ID: 1139765337

View in Genome Browser
Species Human (GRCh38)
Location 16:69223918-69223940
Sequence GAAGAACTGTCGGCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 11, 3: 119, 4: 728}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139765337_1139765342 24 Left 1139765337 16:69223918-69223940 CCACACCCGGCCGACAGTTCTTC 0: 1
1: 0
2: 11
3: 119
4: 728
Right 1139765342 16:69223965-69223987 TTGACACTTTAGAAGAATACTGG 0: 1
1: 2
2: 72
3: 253
4: 726

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139765337 Original CRISPR GAAGAACTGTCGGCCGGGTG TGG (reversed) Intronic
900152894 1:1187134-1187156 AAAGAACTTTTGGCCGGGCGCGG - Intronic
900194592 1:1369443-1369465 GAAAAACAGTTGGCTGGGTGCGG - Intergenic
900228974 1:1546500-1546522 GAAGAGCTCGAGGCCGGGTGCGG + Intronic
900248901 1:1655631-1655653 AAAGAACTTTTGGCCGGGTGTGG + Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
901043471 1:6380307-6380329 AAACACCTTTCGGCCGGGTGTGG + Intronic
901382221 1:8882050-8882072 AAAGAAATGGAGGCCGGGTGCGG + Intergenic
901466460 1:9424647-9424669 AAAGAACTGGAGGCCAGGTGTGG + Intergenic
901487469 1:9574921-9574943 GAACCCCTGTAGGCCGGGTGCGG + Intronic
901806622 1:11742818-11742840 AAAGAACTGTGGGCCAGGTCTGG - Intronic
902302208 1:15510218-15510240 GAAAAAATGTAGGCCGGGCGTGG - Intronic
902461438 1:16580336-16580358 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
902462223 1:16586635-16586657 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
902505492 1:16937062-16937084 GCAGAACTTGTGGCCGGGTGTGG + Intronic
902588769 1:17458546-17458568 GACGAAGTCTCGGCCGGGCGCGG - Intergenic
903596581 1:24500105-24500127 CAAGAAATGGAGGCCGGGTGCGG + Intergenic
903653766 1:24936470-24936492 GAAGAACTGTGGGCAGGATTCGG + Intronic
903713654 1:25346076-25346098 GAAAACATATCGGCCGGGTGTGG - Intronic
903789448 1:25882511-25882533 TAAGAACTTCAGGCCGGGTGCGG + Intergenic
903837637 1:26215876-26215898 CAAGGACTCTCCGCCGGGTGTGG - Intergenic
903860316 1:26360712-26360734 GAAGCACTTACGGCCGGGAGCGG + Intergenic
904085065 1:27900400-27900422 AAAGAGCTGTTGGCCAGGTGCGG - Intronic
904162073 1:28529472-28529494 GAAAAACAGACGGCCAGGTGTGG - Intronic
904229945 1:29060932-29060954 GAAGAACTGTCGGGGAGGGGCGG + Intronic
905163330 1:36057028-36057050 AAAGAATAGTAGGCCGGGTGCGG - Exonic
905952412 1:41963299-41963321 GAAAAACTTTTGGCCGGGCGCGG - Intronic
906100992 1:43261508-43261530 TAAGAGCTGTAGGCCAGGTGTGG + Intronic
907156944 1:52343463-52343485 GAAGTCCTTTGGGCCGGGTGCGG + Intronic
907368803 1:53984334-53984356 AAAGAACTCTTGGCCGGGTGCGG + Intergenic
907390557 1:54155360-54155382 GAAAGACTGTCGGCCGGGTGCGG + Intronic
908203394 1:61820630-61820652 AAATAAATGTAGGCCGGGTGTGG - Intronic
908525952 1:64987516-64987538 GAAGAATTGTTTGCCTGGTGTGG + Intergenic
908541653 1:65128135-65128157 GAATAACTGTTGGCCGGGTGTGG - Intergenic
908887859 1:68810671-68810693 ACACAGCTGTCGGCCGGGTGCGG - Intergenic
909160011 1:72135084-72135106 AAATAACTTTCGGCCGGGCGTGG + Intronic
909597524 1:77422923-77422945 GAAGTACTGTTGGCTGGGTGCGG + Intronic
910499226 1:87870590-87870612 AAATAATTGTCGGCCGGGCGCGG + Intergenic
910616102 1:89199967-89199989 GAAGAAATTTAGGCTGGGTGTGG + Intergenic
911133875 1:94418654-94418676 AGAGACCTGTCGGCCGGGTGGGG - Intronic
912145995 1:106795186-106795208 AAATAAATGTAGGCCGGGTGTGG + Intergenic
912277786 1:108278757-108278779 TAAGAAGAGTCGGCCGGGCGCGG + Intergenic
912290440 1:108415602-108415624 TAAGAAGAGTCGGCCGGGCGCGG - Intronic
912858736 1:113194104-113194126 AGAGAACCCTCGGCCGGGTGTGG - Intergenic
912985848 1:114429479-114429501 AAAGTACTCTTGGCCGGGTGCGG - Intronic
914084539 1:144440956-144440978 AAAGAGAAGTCGGCCGGGTGCGG - Intronic
914819699 1:151091424-151091446 GATGAACTCTCAGCTGGGTGCGG + Intronic
914821719 1:151109647-151109669 AAAAAACTATAGGCCGGGTGTGG - Intronic
914897236 1:151687656-151687678 TAAAAACTGTCGGCCTGGCGCGG + Intronic
914922189 1:151854680-151854702 GAAGAGGTGTTGGCCGGGTGCGG - Intergenic
915184435 1:154092675-154092697 GAATAACTCTTGGCTGGGTGTGG - Intronic
915295611 1:154919256-154919278 AAACAAAAGTCGGCCGGGTGTGG + Intergenic
915329447 1:155100988-155101010 AAAGAAATATGGGCCGGGTGTGG - Intergenic
915397082 1:155593202-155593224 TAAGAACAGTAGGCCAGGTGCGG - Intergenic
915707945 1:157864232-157864254 TAAGAACTGTGGGCCTGGTGAGG - Intronic
916752258 1:167733964-167733986 AATGCACTGTAGGCCGGGTGCGG + Intronic
916803260 1:168233991-168234013 GAAGACTTATTGGCCGGGTGTGG + Intronic
917427889 1:174934375-174934397 GTACAACTTTCGGCCGGGCGTGG - Intronic
917766743 1:178228289-178228311 AAAAAATTGTGGGCCGGGTGCGG + Intronic
918732041 1:188011095-188011117 AAAGAAATGCCGGCCGGGCGCGG - Intergenic
918977708 1:191512423-191512445 GATGATCTCTCGGCCGGGCGCGG + Intergenic
919452823 1:197790527-197790549 AAAGAAATGTCAGCTGGGTGCGG - Intergenic
919904893 1:202071676-202071698 GAAGAATTATGGGCCGGGCGTGG + Intergenic
920023397 1:202973050-202973072 AAAGAACTCTCAGCCGGGCGTGG - Intergenic
920083398 1:203394786-203394808 AAAGTCCTGTCGGCCAGGTGTGG + Intergenic
920091930 1:203460564-203460586 TATGAATTGTCGGCCGGGCGCGG + Intergenic
920145253 1:203855338-203855360 GCAGAACTGTTGGCTGGGCGTGG - Intergenic
920324223 1:205149189-205149211 AAAAAACTTTCGGCCAGGTGCGG - Intronic
920461378 1:206143306-206143328 TCAGAACTGTCGGTCGGGAGGGG + Intergenic
920577038 1:207069033-207069055 AAAGAAATGTCGGCCGGGCACGG - Intronic
920780613 1:208987558-208987580 AAGGAAATGTGGGCCGGGTGCGG - Intergenic
921644297 1:217595788-217595810 TAAGAAGGATCGGCCGGGTGCGG - Intronic
921656439 1:217744170-217744192 AAAGAATTTTCGGCCGGGCGCGG + Intronic
921866450 1:220092129-220092151 TAGGTACTGTCGGCCAGGTGCGG - Intergenic
922521815 1:226259248-226259270 TAAGTATTGTTGGCCGGGTGTGG - Intronic
923156673 1:231285361-231285383 TAAGAACTGGGGGCTGGGTGTGG + Intergenic
923159863 1:231306689-231306711 GTAGAAAGGTCGGCCGGGCGCGG - Intergenic
923343874 1:233032391-233032413 TGAAAACTGTCGGCTGGGTGCGG - Intronic
923587096 1:235283064-235283086 GAAGTAGTATCGGCCAGGTGCGG - Intronic
924534949 1:244927594-244927616 AAAGCACTGTGGGCCAGGTGCGG - Intergenic
924551457 1:245081757-245081779 AAAGAACACTCGGCCGGGCGTGG - Intronic
924855659 1:247872937-247872959 GATGAACTCTGGGCCGGGCGCGG + Intronic
1063192393 10:3708300-3708322 AAAAAACTCTCGGCCGGGCGCGG - Intergenic
1063232229 10:4076445-4076467 TAAGGACTGTCGGCAGGGTGTGG - Intergenic
1063662001 10:8041248-8041270 CAAGAACTGTAGCCCGGGTGGGG - Intergenic
1063790534 10:9441046-9441068 AAAAAACTTTTGGCCGGGTGCGG + Intergenic
1063996073 10:11621182-11621204 GAAAAAATGTTGGCCGGGCGCGG + Intergenic
1064076594 10:12273776-12273798 TAAGAACGCTTGGCCGGGTGTGG + Intergenic
1065390380 10:25175971-25175993 GAAGACCTGTGGGGCCGGTGCGG - Exonic
1065434579 10:25693822-25693844 GAAAAACTATTGGCCAGGTGTGG - Intergenic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1066084846 10:31966117-31966139 TAACAACTGTCAGCCGGGTGTGG + Intergenic
1066414985 10:35213557-35213579 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1066533440 10:36365131-36365153 GAATAATTATTGGCCGGGTGCGG - Intergenic
1066585480 10:36929801-36929823 TAAAAACTATGGGCCGGGTGTGG + Intergenic
1066691459 10:38032739-38032761 AAACAACTGTCGGCAAGGTGCGG - Intronic
1066705307 10:38171413-38171435 GGATATCTGTGGGCCGGGTGCGG + Intergenic
1067001246 10:42615930-42615952 AAACAATTGTCGGCTGGGTGCGG + Intronic
1067680224 10:48430382-48430404 GAAGAACCTTCGGCCATGTGTGG - Intronic
