG - Intronic
1119232000 14:72987441-72987463 CTCAAGTAGCTAGGACTAACAGG - Intronic
1121367003 14:93322235-93322257 CTCGAATAGCTAAGAACTACAGG + Intronic
1121558771 14:94858646-94858668 CCCAAGTAGCTAGGACTCACAGG - Intergenic
1121628009 14:95400760-95400782 CCCGAGTAGCTGGGAACTACAGG - Intergenic
1122591202 14:102852823-102852845 CTTGAGTAGCTAGGACTCACAGG + Intronic
1122623438 14:103072403-103072425 CCCGAGTAGCTGGGAACTACAGG - Intergenic
1124267449 15:28249769-28249791 CCCGAGTAGCTGGGAATTACAGG + Intronic
1125952057 15:43760651-43760673 CCCGAGTAGCTCGGGACCACAGG + Intronic
1125958851 15:43811630-43811652 CCCGAGTAGCTGGGAATAACAGG + Intronic
1126620917 15:50638808-50638830 CCCAAGTAGCTAGGAGGCACAGG + Intronic
1128310453 15:66628631-66628653 CTCCAGGAGGTAGGAAAGACAGG + Intronic
1134302846 16:13007082-13007104 CTCTAGTATCTAGAATACACTGG - Intronic
1135385516 16:22036248-22036270 CTCGAGTAGCTGGGAACCATAGG + Intronic
1136046708 16:27620967-27620989 CTTAAGCAGCTAGGAAACACTGG + Intronic
1136351576 16:29712035-29712057 CCCAAGTAGCTAGGATTCACAGG + Intergenic
1136399176 16:30008626-30008648 CTCGAGTAGCTGGGATTTACAGG + Intronic
1136685014 16:31988895-31988917 CTGGAGGAGCCAGGAAGCACTGG + Intergenic
1136785626 16:32932430-32932452 CTGGAGGAGCCAGGAAGCACTGG + Intergenic
1136884143 16:33921374-33921396 CTGGAGGAGCCAGGAAGCACTGG - Intergenic
1137970796 16:52982915-52982937 CCCAAGTAACTAGGAAATACTGG - Intergenic
1138139606 16:54557001-54557023 CCCAAGTAGCTGGGATACACAGG + Intergenic
1138485451 16:57339987-57340009 CTCTAGTAGCTAGGGGCCACAGG + Intergenic
1138708303 16:58940296-58940318 CTCGAGTAGCTTGGGACTACAGG + Intergenic
1139604768 16:68010252-68010274 CCTGAGTAGCTAGGGACCACAGG + Intronic
1139759880 16:69176317-69176339 CTCGAGTAGCTAGGAAACACAGG - Intronic
1139812147 16:69629891-69629913 CCTGAGTAGCTGGGAACCACAGG + Intronic
1143537063 17:7547951-7547973 CCCGAGTAGCTGGGAACTACAGG + Intergenic
1144515116 17:15912087-15912109 CCTGAGTAGCTGGGAATCACAGG - Intergenic
1146194114 17:30796846-30796868 CTCGAGTAGCTGGGACTTACAGG + Intronic
1146265070 17:31447338-31447360 CCCAAGTAGCTGGGACACACAGG - Intronic
1146732756 17:35209333-35209355 CCTGTGTAGCTGGGAAACACAGG - Intergenic
1148077238 17:44945183-44945205 CCTGAGTAGCTGGGAATCACAGG + Intronic
1148664783 17:49366234-49366256 CCTGAGTAGCTAGGGACCACAGG + Intergenic
1148704313 17:49615636-49615658 CAGGAGTAGCTGGGAACCACAGG + Intronic
1150077207 17:62202732-62202754 CCCGAGTAGCTGGGAACCACAGG + Intergenic
1152977449 18:236478-236500 CCCGAGTAGCTGGGAACTACAGG + Intronic
1153383786 18:4469499-4469521 CTCGAGTAGTTGGGGAAAACGGG + Intergenic
1154473203 18:14724777-14724799 CCCGAGTAGCTGGGAATTACAGG + Intergenic