1067763748 10:49069960-49069982 AAAGAAATATCGGCCGGGCGCGG + Intronic
1068979217 10:63043937-63043959 AAAAAACTGTCGGCCGGGCGCGG + Intergenic
1069369897 10:67736738-67736760 TAAAAAATGTGGGCCGGGTGTGG - Intergenic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069517998 10:69095015-69095037 AAAGTACTTTCGGCCGGGTGTGG + Intronic
1069519048 10:69103227-69103249 GAAGTCCTCTTGGCCGGGTGTGG - Intronic
1069829376 10:71273177-71273199 CAAGCACTGTGGGCCGGGCGCGG - Intronic
1071174749 10:82912933-82912955 AAAGTACTTCCGGCCGGGTGCGG + Intronic
1071588749 10:86850789-86850811 GGAGAACTTTAGGCCAGGTGTGG - Intronic
1072194807 10:93108145-93108167 GAATTATTGGCGGCCGGGTGCGG - Intergenic
1073108971 10:101049588-101049610 GAAGAAATGTGGGCCGGGCTCGG + Intergenic
1073253617 10:102137046-102137068 AAATAAGTGTCGGCCGGGCGTGG + Intronic
1073334598 10:102696552-102696574 AAAAAACTGTTGGCCGGGTGCGG - Intronic
1073372715 10:103005356-103005378 GAAGTACAGTTGGCCAGGTGCGG + Intronic
1073720940 10:106170930-106170952 TAAAAAATGTCGGCTGGGTGTGG - Intergenic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1074057190 10:109933392-109933414 GAAGAAATTTCGGCCAGGCGCGG + Intergenic
1074739153 10:116467833-116467855 AAAGTAATGTCGGCCGGGCGCGG + Intronic
1075152398 10:119945739-119945761 GAAAAAATCTCGGCCGGGCGCGG - Intergenic
1075187692 10:120277718-120277740 TAAGATGTGTCAGCCGGGTGCGG + Intergenic
1075315070 10:121446747-121446769 AAAGAATAGTGGGCCGGGTGTGG + Intergenic
1075775196 10:124978906-124978928 GAAGAATTATCGGCCGGGCCTGG + Intronic
1075897737 10:126012239-126012261 GAAGAATGGTTGGCAGGGTGGGG - Intergenic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1076504585 10:130963365-130963387 GATGAATTGTCGGCAGGGCGCGG + Intergenic
1077097875 11:806871-806893 AAAGATCTCTTGGCCGGGTGCGG - Intronic
1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG + Intronic
1077133896 11:989036-989058 AAATAACTATTGGCCGGGTGTGG + Intronic
1077621049 11:3724139-3724161 AAAGAAATTTCGGCTGGGTGTGG + Intronic
1078208458 11:9250841-9250863 CAAGGACTTCCGGCCGGGTGCGG + Intronic
1078347815 11:10566403-10566425 TAAGAACTGGGGGCCGGGTTGGG - Intronic
1078577556 11:12514774-12514796 TAAGAACAGTCAGCTGGGTGCGG - Intronic
1079048726 11:17133635-17133657 GTAAAACTGGCGGCTGGGTGTGG + Intronic
1080323907 11:31048561-31048583 AAAGGACTGTCGGCTGGGCGCGG + Intronic
1080365295 11:31567221-31567243 GAAGTACTACAGGCCGGGTGCGG - Intronic
1083481773 11:62953040-62953062 AAAGAAATGGGGGCCGGGTGTGG - Intronic
1083795440 11:65014173-65014195 GAAGAAACGGCGGCCGGGAGGGG + Exonic
1083873788 11:65509043-65509065 TAAGAGCAGTCGGCCGGGCGCGG - Intergenic
1084161364 11:67352217-67352239 TAAGAATTATTGGCCGGGTGTGG + Intronic
1084277451 11:68061394-68061416 TAAGAATTGTCAGCCGGGTACGG - Intronic
1084637694 11:70403475-70403497 AAAGAACTCTTGGCCAGGTGAGG - Intronic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1085167582 11:74416972-74416994 GAAGAAATGGGGGCTGGGTGTGG + Intergenic
1086225724 11:84506363-84506385 TAAGAACTGAGGGCCGGGCGCGG - Intronic
1086281626 11:85195814-85195836 AAAACACTGTCGGCCGGGCGCGG - Intronic
1086305232 11:85472586-85472608 GAATAGCTCTCGGCTGGGTGTGG - Intronic
1086618982 11:88861771-88861793 TTAGAACTGTGGGCCAGGTGTGG - Intronic
1086979924 11:93183986-93184008 TAAGAAAAGTTGGCCGGGTGCGG - Intronic
1087406967 11:97742700-97742722 AAAGATATGTTGGCCGGGTGCGG - Intergenic
1087420241 11:97913950-97913972 AAAGAAATATCGGCCGGGCGCGG - Intergenic
1088166139 11:106939867-106939889 GAAGATCTATCGGCTGGATGTGG - Exonic
1088307108 11:108422216-108422238 GAATAAGTGTCGGCCAGGCGCGG - Intronic
1088641518 11:111877895-111877917 TAACAACTGTTGGCCGGGCGTGG + Intronic
1088686386 11:112287607-112287629 AAATAAATGTTGGCCGGGTGCGG + Intergenic
1088936547 11:114406739-114406761 TAAGATCTGAAGGCCGGGTGCGG + Intronic
1089332784 11:117701540-117701562 GAAGAGCTGGCTGCCGGCTGGGG + Intronic
1089514109 11:119020684-119020706 AAAGAACTGTGGGTCGGGTGTGG - Intronic
1090164409 11:124532238-124532260 GAAGGATAATCGGCCGGGTGTGG + Intergenic
1090802741 11:130183248-130183270 TAAGAAATGTAGGCCGGGTGTGG - Intronic
1090819253 11:130326334-130326356 TAAGGACTGTGGGCCGGGCGCGG - Intergenic
1091865707 12:3834340-3834362 CAAAAACAGTGGGCCGGGTGTGG + Intronic
1091878020 12:3952629-3952651 AAAGAATTATCGGCCGGGCGCGG - Intergenic
1092266706 12:6986822-6986844 TTACACCTGTCGGCCGGGTGCGG + Intronic
1092524756 12:9302801-9302823 TAAGAAGGGTCGGCCGGGTGTGG + Intergenic
1092542508 12:9429010-9429032 TAAGAAGGGTCGGCCAGGTGTGG - Intergenic
1092790436 12:12066079-12066101 GAAAAACTCTCGGCCAGGTGCGG - Intronic
1093721256 12:22444504-22444526 GAAGAAATGTGGGCTGGGCGCGG - Intergenic
1094119022 12:26949420-26949442 GAAAAACTGTAGGCCAGGTGTGG - Intronic
1094510503 12:31093423-31093445 TAAGAAGGGTCGGCCGGGTGCGG + Intronic
1094553599 12:31475831-31475853 GAGGAGGTGTGGGCCGGGTGCGG + Intronic
1094708894 12:32941511-32941533 AAAGAATTATGGGCCGGGTGCGG - Intergenic
1095073670 12:37890655-37890677 TAAAAACTGGAGGCCGGGTGCGG - Intergenic
1095203747 12:39415545-39415567 GAAGCATTCTCGGCCGGGCGCGG - Intronic
1095304561 12:40624545-40624567 AAAAAAATGTCGGCCGGGCGCGG + Intergenic
1095867228 12:46985196-46985218 AAAGAAATTTCGGCCGGGCGCGG + Intergenic
1096576657 12:52557040-52557062 TAAAAATTGTAGGCCGGGTGTGG + Intergenic
1096905906 12:54935163-54935185 TAAGAAATGTGGGCCGGGCGTGG - Intergenic
1096998832 12:55858730-55858752 AAAAAAATATCGGCCGGGTGTGG - Intergenic
1097239103 12:57562504-57562526 GAAGAACTGTGGGTCGGGCACGG - Intronic
1097667172 12:62492659-62492681 TAAGAACTAACGGCCGGGCGCGG - Intronic
1098292710 12:68972377-68972399 TAAGAAATGTAGGCTGGGTGCGG - Intergenic
1098340415 12:69445064-69445086 AAGGAACTGTGGGCCGGGCGCGG - Intergenic
1098605239 12:72381684-72381706 TAAAAACTTTCGGCCGGGCGCGG - Intronic
1098690684 12:73483331-73483353 CAAGAAATGGAGGCCGGGTGTGG - Intergenic
1099275590 12:80571426-80571448 AAAGAATTGTAGGCTGGGTGTGG - Intronic
1099704377 12:86132501-86132523 GAAAAACTGACGGCTGGGCGCGG + Intronic
1099979229 12:89579581-89579603 AAAGAACTTTTGGCCGGGTGCGG - Intergenic
1100599543 12:96101069-96101091 GAAGAAAAGGAGGCCGGGTGCGG - Intergenic
1101150792 12:101880577-101880599 GAAGCACTGCAGGCTGGGTGTGG - Intronic
1101356756 12:103986209-103986231 AATGCACTGTAGGCCGGGTGCGG - Intronic
1101357335 12:103992780-103992802 AGAGAACTTTCGGCCGGGCGTGG - Intronic
1102169852 12:110834132-110834154 GAAAAAGAGTCGGCCGGGTGCGG + Intergenic
1102311639 12:111849550-111849572 AAAGAACTCTAGGCCAGGTGCGG - Intronic
1102368271 12:112358883-112358905 TAAGAACGGCCGGCCGGGCGCGG + Intronic
1102945308 12:116981902-116981924 TAAGAACTTTAGGCTGGGTGTGG - Intronic
1103090546 12:118095191-118095213 CAAAAAATGCCGGCCGGGTGCGG - Intronic
1103300488 12:119922621-119922643 ACACAACTTTCGGCCGGGTGAGG + Intergenic
1103505410 12:121439668-121439690 GAGTTACTGTTGGCCGGGTGCGG - Intronic
1103659454 12:122501948-122501970 AAAGAAATGTGGGCCGGGGGCGG + Intergenic
1103671141 12:122616549-122616571 CAGGAAATCTCGGCCGGGTGCGG - Intronic
1104123071 12:125817807-125817829 GGAGATCTGTGGGCTGGGTGCGG - Intergenic
1104228667 12:126862107-126862129 GAGTAAGTGTAGGCCGGGTGTGG - Intergenic
1104710271 12:130980686-130980708 GAGGAACTGCAGGCCGGGCGCGG - Intronic
1105238101 13:18580141-18580163 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1105253822 13:18726326-18726348 AAAGAACTTCCGGCCGGGCGCGG - Intergenic
1105361050 13:19716897-19716919 TAAGAACTGTTGGCCAGGCGCGG + Intronic
1105378228 13:19863798-19863820 GAAGAGCTGTCCGTCAGGTGCGG + Intergenic
1106222716 13:27760043-27760065 GAAGAATGGCTGGCCGGGTGCGG - Intergenic
1107198738 13:37687251-37687273 GTAGAACTTTGGGCTGGGTGTGG - Intronic
1107807565 13:44168808-44168830 TAAGAAATTTAGGCCGGGTGTGG + Intergenic
1107843332 13:44483369-44483391 CAAGAATTATGGGCCGGGTGCGG + Intronic
1107925619 13:45259134-45259156 GAAGAAAAATAGGCCGGGTGCGG + Intronic
1108056324 13:46489090-46489112 AACCAACTGTGGGCCGGGTGAGG + Intergenic
1108329390 13:49370111-49370133 GCAGAACAGTCTACCGGGTGAGG + Intronic
1108380081 13:49846882-49846904 AAAGAATTGCCGGCCGGGCGCGG + Intergenic
1108621033 13:52183916-52183938 ATATAAATGTCGGCCGGGTGCGG - Intergenic
1108643406 13:52404234-52404256 GATTAACTGTGGGCTGGGTGTGG - Intronic
1109109936 13:58303950-58303972 GAAGCAGAGTTGGCCGGGTGCGG + Intergenic
1109123275 13:58485347-58485369 AAAGAACTCTGGGCCGGGCGCGG - Intergenic
1109314629 13:60735586-60735608 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1109504702 13:63285169-63285191 GAAAAATTATTGGCCGGGTGCGG - Intergenic
1109864067 13:68239396-68239418 AAAAAGCTGTAGGCCGGGTGCGG + Intergenic
1110620762 13:77592853-77592875 TAAGAACTGTGGGCTGGGTGTGG - Intronic
1111230126 13:85334437-85334459 GGAAAAAAGTCGGCCGGGTGTGG - Intergenic
1112221958 13:97500230-97500252 GAAGCAATGTTGGCCGGGCGCGG + Intergenic
1112407593 13:99135022-99135044 GAAGCAAAGTAGGCCGGGTGTGG + Intergenic
1112415730 13:99201779-99201801 AAAGATCTGTTGGCCGGGCGCGG + Intronic
1113168211 13:107467748-107467770 CAAGAAGTATTGGCCGGGTGCGG + Intronic
1113253134 13:108476337-108476359 GAATAAATATCAGCCGGGTGTGG + Intergenic
1113458180 13:110463824-110463846 GTAAAAATGTGGGCCGGGTGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114372984 14:22110824-22110846 GAACAGTTGTCGGCCGGGCGCGG - Intergenic
1114492311 14:23110956-23110978 GGAGAGCTGTCGTCCAGGTGGGG + Intergenic
1114509536 14:23246848-23246870 AAAAAATTGTTGGCCGGGTGTGG + Intronic
1114541589 14:23464240-23464262 GAAGAACTGTCGGCTGGGCATGG - Intergenic
1114899137 14:27034092-27034114 GTAGAAGAGTCGGCCGGGCGCGG - Intergenic
1115216841 14:31022087-31022109 AAATCACTGTCGGCCGGGCGCGG + Intronic
1115219166 14:31042119-31042141 TAAGTAATGTTGGCCGGGTGCGG - Intronic
1115556683 14:34549810-34549832 ACGGAACTGTCGGCCGGGCGCGG + Intergenic
1115679470 14:35720040-35720062 TAAGAATTGTTGGCCGGGCGCGG - Intronic
1116823594 14:49649434-49649456 AAAGAAATATAGGCCGGGTGTGG - Intronic
1116846358 14:49868163-49868185 GCGGGACTGTCGGCGGGGTGTGG + Intergenic
1116911125 14:50465785-50465807 AAAGAACACTGGGCCGGGTGAGG + Intronic
1117153361 14:52911995-52912017 GAAGAACTGGGGGTAGGGTGGGG - Intronic
1117563509 14:56969580-56969602 GAAAAACTTTTGGCCGGGTGCGG - Intergenic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118636296 14:67751534-67751556 AAAGAAGAGTCAGCCGGGTGTGG - Intronic
1119276026 14:73357110-73357132 TAAAAAGTGTTGGCCGGGTGTGG + Intronic
1119457949 14:74772645-74772667 GTAGAACTATTGGCTGGGTGCGG - Intronic
1119656735 14:76422499-76422521 AAGGAAATGTCGGCCGGGTGTGG - Intronic
1120065377 14:80034377-80034399 AAAAAACTGTGGGCCGGGCGCGG + Intergenic
1120653255 14:87159944-87159966 AAAGAAATGTGGGCCGGGCGCGG - Intergenic
1121198420 14:92096332-92096354 AAAGAAATGTAAGCCGGGTGTGG + Intronic
1121276805 14:92673794-92673816 GAAGATGTGGCGGCCGGGCGCGG - Intronic
1121345704 14:93134221-93134243 AAAAAAAAGTCGGCCGGGTGCGG - Intergenic
1121668273 14:95688994-95689016 TAAAAACAGTTGGCCGGGTGCGG + Intronic
1121799067 14:96758281-96758303 GAAGATCTCTAGGCCGGATGCGG + Intergenic
1121894751 14:97636620-97636642 AAAGAAATATCGGCGGGGTGCGG + Intergenic
1122189953 14:100033933-100033955 GAAGAACTGTAGGCCGGGCATGG + Intronic
1122646718 14:103199393-103199415 GAAAAACTTTAGGCCGGGCGTGG + Intergenic
1124357874 15:29010546-29010568 AAAGAACTCCCGGCCGGGTGTGG - Intronic
1124418416 15:29493421-29493443 AAAGAGTTGTCGGCCGGGCGCGG - Intronic
1124525169 15:30444369-30444391 TAAAATCTGTCGGCCGGCTGCGG + Intergenic
1124773487 15:32563344-32563366 TAAAATCTGTCGGCCGGCTGCGG - Intergenic
1124838537 15:33219793-33219815 GAGGAACTCTCGGCTGGGTGTGG + Intergenic
1125156242 15:36589792-36589814 GGAGAACTGTTGGCCGGGAGCGG - Intronic
1125247613 15:37659965-37659987 AAAGAACTCCCGGCCGGGTGTGG + Intergenic
1125822249 15:42641892-42641914 TAAGAAATGTCAGCCGGGCGCGG - Intronic
1125843931 15:42833580-42833602 TAAAAATTGTCGGCCAGGTGTGG + Intronic
1126150024 15:45515362-45515384 AAAGAAATTTCGGCCGGGCGTGG + Intronic
1126396072 15:48219252-48219274 GAAAACTTGTCGGCCGGGTGTGG + Intronic
1126963125 15:54020571-54020593 TAAGAAAAATCGGCCGGGTGTGG - Intronic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1128039461 15:64557972-64557994 GAAAATCTTTCGGCCGGGCGCGG - Intronic
1128755005 15:70176885-70176907 GAAGACTTATGGGCCGGGTGTGG + Intergenic
1128980623 15:72183225-72183247 AAAGAACTCTTGGCCGGGCGCGG + Intronic
1129306310 15:74666086-74666108 TATAATCTGTCGGCCGGGTGTGG - Intronic
1129321248 15:74776291-74776313 GAAGCAGTGTCGGCCGGACGCGG + Intergenic
1129422417 15:75439633-75439655 GAAGCATTGATGGCCGGGTGCGG - Intronic
1129858079 15:78839332-78839354 AAACAACTGTTGGCCGGATGTGG - Intronic
1129988255 15:79937666-79937688 GAATAAATTTCGGCCGGGCGCGG + Intergenic
1130020154 15:80223345-80223367 GAATAAATCTCGGCCGGGCGCGG - Intergenic
1130860471 15:87881707-87881729 TAAGAACTTTAGGCCGGGCGCGG - Intronic
1131254915 15:90855633-90855655 GAAGATCTGGCGGCCGGGCGTGG + Intergenic
1132867573 16:2101272-2101294 TAAAAACTGTCGGCCGGGCGCGG - Intronic
1133070035 16:3239988-3240010 AAGAAACTGCCGGCCGGGTGCGG - Intergenic
1133152285 16:3843856-3843878 GAAAGACTTTCGGCCGGGCGCGG + Intronic
1133710206 16:8393892-8393914 TAACAACTGTGGGCCGGGCGCGG - Intergenic
1134222455 16:12365750-12365772 GCAGAACAGTGGGCCGGGCGCGG + Intronic
1134524207 16:14931841-14931863 TAAAAACTGTCGGCCGGGCGCGG + Intronic
1134548698 16:15129093-15129115 TAAAAACTGTCGGCCGGGCGCGG - Intronic
1134652592 16:15922116-15922138 AAAGTACTTTTGGCCGGGTGCGG - Intergenic
1134711796 16:16330327-16330349 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1134719648 16:16373621-16373643 TAAAAACTGTCGGCCGGGCGCGG + Intergenic
1134744839 16:16580076-16580098 AAAAAACTCTTGGCCGGGTGCGG + Intergenic
1134906355 16:17982891-17982913 GAAGAGCTCCCGGCCGGGTGTGG - Intergenic
1134947778 16:18338264-18338286 TAAAAACTGTCGGCCGGGCGTGG - Intergenic
1134955032 16:18378366-18378388 TAAAAACTGTCGGCCGGGTGCGG - Intergenic
1134976406 16:18574083-18574105 GAAACACAGTCGGCCGGGGGTGG - Intergenic
1135017589 16:18936715-18936737 GAATTACTATGGGCCGGGTGTGG - Intergenic
1135278995 16:21137711-21137733 GAAGAACTATCAGCTGGGTGTGG - Intronic
1135427167 16:22348225-22348247 CAATCACTGTTGGCCGGGTGTGG - Intronic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1135820508 16:25681200-25681222 TAAGATATGTAGGCCGGGTGCGG + Intergenic
1138078414 16:54065452-54065474 GAGTAACTGTGGGCCGGATGCGG - Intronic
1138268509 16:55677949-55677971 TAAGCCCTGTAGGCCGGGTGAGG - Intronic
1138311939 16:56032787-56032809 AAAGAACTCTTGGCCGGGCGTGG - Intergenic
1138413459 16:56857708-56857730 GAAGAACTCCCAGCCAGGTGTGG - Intergenic
1138464047 16:57174003-57174025 AAAAAATTCTCGGCCGGGTGCGG + Intronic
1139454152 16:67058429-67058451 AAAGAACTGTTGGTCGGGCGTGG - Intronic