1154952329 18:21222493-21222515 CTCGAGTAGCTGGGGACTACAGG + Intergenic
1155040069 18:22057499-22057521 CCCGAGTAGCTGGGAATCACAGG - Intergenic
1156675470 18:39522549-39522571 CCCGAGTAGCTAGGAACTACAGG + Intergenic
1156806515 18:41189256-41189278 CTCAAGTAGCTGGGAATTACAGG + Intergenic
1157651763 18:49340073-49340095 CTCGAGTAGCTGTGAACTACAGG + Intronic
1157654391 18:49370640-49370662 CCCGAGTAGCTGGGAATCACAGG - Intronic
1158199453 18:54923834-54923856 CTTGAGTAGCTGGGAATTACAGG + Intronic
1161572660 19:5038934-5038956 TTCTAGGAGCTAGGAAACACTGG - Intronic
1162388064 19:10372416-10372438 CCTGAGTAGCTGGGAAATACAGG + Intronic
1162999598 19:14358266-14358288 CCCAAGTAGCTGGGAACCACAGG + Intergenic
1163433098 19:17280010-17280032 CTCAAGTAGCTGGGAATCACAGG - Intronic
1164338777 19:24364173-24364195 ATTGAGTAGTTTGGAAACACTGG + Intergenic
1166830631 19:45637601-45637623 CCAGAGTAGCTGGGAACCACAGG + Intronic
1167995760 19:53400954-53400976 CCCAAGTAGCTGGGAACCACAGG + Intronic
1168368922 19:55814782-55814804 CTGGATTATCTAGGACACACGGG + Intronic
926032830 2:9607323-9607345 CTCGAGTAGCTGGGACTAACAGG + Intronic
927193166 2:20530968-20530990 CCCGAGTAGCTGGGAACTACAGG + Intergenic
932287777 2:70551491-70551513 CTCGGGTAGCGATGGAACACTGG + Intronic
933751330 2:85603714-85603736 CCCGAGTAGCTGGGAACTACAGG + Intronic
933861020 2:86467899-86467921 CTCCAGTAGCTAGGAATAACAGG - Intronic
936603948 2:113929264-113929286 CCTGAGTAGCTAGGACACACAGG + Intronic
938709745 2:133966009-133966031 CTCCTGTAGCCAGGAAGCACAGG + Intergenic
939160116 2:138577641-138577663 CTTAAGAAGCTAGGAAACAAAGG - Intergenic
940059922 2:149553672-149553694 CCTGAGAAGCTAGGAAGCACAGG - Intergenic
940713304 2:157188564-157188586 CTTGAGTAGTTATGAAAAACTGG - Intergenic
942910815 2:181242165-181242187 CCCAAGTAGCTGGGAAATACAGG - Intergenic
945126704 2:206519888-206519910 CCCAAGTAGCTGGGAACCACAGG - Intronic
945420735 2:209633060-209633082 ATCGAGTAGAAAGGAAAGACTGG - Intronic
945883850 2:215354150-215354172 CCCGAGTAGCTGGGGACCACAGG + Intergenic
947696046 2:232190207-232190229 CCTGAGTAGCTGGGAACCACAGG - Intronic
1169233678 20:3911457-3911479 CCCGAGTAGCTGGGATTCACAGG - Intronic
1171522981 20:25789531-25789553 CCTGAGTAGCTGGGATACACAGG + Intronic
1171553846 20:26066352-26066374 CCTGAGTAGCTGGGATACACAGG - Intergenic
1172844949 20:37924427-37924449 CTCGAGTAGCTTGGGATTACAGG - Intronic
1172968095 20:38853072-38853094 CTCGATTAGAAAGGAAACAGTGG - Intronic
1173605433 20:44327679-44327701 CCTGAGTAGCTGGGAATCACAGG + Intergenic
1174239433 20:49121281-49121303 CCCGAGTAGCTGGGATTCACGGG - Intronic
1174535829 20:51250769-51250791 CCCAAGTAGCTAGGAACTACAGG + Intergenic
1174841348 20:53904261-53904283 CTTGAGTAGCTGGGAACTACAGG + Intergenic
1177805864 21:25874097-25874119 ACCGAGTAGCTAGGAATCACAGG + Intergenic
1178290850 21:31366739-31366761 CCCGAGTAGCTGGGAATTACAGG + Intronic
1179127599 21:38604127-38604149 CCCGAATAGCTGGGAACCACAGG - Intronic
1183012161 22:34955726-34955748 CCCGAGTAGCTGGGAACTACAGG - Intergenic
1184127387 22:42497299-42497321 CCCGAGTAGCTTGGAATGACAGG - Intergenic
952168110 3:30773982-30774004 CCAGAGGAGTTAGGAAACACTGG - Intronic
952831980 3:37572707-37572729 CTTGAGTAGGTAGGAAACTAAGG - Intronic
955168002 3:56534357-56534379 CTTGAGTAGCTGGGGACCACAGG + Intergenic
959688120 3:109169804-109169826 CTAGAGTTGTTATGAAACACAGG - Intergenic
960714947 3:120565658-120565680 GAAGAGTAGCTAGGAAACACAGG + Intergenic
960925895 3:122794954-122794976 CGCGGGTGGCGAGGAAACACCGG - Exonic
961253602 3:125526898-125526920 CTCGAGTAGCTGGGACTAACAGG + Intergenic
962586951 3:136851371-136851393 CCCGAGTAGCTGGGAACTACAGG - Intronic
964521502 3:157574096-157574118 TTCAGGAAGCTAGGAAACACTGG - Intronic
966719643 3:183049445-183049467 CCCGAGTAGCTGGGAACTACAGG - Intronic
966803353 3:183785362-183785384 CCCGAGTAGCTAGGACTTACAGG - Intronic
968628942 4:1640384-1640406 CTTTAGTTGCTAGGAAACCCCGG - Exonic
968738098 4:2309541-2309563 ATCAAGTACCTAGGAAACTCAGG - Intronic
971830612 4:31687800-31687822 CTCCAATAGCTAGGTAACAAAGG + Intergenic
973378634 4:49304708-49304730 GGAGAGTAGCTGGGAAACACAGG + Intergenic
973379584 4:49310946-49310968 GGAGAGTAGCTGGGAAACACAGG - Intergenic
974760241 4:66265772-66265794 CCAGAGTAGCTGGGACACACAGG + Intergenic
976499819 4:85774736-85774758 CTCCAGCAGCTAGGAATGACAGG - Intronic
978341377 4:107724120-107724142 CTCCCGTAGCCAGGAATCACGGG - Intergenic
978660181 4:111117251-111117273 CCCGAGTAGCTTGGAACTACAGG + Intergenic
978887654 4:113784234-113784256 CCCGAGTAGCTGGGAATTACAGG - Intergenic
979116351 4:116829430-116829452 CTCTATCAGCCAGGAAACACTGG - Intergenic
979165770 4:117528462-117528484 CCCGAGTAGCTGGGGAATACAGG + Intergenic
981235145 4:142406573-142406595 TTCAAATAGCTAGGCAACACTGG + Intronic
981710070 4:147700583-147700605 CTTGAGTAGCTAGGGACTACAGG - Intergenic
981863334 4:149383280-149383302 CTCCAGTATCTAGGAAACTTAGG + Intergenic
984532107 4:180929135-180929157 CTCCAGTAGCTAGGGAAGAAAGG + Intergenic
989394192 5:40935742-40935764 CTAGAGTACCAAGGAAGCACTGG - Intronic
989504861 5:42215672-42215694 ATCCAGGAGCTAGGAAACATGGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
995259211 5:110082288-110082310 TTAGAGTAGCTTGAAAACACTGG + Intergenic
996674292 5:126156731-126156753 CCCGAGTAGCTGGGAATTACAGG + Intergenic
996844557 5:127884958-127884980 CTGGTGTAGTTAGAAAACACTGG - Intergenic
998530535 5:142880391-142880413 CCCGAGTAGCTGGGAACTACAGG - Intronic