1139456143 16:67078948-67078970 AAAAAACTGTGGGCCTGGTGCGG - Intronic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1140171594 16:72610580-72610602 GAAGCACTGGAGGCTGGGTGTGG + Intergenic
1140293091 16:73682493-73682515 AAAGAAAGGTAGGCCGGGTGCGG + Intergenic
1140425912 16:74861143-74861165 GAAGAATTACTGGCCGGGTGTGG - Intergenic
1141090320 16:81125833-81125855 GGAGATCTGTCAGCCTGGTGTGG + Intergenic
1141504990 16:84471027-84471049 AAAGCACTGTTGGCCGGGTGTGG + Intergenic
1142198977 16:88752190-88752212 GACAAACTTTAGGCCGGGTGTGG + Intronic
1142301493 16:89261156-89261178 AAAGAAAAGTCGGCCGGGTGCGG + Intergenic
1142303578 16:89273409-89273431 GAAAATCTGTCGGCTGGGTGCGG + Intronic
1142423285 16:89986604-89986626 GACCAAGTGTCGGCCGGGGGCGG - Intergenic
1142665323 17:1459783-1459805 GAAGACATTTGGGCCGGGTGCGG - Intronic
1142691819 17:1611132-1611154 GAAAGACTTTAGGCCGGGTGCGG - Intronic
1142981299 17:3673628-3673650 GAAGAACTGACGGCAGGGGGTGG + Exonic
1143456324 17:7070202-7070224 GAGGCATTGTCGGCCGGGCGCGG + Intergenic
1143683620 17:8495997-8496019 AAAGAACTTCCAGCCGGGTGTGG - Intronic
1144427718 17:15159806-15159828 GAAAACCTGTTGGCCGGGCGCGG + Intergenic
1144451780 17:15386645-15386667 AAAAAACTGCCAGCCGGGTGTGG - Intergenic
1144632892 17:16883018-16883040 GAAAAACTTTCGGCCAGGCGTGG + Intergenic
1144694456 17:17292600-17292622 AAGGAACAGGCGGCCGGGTGTGG - Intergenic
1144887514 17:18473458-18473480 CAAGCACTGTAGGCCGGGTGCGG - Intergenic
1145028976 17:19490182-19490204 AAAAAAATGTCGGCCGGGCGTGG + Intergenic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145144703 17:20470837-20470859 CAAGCACTGTAGGCCGGGTGCGG + Intergenic
1145176155 17:20702236-20702258 CAAGCACTGTAGGCTGGGTGCGG + Intergenic
1145784123 17:27582994-27583016 GAAGACCTTGCGGCTGGGTGGGG - Exonic
1145874021 17:28302131-28302153 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1145926101 17:28647930-28647952 TAAGATCTATAGGCCGGGTGCGG + Intergenic
1146171040 17:30633570-30633592 GATGAACTGTAGGCCAGGGGTGG + Intergenic
1146325514 17:31882609-31882631 GAAGAACCCTGGGCTGGGTGTGG - Intronic
1146344496 17:32049574-32049596 GATGAACTGTAGGCCGGGGGTGG + Intronic
1146804014 17:35850816-35850838 TTAAAACTTTCGGCCGGGTGTGG - Intronic
1146842480 17:36165556-36165578 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1146854790 17:36253515-36253537 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1146865830 17:36334861-36334883 TAAGAAATTTAGGCCGGGTGTGG + Intronic
1146870690 17:36377407-36377429 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1146878048 17:36428488-36428510 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1146881989 17:36449592-36449614 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1147068700 17:37935473-37935495 TAAGAAATTTAGGCCGGGTGTGG + Intergenic
1147073573 17:37978031-37978053 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1147080223 17:38015010-38015032 TAAGAAATTTAGGCCGGGTGTGG + Intronic
1147085095 17:38057569-38057591 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1147096171 17:38138970-38138992 TAAGAAATTTAGGCCGGGTGTGG + Intergenic
1147101041 17:38181535-38181557 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1147118361 17:38319810-38319832 TAAGAACTTGGGGCCGGGTGCGG + Intronic
1147150975 17:38513547-38513569 TAAGACGTGTTGGCCGGGTGTGG - Intergenic
1147287351 17:39412823-39412845 GAAAAATTTGCGGCCGGGTGCGG - Intronic
1147502069 17:40975060-40975082 AAAAAACTGTCGGCCAGGCGTGG - Intergenic
1147735843 17:42637616-42637638 AAGCAACTGTGGGCCGGGTGTGG + Intergenic
1148096284 17:45054536-45054558 TAACAACTGTCAGCCAGGTGTGG - Intronic
1148148659 17:45382943-45382965 CAAGAACTCTTGGCGGGGTGCGG - Intergenic
1148170266 17:45513664-45513686 GATGAACTGTAGGCCGGGGGTGG - Intergenic
1148170743 17:45517657-45517679 GATGAACTGTAGGCCGGGGGTGG - Intergenic
1148191988 17:45685680-45685702 AAAGAACTGAAGGCCAGGTGCGG - Intergenic
1148278943 17:46332161-46332183 GATGAACTGTAGGCCGGGGGTGG + Intronic
1148301158 17:46550023-46550045 GATGAACTGTAGGCCGGGGGTGG + Intronic
1148365281 17:47050895-47050917 GATGAACTGTAGGCCAGGGGTGG + Intergenic
1148656398 17:49286889-49286911 AAACAAAAGTCGGCCGGGTGCGG + Intergenic
1148954195 17:51339870-51339892 AAAGAAATGTAGGCTGGGTGTGG - Intergenic
1149458169 17:56806262-56806284 AATCAACTGTAGGCCGGGTGCGG - Intronic
1149641140 17:58203640-58203662 TAAGACCTGACGGCCGGGCGCGG + Intronic
1149697840 17:58630344-58630366 GAAAAACGTTTGGCCGGGTGCGG - Intronic
1149708505 17:58717446-58717468 GAAAAGCTGCCGGCCGGGTGTGG + Intronic
1149845632 17:60007998-60008020 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1149893491 17:60410788-60410810 TAGAAACTGTCGGCTGGGTGCGG + Intronic
1150083981 17:62264581-62264603 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1150192247 17:63255380-63255402 GAACTACTGCCGGCCGGGCGCGG - Intronic
1150401356 17:64859240-64859262 GATGAACTGTAGGCTGGGGGTGG - Intronic
1150426081 17:65078189-65078211 AAACAACTGGTGGCCGGGTGCGG - Intergenic
1150702709 17:67461634-67461656 TTAGAACTGTAGGCTGGGTGTGG + Intronic
1150751844 17:67871059-67871081 GAAGCATTTTCGGCCGGGCGCGG - Intronic
1150852952 17:68722658-68722680 GAAGATCTGTTGGCTGGGAGTGG + Intergenic
1150959773 17:69900701-69900723 AAAGAACTTGCGGCCGGGCGTGG - Intergenic
1151233811 17:72703835-72703857 GACAAACTGTTGGCCGGGGGTGG + Intronic
1151511070 17:74560543-74560565 AAAAAAATGTAGGCCGGGTGCGG - Intergenic
1151595089 17:75073565-75073587 AAAAAAGTGTCAGCCGGGTGAGG - Intergenic
1152350579 17:79781982-79782004 GAGGAACTCTCAGCCGGCTGGGG - Intronic
1153393909 18:4595597-4595619 AATGATCTGTTGGCCGGGTGCGG - Intergenic
1153652199 18:7250709-7250731 GAAGAAATATGGGCCGGGTGCGG - Intergenic
1154251008 18:12745033-12745055 AAAAAATTGTCGGCTGGGTGCGG - Intergenic
1155649708 18:28126783-28126805 GCAGAACTATCGGTCTGGTGGGG + Intronic
1155660182 18:28240057-28240079 GAAGAACTGATGGCCGGGCACGG - Intergenic
1155916392 18:31561706-31561728 AATGAGCTGTGGGCCGGGTGTGG + Intergenic
1156328686 18:36098939-36098961 GAAGAACAAGCGGCCGGGCGCGG - Intergenic
1156442047 18:37200519-37200541 AAGGAGCTGTCGGCCGGGCGCGG + Intronic
1156980589 18:43283433-43283455 AAAGAACTCTTGGCCGGGCGCGG + Intergenic
1157690217 18:49675676-49675698 GAAAAAATGTGGGCCGGGTGCGG + Intergenic
1157765590 18:50294551-50294573 TAAGAAATGTGGGCCAGGTGCGG - Intergenic
1157825541 18:50808845-50808867 AAAGAACTGTCGGCCGGGCGCGG + Intronic
1158180456 18:54709647-54709669 AAAGAATTCTCGGTCGGGTGCGG - Intergenic
1158263222 18:55632326-55632348 AAAGAACTGTTGGCCGGGCGCGG - Intronic
1158914852 18:62114069-62114091 AAAAAAATGTGGGCCGGGTGCGG + Intronic
1159112417 18:64074658-64074680 GAACCACTGGAGGCCGGGTGTGG + Intergenic
1159443647 18:68512794-68512816 GAAAAACTGTAGGCCAGGCGCGG - Intergenic
1159845945 18:73460165-73460187 GAAAAACTGTTGGCTGGATGCGG - Intergenic
1160058917 18:75511879-75511901 GAATAACTGGTGGCCGGGCGCGG + Intergenic
1160275016 18:77423926-77423948 AAATAAATGTCGGCCGGGTGCGG + Intergenic
1160839567 19:1140007-1140029 GAAGAAATGCAGGCCGGGCGCGG + Intronic
1161372238 19:3919301-3919323 TAAAAATTATCGGCCGGGTGTGG + Intronic
1161429293 19:4222096-4222118 TAAGAACTATTGGCCGGGCGCGG + Intronic
1161430635 19:4230212-4230234 GAATGAATGTCGGCCGGGCGCGG - Intronic
1161548889 19:4899637-4899659 AAAGAACTAGCGGCCGGGCGCGG + Intronic
1161601173 19:5184077-5184099 CAAGAAGTTTCGGCCGGGCGCGG + Intronic
1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG + Intergenic