1002121013 5:177005016-177005038 CCCGAGAAGCTGGGAACCACAGG + Intronic
1002121726 5:177009909-177009931 CTCGAGTAGCTGGGACTTACTGG - Intronic
1002420345 5:179143307-179143329 TCCGAGTAGCTGGGAATCACAGG - Intronic
1003604566 6:7547550-7547572 CTCGAGTAGCTTGGGACCACAGG + Intronic
1003614303 6:7641448-7641470 CTCCTGTAGATAGAAAACACAGG + Intergenic
1005679377 6:28190663-28190685 CCCAAGTAGCTGGGAACCACAGG - Intergenic
1008386831 6:50901483-50901505 CTTGAGTAGCTGGGATTCACAGG + Intergenic
1008740100 6:54596464-54596486 CTCTAGAAGCTAGAAAAGACAGG - Intergenic
1010211288 6:73364271-73364293 CTCGGGCGGCTAGGAACCACAGG - Intergenic
1010237788 6:73589633-73589655 CCCGAGTAGCTGGGAACTACAGG + Intergenic
1012262348 6:97102305-97102327 ATGCAGTAGCTAGGAAACAATGG + Intronic
1013216782 6:108034742-108034764 CCCGAGTAGCTGGGAACCACAGG + Intergenic
1014811952 6:125896665-125896687 CTTGAGTAGCTGGGAACTACAGG - Intronic
1015401969 6:132797471-132797493 CCCGAGTAGCTGGGATACAGGGG - Intronic
1015616381 6:135079535-135079557 CCAGAGTAGCTGGGAAATACAGG - Intronic
1017842137 6:158231206-158231228 CCCGAGTAGCTAGGGACTACAGG - Intergenic
1018021228 6:159763417-159763439 CTCCAGTAGCTGGGAGGCACAGG - Intronic
1019213501 6:170424599-170424621 CTGGAGCAGCCAGGAACCACGGG - Intergenic
1019442787 7:1055878-1055900 CTTGAGTCCCCAGGAAACACAGG - Intronic
1019991186 7:4692518-4692540 CCCGAGTAGCTGGGATAAACAGG + Intronic
1020044745 7:5032464-5032486 CTTGAGTAGCTAGGACTAACAGG - Intronic
1020066923 7:5195359-5195381 CCCGAGTAGCTGGGGACCACAGG - Intronic
1020273679 7:6612358-6612380 CCCGAGTAGCTGGGAACTACAGG - Intergenic
1020290098 7:6716489-6716511 CTTGAGTAGCTAGGACTAACAGG - Intergenic
1021231851 7:18094553-18094575 CCCAAGTAGCTAGGACTCACAGG + Intronic
1022162494 7:27725797-27725819 CCCAAGTAGCTGGGAAATACAGG + Intergenic
1023651300 7:42371812-42371834 CCTGAGTAGCTGGGAATCACAGG - Intergenic
1025625669 7:63219051-63219073 CCCAAGTAGCTAGGAACTACAGG + Intergenic
1027153481 7:75749886-75749908 CCCGAGTAGCTGGGATACAGGGG - Intergenic
1027198916 7:76050151-76050173 CCCGAGTAGGTGGGAATCACAGG + Intronic
1031784501 7:126012496-126012518 CTCTAGTAGCTAAGTAGCACTGG + Intergenic
1031931542 7:127691007-127691029 CTGGAGTAGCTAGGCAACGCTGG - Intronic
1032815569 7:135470252-135470274 CCTGAGTAGCTAGGACCCACGGG + Intronic
1034041137 7:147877886-147877908 TTCGAGCAGCCAGCAAACACTGG - Intronic
1034144704 7:148858647-148858669 CTCGAGTAGCTGGGGACTACAGG + Intronic
1034147648 7:148886201-148886223 CCCGAGTAGCTGGGGACCACAGG + Intergenic
1034782192 7:153890813-153890835 CTCGAGTAGCTGGGGACTACAGG + Intronic
1035897178 8:3416175-3416197 CCCGAGTAGCTGGGAATTACAGG - Intronic