1161892274 19:7049003-7049025 ATGGAATTGTCGGCCGGGTGCGG - Intergenic
1161968800 19:7564095-7564117 TAAAAACTTTAGGCCGGGTGTGG - Intergenic
1162665364 19:12205850-12205872 AAAGAAGTTTAGGCCGGGTGCGG - Intergenic
1162688009 19:12403840-12403862 GAAGACCTGCAGGCTGGGTGCGG - Intronic
1162709214 19:12579258-12579280 AAAGAACTGGGGGCCGGGTGTGG + Exonic
1163022697 19:14491817-14491839 AAATCAGTGTCGGCCGGGTGTGG + Intronic
1163216620 19:15883768-15883790 GAAAATGTGGCGGCCGGGTGCGG + Intronic
1163308773 19:16499563-16499585 GAAAAACTACAGGCCGGGTGCGG - Intronic
1163342835 19:16720841-16720863 GAAAAAGTCTCGGCCAGGTGCGG - Intronic
1163472104 19:17503639-17503661 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1163996623 19:21054962-21054984 GAAAAAATGACGGCCGGGCGCGG - Intronic
1164151347 19:22554947-22554969 AAAGAATTTTCGGCAGGGTGCGG - Intergenic
1165048018 19:33121607-33121629 GGAGACTTGGCGGCCGGGTGCGG - Intronic
1165359695 19:35328684-35328706 AAAGATATCTCGGCCGGGTGCGG - Intronic
1165481112 19:36064868-36064890 GAAGGAATGGGGGCCGGGTGCGG - Intronic
1165594658 19:37002474-37002496 AAAGTAAAGTCGGCCGGGTGCGG + Intergenic
1165657241 19:37544710-37544732 GAAAAACAGTAGGCCGGGCGTGG - Intronic
1165705355 19:37972410-37972432 TAAGAACTGTGGGCTGGGTGTGG + Intronic
1166712599 19:44946859-44946881 AAAGAACTGTAGGCTGGGCGTGG + Intronic
1167247083 19:48380044-48380066 AAAGAGATGCCGGCCGGGTGCGG + Intergenic
1167283006 19:48581745-48581767 AAAGAACTCTCGGCCGGGCACGG - Intronic
1167497457 19:49827937-49827959 CAACAAATGTCGGCCGGGTGTGG + Intronic
1167616568 19:50537663-50537685 AAAGAACAGTCGGCCGGGCGCGG - Intronic
1168041577 19:53763285-53763307 TAAAAACTATCGGCCGGGCGCGG - Intergenic
1168143727 19:54407184-54407206 GTAGAATTGTTGGCCGGGCGTGG + Intergenic
1168209491 19:54879973-54879995 AAAGAAATGTCGGCCGGGCGCGG - Intronic
1168559317 19:57370179-57370201 GAAGAACTATGGGCTGGGTGCGG - Intronic
1168592663 19:57650356-57650378 GTATAATTTTCGGCCGGGTGTGG + Intergenic
1202677876 1_KI270711v1_random:24083-24105 TAAGAAGTCTCGGCCGGGCGCGG - Intergenic
1202706445 1_KI270713v1_random:27704-27726 AAAAAATTGTTGGCCGGGTGCGG - Intergenic
925292372 2:2756303-2756325 GAAGAACTGTGTGGCTGGTGGGG - Intergenic
925925155 2:8664944-8664966 GAAGGATTGTGGGCCGGGCGCGG + Intergenic
925932366 2:8719304-8719326 TAAGAAATGAGGGCCGGGTGTGG + Intergenic
926185940 2:10690643-10690665 GAAGTACTGTAGGCCGGGTGCGG + Intergenic
926270326 2:11360940-11360962 AAAGACCTGTAGGTCGGGTGCGG - Intergenic
926766644 2:16328083-16328105 AAAGCTCTGTGGGCCGGGTGCGG - Intergenic
926791664 2:16578010-16578032 GAACAACTGTCTGCCTGGTGAGG + Intronic
927137449 2:20107162-20107184 AATGAACTATGGGCCGGGTGCGG + Intergenic
927541374 2:23914547-23914569 CAAGAACTCTCGGCCCGGCGCGG + Intronic
927547676 2:23969179-23969201 GAAGAAATATCAGCTGGGTGAGG - Intronic
927730406 2:25466042-25466064 GAAGTACTTAAGGCCGGGTGTGG + Intronic
928967496 2:36991937-36991959 AAAGAGATGTCGGCTGGGTGTGG + Intronic
929353074 2:40984095-40984117 GAAGAAATCAAGGCCGGGTGTGG - Intergenic
929691185 2:44075116-44075138 AAAGCACTCTAGGCCGGGTGCGG - Intergenic
930259095 2:49124283-49124305 AAAGAAAACTCGGCCGGGTGTGG - Intronic
930714082 2:54576342-54576364 GAAGAGCTGAAGGCCGGGCGCGG - Intronic
931519230 2:63077151-63077173 GAATAAAATTCGGCCGGGTGCGG - Intergenic
932170273 2:69548964-69548986 GAAGAACTGTCTAACGGGTGAGG - Intronic
932671112 2:73738580-73738602 GAAGAACATTCGGCCAGGTGCGG + Intergenic
932979508 2:76647336-76647358 TAAGAATTGTAGGCCGGGCGCGG - Intergenic
934973458 2:98782983-98783005 GTAGATCTTTAGGCCGGGTGCGG + Intergenic
935296137 2:101651250-101651272 GAAGAACAGGAGGCCCGGTGTGG + Intergenic
936128864 2:109816062-109816084 TAAGAACTATTGGCAGGGTGCGG - Intronic
936215833 2:110555423-110555445 TAAGAACTATTGGCAGGGTGCGG + Intronic
936424970 2:112409995-112410017 TAAGAACTATTGGCAGGGTGCGG + Intronic
936478921 2:112867270-112867292 AAAGAACTCCCGGCCGGGTATGG - Intergenic
936785560 2:116090009-116090031 GAAAACCTGTAGGCCGGGCGCGG - Intergenic
937162593 2:119779325-119779347 AAAGAATTGTCGGCTGGGCGCGG + Intronic
937208602 2:120252930-120252952 TAAGAGCTGCGGGCCGGGTGCGG + Exonic
937420637 2:121752340-121752362 AAAGAGCAGACGGCCGGGTGCGG + Intronic
937979177 2:127603841-127603863 GAAAATCTGTTGGCCAGGTGTGG + Intronic
938112422 2:128577913-128577935 GAATAAATCTCGGCCGGGCGCGG + Intergenic
938185923 2:129231812-129231834 TAAGAACTCTAGGCTGGGTGTGG - Intergenic
938578181 2:132622822-132622844 TAAGACCTGTTGGCCAGGTGCGG + Intronic
941134682 2:161699308-161699330 TAATAAATGTCGGCCGGGTGCGG - Intronic
941218574 2:162744861-162744883 AAAGTTCTGTCGGCCGGGCGCGG - Intronic
941869260 2:170366581-170366603 GAAGATCTGTTGGCCAGGCGTGG - Intronic
941945959 2:171097632-171097654 TAAGAATAGGCGGCCGGGTGTGG + Intronic
942285651 2:174413160-174413182 AGAGCACTATCGGCCGGGTGTGG - Intronic
943214742 2:185016130-185016152 GAATAGCTGGAGGCCGGGTGCGG + Intergenic
943598954 2:189891511-189891533 AAAGAATTTTCGGCCGGGTTTGG - Intronic
943869649 2:192977772-192977794 GAAGATCTTTAGGCTGGGTGCGG + Intergenic
943959382 2:194242055-194242077 AAAGAATTATAGGCCGGGTGCGG + Intergenic
944253765 2:197603623-197603645 ATAGAACTTTAGGCCGGGTGTGG + Intronic
944617544 2:201477352-201477374 TAAGAACTGATAGCCGGGTGCGG - Intronic
944809853 2:203317338-203317360 GAGTAATTTTCGGCCGGGTGTGG + Intergenic
945131848 2:206582166-206582188 TAAGAAATGTTGGCCGGGCGTGG - Intronic
945914327 2:215686844-215686866 ACAAAACTGTTGGCCGGGTGCGG - Intergenic
946663631 2:222027544-222027566 AAAGCAATGTAGGCCGGGTGTGG + Intergenic
946970677 2:225087566-225087588 TAAAAACTTTCGGCTGGGTGCGG + Intergenic
947214543 2:227737908-227737930 AAAGAAATGTGGGCTGGGTGGGG + Intergenic
947618063 2:231571066-231571088 TAACAACTCTTGGCCGGGTGTGG - Intergenic
947674279 2:231962723-231962745 TGGGAACAGTCGGCCGGGTGCGG - Intronic
947789519 2:232856220-232856242 AAAGAACTGCAGGCCGGGTGTGG - Intronic
947877197 2:233475452-233475474 GAGGAACTTTTGGCCGGGCGCGG - Intergenic
949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG + Intronic
1169394998 20:5221354-5221376 CAAGAACTGTGGGCCCTGTGTGG + Intergenic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1170257932 20:14366653-14366675 CAAAAATTGTTGGCCGGGTGTGG - Intronic
1170769822 20:19322914-19322936 GAAGAAATATAGGCCGGGCGCGG + Intronic
1172252436 20:33489608-33489630 TAATAACTGTTGGCCGGGCGTGG - Intergenic
1172544337 20:35747715-35747737 GAAGAAATCTAGGCCGGGCGTGG + Intergenic
1172565407 20:35926527-35926549 GAAAGTCTGTCGGCCGGGCGCGG - Intronic
1172775024 20:37402319-37402341 GAAGAAGTGTGGGGAGGGTGGGG + Intronic
1172935677 20:38618395-38618417 CAAGAACTTTGGGCTGGGTGCGG - Intronic
1172969327 20:38861963-38861985 GAAGAACTGTAGGCCAGGCACGG - Intronic
1174030332 20:47619352-47619374 AAAGAAATGTAGGCTGGGTGTGG + Intronic
1174252383 20:49229318-49229340 GAAAACATGTCGGCTGGGTGCGG - Intronic
1174658110 20:52188605-52188627 GAAATAATGTCGGCCGGGTGCGG - Intronic
1174672430 20:52320562-52320584 GAAATACTGAAGGCCGGGTGTGG + Intergenic
1174863086 20:54110975-54110997 AAAGAAAGGTGGGCCGGGTGCGG + Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1176231178 20:64033795-64033817 GATAAACTCACGGCCGGGTGCGG - Intronic
1176782083 21:13208418-13208440 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1176839332 21:13826317-13826339 AAAGAACTTCCGGCCGGGCGCGG - Intergenic
1176983015 21:15404794-15404816 GAAAAACTGTTGGCCGGGCACGG - Intergenic
1177424221 21:20901734-20901756 AATGAACTTTAGGCCGGGTGCGG + Intergenic
1178096110 21:29217455-29217477 GAGGACGTGTGGGCCGGGTGCGG + Intronic
1178623772 21:34198925-34198947 GAAGCACTGTAGGCAGGATGTGG - Intergenic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1180639186 22:17284287-17284309 TAGTAACTGTCGGCCGGGCGCGG - Intergenic
1180674433 22:17577446-17577468 TAGAAACTGTGGGCCGGGTGCGG - Intronic
1180684872 22:17658108-17658130 AAAGAAATGTCGGCCGGGCGTGG - Intronic
1180901887 22:19379300-19379322 GAAAAACTGCCGGCCGGGCACGG - Intronic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181691765 22:24566550-24566572 GAACAACTATGGGCCAGGTGTGG - Intronic
1181817704 22:25451017-25451039 TAAGAAGTATAGGCCGGGTGCGG - Intergenic
1182364898 22:29771952-29771974 GAGGAGCTGTAGGCCGGGCGTGG + Intergenic
1182468187 22:30531115-30531137 AAGGAACTGTAGGCCAGGTGCGG + Intronic
1182736934 22:32537447-32537469 AAGGAAGTGCCGGCCGGGTGCGG - Intronic
1182820612 22:33212725-33212747 GAATATTTGTGGGCCGGGTGCGG + Intronic
1183239849 22:36649574-36649596 GTAGAGCTGTTGGCCGGGCGTGG - Intronic
1183592850 22:38790875-38790897 AAAGTACAGTTGGCCGGGTGCGG + Intronic
1183718271 22:39547024-39547046 GAAGAACTGTGGGCCAGGTTAGG + Intergenic
1183896826 22:40976067-40976089 GAAGAAGTGAGGGCCGGGTGCGG - Intergenic
1183908744 22:41062684-41062706 GATTAAATGACGGCCGGGTGTGG + Intergenic
1184160904 22:42696814-42696836 GAAAAACAGGCGGCCAGGTGTGG - Intronic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
1184540592 22:45121540-45121562 GAAGTAATGGCGGCCGGGCGCGG + Intergenic
1185314530 22:50173321-50173343 GAAGAAAGTTGGGCCGGGTGCGG - Intronic
949635438 3:5976839-5976861 GAAGCATTTTCGGCCGGGCGTGG - Intergenic
949658258 3:6247132-6247154 GAATAAATGTGGGCCAGGTGCGG + Intergenic
950065898 3:10111528-10111550 GAAGAACTATCGGCCAGGCACGG + Intergenic
950775637 3:15347581-15347603 AAAGAACTCTTGGCTGGGTGTGG - Intergenic
950892565 3:16417288-16417310 GAAGTTCTGGAGGCCGGGTGCGG - Intronic
951057867 3:18168893-18168915 TAAGAACTGTAGGCTGAGTGCGG + Intronic
951319546 3:21227695-21227717 AACAAACTCTCGGCCGGGTGTGG - Intergenic
952098017 3:29978842-29978864 GAAGAACTGGGGGCTGGGCGTGG + Intronic
952747380 3:36794061-36794083 GAAGACATGTGGGCCGGGTGCGG - Intergenic
953030129 3:39174476-39174498 AAAAAACTGTGGGCCGGGCGCGG + Intergenic
953948312 3:47167376-47167398 GAAGAAATGTAGACCGGGTGCGG + Intergenic
954565075 3:51592860-51592882 GAAAAGCTTTAGGCCGGGTGTGG - Intronic
955159092 3:56446915-56446937 AATGCACTCTCGGCCGGGTGTGG - Intronic
956504450 3:69922508-69922530 AAAGCAATGGCGGCCGGGTGTGG - Intronic
956625327 3:71260830-71260852 CTAGAACTGTAGGCCGGGCGTGG - Intronic
956815053 3:72900706-72900728 TAAGAATTGTGGGCTGGGTGTGG - Intronic
957450620 3:80377285-80377307 GAAGTACAGTAGGCCAGGTGTGG - Intergenic
957612067 3:82480748-82480770 TAAGAAGTCTTGGCCGGGTGTGG - Intergenic
957932333 3:86897264-86897286 GAAAAACTGCTGGCCGGGCGCGG - Intergenic
958174881 3:89984717-89984739 TAAAAACTTTCGGCCGGGCGCGG + Intergenic
958430834 3:94038809-94038831 GATGAGCAGCCGGCCGGGTGCGG - Intronic
958903221 3:99912666-99912688 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
958955443 3:100461019-100461041 GCAGAAGTGACGGCCGGGCGCGG - Intergenic
959030793 3:101297196-101297218 TAAAAACTGCCGGCCGGGCGTGG - Intronic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
959738602 3:109689566-109689588 AGAGAACTACCGGCCGGGTGCGG - Intergenic
960377182 3:116917701-116917723 AAAGAAAAGTCGGCCAGGTGTGG + Intronic
960583648 3:119301334-119301356 TAAGAACAGTCTGCGGGGTGAGG + Intronic
962075900 3:132081343-132081365 TAAGATTTGTCGGCCGGGCGCGG - Intronic
962790918 3:138810935-138810957 AAATAAATGTCGGCCGGGCGCGG + Intronic
963160772 3:142149197-142149219 GAAGAACTGGCGGCCAAGCGAGG + Exonic
963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG + Intergenic
963769266 3:149372777-149372799 GAAGAGCTATCAGCCGGGCGTGG - Intronic
963813937 3:149809279-149809301 TAAGAAGTCTGGGCCGGGTGCGG + Intronic
963818689 3:149863668-149863690 GAACAAATGTAGCCCGGGTGTGG - Intronic
964102737 3:153006444-153006466 GAAGAGGTGGAGGCCGGGTGTGG - Intergenic
964174655 3:153811846-153811868 TAAAAACTCTAGGCCGGGTGCGG + Intergenic
964240493 3:154587083-154587105 AAAGAACTCTCGGCCAGGTGTGG - Intergenic
964281522 3:155071869-155071891 GAATCACTGTCGGCCGGGCGCGG + Intronic
964568091 3:158080550-158080572 GAAGAACATTGGGCCAGGTGTGG + Intergenic
965231966 3:166065694-166065716 GAAAAAATGTCGGCCGGGCACGG - Intergenic
965537941 3:169843482-169843504 ACAGAACTGTGAGCCGGGTGAGG + Intronic
965687886 3:171324806-171324828 GAAGAACTCAGGGCCGGGCGCGG + Intronic
965905629 3:173701947-173701969 GAAGAGTTTTCGGCCGGGCGCGG + Intronic
965985727 3:174750722-174750744 GAAGAATAATAGGCCGGGTGCGG - Intronic
966170928 3:177079139-177079161 AAAAAAATGTCGGCCGGGTGCGG + Intronic
966177530 3:177154683-177154705 AAAGTTCTGTCGGCCGGGCGCGG - Intronic
966276176 3:178172830-178172852 TAAGAATTCTAGGCCGGGTGTGG + Intergenic
966358189 3:179104545-179104567 AAATAATTGCCGGCCGGGTGCGG + Intergenic
966482807 3:180430209-180430231 CAAGAAATGTTGGCCGGGCGCGG + Intergenic
966663852 3:182448311-182448333 GAGGAACTGTAGGCAGGGAGTGG + Intergenic
967349127 3:188492402-188492424 AAAGTAATGTCAGCCGGGTGTGG + Intronic
967441210 3:189511238-189511260 CAAGATCTCTGGGCCGGGTGCGG + Intergenic
967450776 3:189620080-189620102 GAAAAACTCTTGGCTGGGTGTGG + Intergenic
968029946 3:195474962-195474984 GAGGAAAAGTCGACCGGGTGCGG + Intergenic
968096419 3:195933820-195933842 GAAGGACGGGAGGCCGGGTGCGG + Intergenic
968343768 3:197982514-197982536 GAAGAACTTAAGGCCGGGCGTGG - Intronic
968800435 4:2739864-2739886 GAATCAGTCTCGGCCGGGTGTGG + Intergenic
968837638 4:2976927-2976949 AAAGAAAATTCGGCCGGGTGCGG - Intronic
968857614 4:3138901-3138923 AAAGAAATATCAGCCGGGTGTGG - Intronic
968943704 4:3652654-3652676 GAGGCACTGTTGGGCGGGTGAGG + Intergenic
970018508 4:11539855-11539877 AAAAAACAGTCAGCCGGGTGTGG + Intergenic
970181297 4:13398486-13398508 GTAAGACTGTCGGCCGGGCGCGG + Intronic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
973303158 4:48612877-48612899 ATAGAACAGTTGGCCGGGTGCGG - Intronic
973812943 4:54590265-54590287 AAACATCTGTCAGCCGGGTGCGG - Intergenic
974521940 4:62992774-62992796 GAAAGACAGACGGCCGGGTGCGG - Intergenic
975113166 4:70649499-70649521 GTAAAGCTGGCGGCCGGGTGCGG - Intronic
975461556 4:74659419-74659441 AAAGGATTGTAGGCCGGGTGTGG + Intergenic
975643734 4:76526075-76526097 AAATAAATGTCGGCCAGGTGCGG + Intronic
975714392 4:77191459-77191481 AAAAACCTTTCGGCCGGGTGCGG - Intronic
975727739 4:77308462-77308484 GAAAAGCTGTAGGCCGGGCGTGG + Intronic
976513276 4:85934803-85934825 TAAGAGCTGTCGGCTGGGCGAGG - Intronic
978145304 4:105365345-105365367 AAAGAACTGCCGACCGGGCGTGG - Intergenic
979452442 4:120888080-120888102 GATAAAATGTCGGCCGGGCGCGG - Intronic
980105572 4:128585199-128585221 TTAGAAATGCCGGCCGGGTGTGG + Intergenic
980830949 4:138128730-138128752 CAACAAGTGTCGGCCGGGTGCGG - Intergenic
980969424 4:139555656-139555678 GAAGGGCTGGCGGCCGGGAGGGG + Intronic
981893812 4:149773059-149773081 GAATTACTATCGGCCGGGCGTGG + Intergenic
982030908 4:151299909-151299931 AAACCAATGTCGGCCGGGTGTGG + Intronic
982530815 4:156541057-156541079 CATAAATTGTCGGCCGGGTGCGG + Intergenic
982938777 4:161521556-161521578 GAAAAACTGGTGGCCGGGCGCGG + Intronic
983218778 4:165025020-165025042 AATGAACTGTGGGCCGGGCGCGG - Intergenic