1036214063 8:6864546-6864568 CTGTAATGGCTAGGAAACACCGG - Intergenic
1036556885 8:9867928-9867950 CTCGAGTAGCTGGGAAGTATAGG + Intergenic
1036598874 8:10240735-10240757 CTAGAGTGGCCAGGAAAGACAGG - Intronic
1037527189 8:19738100-19738122 CTCGAGTAGCTGAGAATTACAGG - Intronic
1038796986 8:30718850-30718872 CTCGGGAAGCTAAGAATCACTGG - Intronic
1039006048 8:33038320-33038342 CTAGTGTTGGTAGGAAACACAGG - Intergenic
1039188832 8:34948935-34948957 CTCGGGTAATTAGAAAACACAGG - Intergenic
1044706419 8:95013221-95013243 CTTGAGTAGCTAGGAAGTACAGG + Intronic
1044856397 8:96480460-96480482 CTCCAGTAGCTAGGGATTACAGG + Intergenic
1047817420 8:128479944-128479966 CTCAAGCAGCTAGGAAGCCCTGG - Intergenic
1047966838 8:130051238-130051260 CCCGAGTAGCTGGGAATCACAGG + Intergenic
1048339279 8:133526243-133526265 CTCTAGTGTCTAGGAGACACAGG - Intronic
1049077399 8:140410014-140410036 CCCAAGTAGCTGGGAATCACAGG - Intronic
1051922926 9:22288710-22288732 TTTGAGTAGAAAGGAAACACAGG - Intergenic
1052962555 9:34312820-34312842 CCTGAGTAGCTAGGATTCACAGG + Intronic
1053195110 9:36111516-36111538 CCCAAGTAGCTAGGAACGACAGG + Intronic
1053204879 9:36177594-36177616 CCTGAGTAGCTAGGACTCACAGG - Intergenic
1053248280 9:36553268-36553290 CTCGAGTAGCTGGGGATTACAGG - Intergenic
1053460211 9:38262856-38262878 CTCGAGTAGCTAGGAATTACAGG - Intergenic
1057782087 9:98058045-98058067 CCCGAGTAGCTGGGACCCACAGG + Intronic
1057932060 9:99202375-99202397 GTCAAGTAGCTTGGATACACTGG + Intergenic
1059464146 9:114456424-114456446 CTTAAGTAGCTGGGAAACATTGG + Intronic
1061612991 9:131760845-131760867 CCCGAGTAGCTAGGATTCCCGGG + Intergenic
1062429470 9:136520611-136520633 CTCAAGTAGCTTGGGACCACAGG - Intronic
1186424100 X:9449800-9449822 CCCAAGTAGCTGGGAACCACAGG + Intergenic
1186984425 X:14996643-14996665 CTGGAGTAGCTCTGTAACACAGG - Intergenic
1187193643 X:17060176-17060198 CCCGAGTAGCTGGGGACCACAGG - Intronic
1187333424 X:18361430-18361452 CTCGAGTAGCTTGGGACTACAGG - Intergenic
1192339055 X:70247214-70247236 CTCGAGTAGCTAGGACAATTGGG - Intergenic
1192407608 X:70902124-70902146 CTTGAGTAGCCGGGAATCACAGG - Intronic
1192478495 X:71464579-71464601 CCCGAGTAGCTAGGATTAACAGG - Exonic
1194391994 X:93330371-93330393 CTTGAGTAGCTGGGATTCACAGG + Intergenic
1194457422 X:94122641-94122663 CCTGAGTAGCTGGGAATCACAGG + Intergenic
1194974754 X:100382646-100382668 CTCCATTAGCTAGGAAGCTCTGG - Intronic
1196752804 X:119132753-119132775 CTTGAGTAGCTAGGACTTACAGG + Intronic
1197405353 X:126041625-126041647 CTCCTATAGCTAGGATACACAGG + Intergenic
1197606765 X:128594402-128594424 CTCCAGTAGCTGGGAACTACAGG + Intergenic
1198052593 X:132963058-132963080 CCCGAGTAGCTTGGAACCACAGG - Intergenic
1201474655 Y:14367209-14367231 CCCCAGGAGCTAGGACACACAGG + Intergenic