983226725 4:165092410-165092432 ACAGCACTGTGGGCCGGGTGCGG - Intronic
983265195 4:165500927-165500949 TGAGCACTGTTGGCCGGGTGCGG + Intergenic
983784101 4:171710286-171710308 GAAAAACTTTTGGCCGGGTGCGG - Intergenic
984408557 4:179366299-179366321 GAAGATAAGTGGGCCGGGTGTGG + Intergenic
984688119 4:182694402-182694424 AAACAACTCTCGGCTGGGTGCGG - Intronic
985262042 4:188123653-188123675 TAAGAATTTTGGGCCGGGTGCGG - Intergenic
985279560 4:188271783-188271805 GAAGAAGGGAGGGCCGGGTGCGG - Intergenic
986400554 5:7375106-7375128 GATAAACTGTGGGCCGGGTGCGG - Intergenic
986693948 5:10335503-10335525 GAAGAGTTATAGGCCGGGTGTGG - Intergenic
986724522 5:10584253-10584275 AAAGAACTGTCAGCTGGGGGCGG + Intronic
987206387 5:15631403-15631425 GAAGAAGTGTGGGCTGGGCGTGG + Intronic
988296890 5:29375923-29375945 GAACAAATTTCGGCCGGGCGCGG - Intergenic
988669961 5:33370983-33371005 TAGGAATTGTCGGCCGAGTGTGG + Intergenic
989174440 5:38508872-38508894 AAAGAAATTTAGGCCGGGTGTGG - Intronic
989517787 5:42363496-42363518 AAACAAATGTTGGCCGGGTGCGG - Intergenic
990526821 5:56636310-56636332 AAAGTACTCTCGGCCGGGCGCGG - Intergenic
991059782 5:62361729-62361751 CAAGAACTGTAGGCTGGGTGTGG + Intronic
991925540 5:71701991-71702013 TGAGAAATGTCGGCTGGGTGCGG + Intergenic
992064548 5:73093975-73093997 AGAAAAGTGTCGGCCGGGTGCGG + Intergenic
992304301 5:75420266-75420288 TAAGAACTCTCGCCTGGGTGTGG - Intronic
992760764 5:79949356-79949378 TAAGAATTATTGGCCGGGTGCGG + Intergenic
992986633 5:82237351-82237373 TAAGAAGTCTTGGCCGGGTGTGG + Intronic
993332640 5:86618696-86618718 AAAAAACTGTGGGCCAGGTGCGG + Intronic
993908176 5:93647514-93647536 AAAAAACTGTGGGCTGGGTGTGG - Intronic
993933123 5:93967539-93967561 GAGGAACTGCTGGCGGGGTGTGG + Intronic
994715933 5:103321666-103321688 GAAGTGCTTTTGGCCGGGTGCGG + Intergenic
995003792 5:107166508-107166530 TAAGAAATGTCGGCCGGGCGCGG + Intergenic
996317123 5:122172741-122172763 GAACAAATGTGGGCCGGGCGCGG + Intronic
996447329 5:123570644-123570666 AAAGGACTGTCGGCTGGGCGCGG - Intronic
996541827 5:124638238-124638260 AAAAAACTGTTGGCCGGGTGTGG - Intronic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
997258596 5:132448122-132448144 GGGAAGCTGTCGGCCGGGTGCGG - Intronic
997301634 5:132810514-132810536 GTGGGACTGTGGGCCGGGTGTGG - Intergenic
997455232 5:134011928-134011950 TAAGAACTGTAGGCCGGGCATGG - Intergenic
997489175 5:134258631-134258653 AAGAAACTGTTGGCCGGGTGCGG + Intergenic
998023425 5:138791326-138791348 TAAAAAATGTCGGCCGGGTGCGG + Intronic
998052166 5:139045064-139045086 GAAAAACTCTCAGTCGGGTGTGG + Intronic
998118677 5:139559134-139559156 AAAAATCTGTCGGCCGGGCGCGG + Intronic
998285938 5:140861017-140861039 AAATACCTTTCGGCCGGGTGCGG - Intronic
998471794 5:142389477-142389499 AAAGCACTGCAGGCCGGGTGCGG - Intergenic
998824425 5:146086317-146086339 AAAGACCTTTCGGCCGGGCGCGG - Intronic
998890993 5:146745664-146745686 GATAAATTGTCGGCCAGGTGTGG + Intronic
999414528 5:151383052-151383074 AAAAGACTGTGGGCCGGGTGCGG - Intergenic
999579350 5:153018625-153018647 GTAAAATTGTCGGCCGGGCGCGG + Intergenic
1000090144 5:157923115-157923137 GAGAAACTTTAGGCCGGGTGCGG + Intergenic
1000388371 5:160697583-160697605 GAAGAAATGTATGCAGGGTGGGG + Intronic
1000608914 5:163354344-163354366 GAAAAACCCTAGGCCGGGTGCGG - Intergenic
1000619629 5:163469072-163469094 GAATAAATAGCGGCCGGGTGTGG + Intronic
1000909677 5:167006959-167006981 GATGGAATGTGGGCCGGGTGTGG - Intergenic
1001278505 5:170368551-170368573 GAAGAACTTTAGGCCGGGCACGG - Intronic
1001319267 5:170667021-170667043 TAAAAACTGTCGGCTGGGCGTGG + Intronic
1002007196 5:176245009-176245031 TAAGAAATGTTGGCCGGGTGCGG - Intronic
1002067160 5:176657628-176657650 GAAAACATGTCGGCTGGGTGGGG - Exonic
1002197028 5:177506974-177506996 AAAGCACTGGTGGCCGGGTGCGG - Intronic
1002219184 5:177665613-177665635 TAAGAAATGTTGGCCGGGTGCGG + Intergenic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003229558 6:4239744-4239766 AAAGAACTGTGGGCCAGGTTGGG - Intergenic
1003481957 6:6542817-6542839 GAAGAACTGCAGGCGGGCTGAGG - Intergenic
1003907106 6:10711797-10711819 AAAGAACTCTTGGCCAGGTGCGG - Intergenic
1004085528 6:12444630-12444652 GAAGAGCTTTCGGCCGGGCGCGG + Intergenic
1004197536 6:13518489-13518511 AAAGAAAAGTCGGCCCGGTGCGG + Intergenic
1004325229 6:14668614-14668636 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1004795553 6:19079706-19079728 GAAGCTCTTCCGGCCGGGTGCGG + Intergenic
1005078626 6:21934042-21934064 AATGAACTGTTGGCCAGGTGCGG - Intergenic
1005246861 6:23895915-23895937 GAAAATCTGTTGGCCGGGTATGG - Intergenic
1005282614 6:24290281-24290303 GAAGAGCTCTGGGCCGGGCGCGG - Intronic
1005889004 6:30121034-30121056 TAAGAACTTTGTGCCGGGTGCGG - Intergenic
1006129159 6:31858722-31858744 GAAGGAATGTAGGCTGGGTGCGG + Intronic
1006647603 6:35525702-35525724 GAAGAACTATCAGCCGGGCGTGG - Intergenic
1007042088 6:38732004-38732026 AAAGAAATGTAGGCTGGGTGTGG - Intronic
1007306758 6:40912840-40912862 TAAGCACTGTTGGCCGGGTATGG + Intergenic
1007466645 6:42056894-42056916 GAAGAAATCCAGGCCGGGTGCGG - Intronic
1007671331 6:43556836-43556858 AAAGAAATGAAGGCCGGGTGTGG + Intronic
1010437988 6:75858313-75858335 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1010445621 6:75945639-75945661 GGAGAAATTTTGGCCGGGTGTGG - Intronic
1010892020 6:81325028-81325050 GGAGAAGGGTCGGCTGGGTGCGG - Intergenic
1011072992 6:83406009-83406031 TAAAAACTCTTGGCCGGGTGCGG - Intronic
1011281269 6:85680148-85680170 GAAGCAAAGTAGGCCGGGTGTGG + Intergenic
1011429265 6:87267887-87267909 GTAGAAATGACGGCTGGGTGTGG - Intergenic
1011639171 6:89403149-89403171 TAAAAACTGTCGGCCGGGCGCGG + Intronic
1012288999 6:97427630-97427652 CAAGAACTGTCAGCAGGGAGTGG + Intergenic
1012445568 6:99303989-99304011 AAAACACGGTCGGCCGGGTGTGG + Intronic
1013360630 6:109390994-109391016 AAAGCACTCTCAGCCGGGTGCGG + Intronic
1014040364 6:116818242-116818264 AAAGAATTTTCGGCCGGGCGCGG + Intronic
1014537194 6:122628325-122628347 AAAGAACTGGAGGCCGGGCGCGG - Intronic
1014637542 6:123866718-123866740 GTAAAACTGTGGGCCGGGCGCGG - Intronic
1015424573 6:133050681-133050703 GAAAAATTGGCGGCCGGGCGCGG - Intergenic
1015606699 6:134963710-134963732 ATAGAACTCTCGGCCGGGCGCGG - Exonic
1016508546 6:144813476-144813498 GAAAAACTCTGGGCCAGGTGTGG - Intronic
1016941583 6:149486759-149486781 TAGGAGTTGTCGGCCGGGTGCGG - Intergenic
1017125269 6:151058964-151058986 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
1017143143 6:151209970-151209992 TAAGTACTGTAGGCTGGGTGAGG + Intergenic
1017588186 6:155949251-155949273 GAAGTCCTGTCTGCTGGGTGTGG - Intergenic
1017871693 6:158492146-158492168 AAAGAACTCTTGGCTGGGTGCGG - Intronic
1017915397 6:158827733-158827755 AAAGAAATAACGGCCGGGTGTGG + Intergenic
1017926911 6:158918445-158918467 AAAGAACTGTTGGCCGGGTGCGG - Intergenic
1018322946 6:162633142-162633164 AAAAAAATGTAGGCCGGGTGCGG + Intronic
1018825862 6:167407506-167407528 GCAGAACTGGCTGCCGTGTGTGG + Intergenic
1018939646 6:168300694-168300716 TAAGAACTCTCAGCCGGGTGTGG + Intronic
1019496703 7:1343971-1343993 AAAGAGGTGTAGGCCGGGTGCGG + Intergenic
1019885747 7:3903434-3903456 AAAAAACTGTCGGCCGGGCGCGG - Intronic
1020062635 7:5164048-5164070 GAAGGACGGTTGGCCGGGCGCGG + Intergenic
1020253863 7:6490678-6490700 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1020652321 7:10890356-10890378 GAATTACTGTAGGCCAGGTGTGG + Intergenic
1020762584 7:12286638-12286660 TAAGAAATGTTGGGCGGGTGCGG - Intergenic
1021012910 7:15493663-15493685 AAAGAAATGTGGGCCGGGCGCGG - Intronic
1021545862 7:21812381-21812403 AATGAACTGTCCGCCGGGTGTGG + Intronic
1021864459 7:24941107-24941129 AAAGCAATGTTGGCCGGGTGCGG - Intronic
1021979499 7:26040585-26040607 TAGGTACTGTTGGCCGGGTGTGG + Intergenic
1023500825 7:40847703-40847725 AAAGAAATGTGGGCCGGATGTGG - Intronic
1025778766 7:64581073-64581095 ATATAACTGTCGGCCGGGTGCGG + Intergenic
1026325953 7:69310609-69310631 CAAAAACTGGCTGCCGGGTGCGG - Intergenic
1026570495 7:71525494-71525516 CAAGAACAGTTGGCCGGGTGCGG - Intronic
1026704883 7:72681873-72681895 AAAAAACAGACGGCCGGGTGCGG - Intronic
1026905143 7:74058644-74058666 GAAGTACTGCAGGCCGGGTGTGG - Intronic
1027005873 7:74692358-74692380 AAAGAACTCCCGGCCGGATGTGG - Intronic
1027154828 7:75759333-75759355 TAAGAACTATTGGCTGGGTGTGG - Intergenic
1027542386 7:79483835-79483857 GAAGAACTACTGGCCGGTTGCGG + Intergenic
1027673134 7:81127004-81127026 GAGGAACTCTCGGCCAGGCGTGG - Intergenic
1027919623 7:84376310-84376332 TAAGAAGTGTTGGCCGGGCGCGG + Intronic
1028522686 7:91749087-91749109 TAAGAATTCTCGGCCGGGCGCGG - Intronic
1028927006 7:96369162-96369184 GAATTACTTTTGGCCGGGTGTGG + Intergenic
1029197056 7:98812430-98812452 GAATAAATGTGGGCTGGGTGTGG - Intergenic
1029532193 7:101132760-101132782 GATGAACTGGTGGCTGGGTGTGG + Intronic
1030022587 7:105290746-105290768 GAAGAAATGAAGGCCGGGCGCGG + Intronic
1030507382 7:110442049-110442071 AAAGAACTGCTGGCCGGGCGCGG - Intergenic
1030958526 7:115886268-115886290 GAAGAACTCTTGGCCGGGTGCGG + Intergenic
1031556929 7:123188823-123188845 GAAAATCTTTCGGCCGGGTGCGG + Intronic
1031637787 7:124122410-124122432 AAATAAATGTGGGCCGGGTGCGG + Intergenic
1031999845 7:128257745-128257767 GAATAACTGGCGGCTGGCTGTGG - Intergenic
1033014221 7:137655486-137655508 GAATAACTCTGGGCTGGGTGTGG - Intronic
1033190650 7:139275673-139275695 AAAGATCTGTTGGCCAGGTGTGG + Intronic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1033241728 7:139685451-139685473 GAAAACCTGTTGGCCGGGTGTGG - Intronic
1034000611 7:147408468-147408490 GAGGACCTTGCGGCCGGGTGTGG + Intronic
1034333712 7:150306554-150306576 AAACAACTGTGGGCCGGGTATGG + Intronic
1034664334 7:152803336-152803358 AAACAACTGTGGGCCGGGTATGG - Intronic
1036809150 8:11855308-11855330 TAAGATCTGTGGGCCTGGTGCGG - Intronic
1037382416 8:18300431-18300453 AAAGAAATCTCGGCCGGGTGTGG - Intergenic
1037627448 8:20620393-20620415 TAAAAAGTGTTGGCCGGGTGTGG + Intergenic
1037673004 8:21031245-21031267 GTAGAACTGTGGGCCGGGAGTGG + Intergenic
1037871211 8:22498832-22498854 GTAGAATTATTGGCCGGGTGCGG + Intronic
1037942174 8:22959871-22959893 GTTGAAATGTTGGCCGGGTGTGG + Intronic
1039048979 8:33475781-33475803 GAAGAAAACTCGGGCGGGTGTGG + Intronic
1039049982 8:33484367-33484389 GAAAGACTGTCGGCCGGGCCGGG - Intronic
1039556249 8:38477371-38477393 AAAGAACTTTTGGCTGGGTGTGG - Intergenic
1039927147 8:41945558-41945580 GAAGTACTGTGGGCCGGGTGTGG - Intronic
1042153352 8:65814219-65814241 AAAGGACTTTCGGCCGGGCGCGG + Intronic
1042277986 8:67025712-67025734 AAAGGACAGTAGGCCGGGTGCGG + Intronic
1043418110 8:80072018-80072040 TAAGAAATGTAGGCCGGGCGCGG + Intronic
1044638236 8:94350302-94350324 AAAGAACTAGAGGCCGGGTGCGG + Intergenic
1045025919 8:98086658-98086680 AAGGAAATGTGGGCCGGGTGCGG + Intronic
1045090468 8:98737998-98738020 GAAAATCATTCGGCCGGGTGCGG - Intronic
1045296224 8:100873662-100873684 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1045361372 8:101436681-101436703 AAAGTACTATTGGCCGGGTGCGG - Intergenic
1046173099 8:110538353-110538375 AAAGCACTTTCGGCCAGGTGTGG + Intergenic
1046891056 8:119421297-119421319 GAACCACTGTCGGCCGGGCGCGG - Intronic
1046932172 8:119852643-119852665 GAAGAAATTTGGGCCAGGTGTGG - Intronic
1047972881 8:130100617-130100639 GAAGAAGTAGAGGCCGGGTGTGG - Intronic
1048780373 8:137992598-137992620 CAAGAAGTTTAGGCCGGGTGTGG - Intergenic
1049384904 8:142338280-142338302 GATGAACACTCGGCCGTGTGTGG + Intronic
1049394934 8:142395558-142395580 GAAGATCTGTCGCCAGGGGGCGG + Intronic
1051234886 9:14989544-14989566 GATAAAGTGACGGCCGGGTGTGG + Intergenic
1051642548 9:19237307-19237329 TAAAAGCTGTCGGCCGGGCGTGG - Intronic
1051720128 9:20028578-20028600 GAAGAAGTGAGGGCAGGGTGGGG - Intergenic
1051751759 9:20350303-20350325 GAAAAACAGGCGGCCGGGCGCGG + Intronic
1051823889 9:21197678-21197700 AATGAAATGTCGGCCGGGCGCGG + Intergenic
1052531796 9:29694618-29694640 AAAAAACAGTCAGCCGGGTGTGG + Intergenic
1053247390 9:36545788-36545810 AAAGAATAGGCGGCCGGGTGCGG + Intergenic
1054991169 9:71328454-71328476 AAAGAGAAGTCGGCCGGGTGCGG - Intronic
1055340876 9:75281319-75281341 AAAGAATTGTTGGCCGGGCGCGG - Intergenic
1055752037 9:79517396-79517418 GAAGAAATGGAGGCTGGGTGCGG + Intergenic
1055927271 9:81523585-81523607 GTGGAAATATCGGCCGGGTGCGG + Intergenic
1056176432 9:84041186-84041208 GAAAAAATGTTGGCCAGGTGTGG - Intergenic
1056393993 9:86164854-86164876 GAAGAGCTGTCAGCTGGGTGTGG + Intergenic
1056418594 9:86401793-86401815 TTAGAACTCTGGGCCGGGTGCGG + Intergenic
1057316169 9:93969958-93969980 GAAGTAGGGTCGGCTGGGTGCGG - Intergenic
1057343542 9:94225946-94225968 AAAGAACTTTTGGCTGGGTGTGG - Intergenic
1057508205 9:95654143-95654165 AAAGAACCTTCGGCCGGGTGTGG - Intergenic
1057789494 9:98114610-98114632 TAAAAATTGTCGGCTGGGTGCGG - Intronic
1058696897 9:107566320-107566342 GAAGCACTGGGGGCCGGGCGCGG - Intergenic
1059011463 9:110466466-110466488 AAAGAACTGGCGGCCGGGCACGG + Intronic
1059078482 9:111221078-111221100 GAAGAAATATAGGCCAGGTGCGG - Intergenic
1059113212 9:111576798-111576820 AAAGAACTCTTGGCCAGGTGTGG + Intronic
1059645921 9:116267581-116267603 TAAGAAATGGCGGCCGGGTGCGG + Intronic
1060330152 9:122660773-122660795 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1060412572 9:123409799-123409821 TAAGAACCGTTGGCCGGGTGCGG + Intronic
1060605958 9:124914205-124914227 GAATAACTGTAGGCTGGGCGTGG + Intronic
1060823683 9:126675434-126675456 TAAAAAATGTTGGCCGGGTGCGG + Intronic
1061118892 9:128631133-128631155 GAAGAGCCCTCGGCCGGGAGTGG - Intronic
1061478130 9:130882884-130882906 AAAAAACTGTTGGCCGGGCGTGG + Intronic
1061521910 9:131123421-131123443 GAACCTCTGTCGGCCGGGCGCGG + Intergenic
1062504170 9:136864911-136864933 GTAGAAATGTTGGCCGGGCGCGG - Intronic
1185661306 X:1731034-1731056 AAAAAAGGGTCGGCCGGGTGCGG + Intergenic
1186135747 X:6518640-6518662 GAAAAACTCTGGGCCGGGTGTGG - Intergenic
1187051517 X:15701204-15701226 TAAGAAGTCTAGGCCGGGTGCGG + Intronic
1187353163 X:18540975-18540997 AAAGAACTGTCGGCCGGGCGTGG - Intronic
1188660061 X:32748050-32748072 GAAAAAGTGTAGGCCAGGTGTGG + Intronic
1188829827 X:34882389-34882411 GAAAAAGTGTTGGCCGAGTGCGG - Intergenic
1190271729 X:48869525-48869547 AAAGAATTTTCTGCCGGGTGCGG + Intergenic
1190327922 X:49218194-49218216 GAATAAGTGTTTGCCGGGTGGGG + Intronic
1190546153 X:51529860-51529882 AAGGAACTGTAGGCCGGGCGCGG + Intergenic
1190689596 X:52902348-52902370 GAAGAAATGTGAGCCGGGTGTGG - Intronic
1190696387 X:52953444-52953466 GAAGAAATGTGAGCCGGGTGTGG + Intronic
1190715550 X:53100188-53100210 GAAAATCTGTTGGCCAGGTGCGG + Intergenic
1190715598 X:53100507-53100529 GAAAATCTGTTGGCCGGGTGCGG + Intergenic
1192311814 X:70022624-70022646 AAAGAAATGTCGGCCGGGGGTGG - Intronic
1192464551 X:71344947-71344969 AAATAATTGTTGGCCGGGTGCGG - Intergenic
1192545725 X:72011379-72011401 AAAAAACTGACGGCCAGGTGCGG + Intergenic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1192747833 X:73957103-73957125 TGAGAACTGTTGGCCGGGGGTGG - Intergenic
1193659661 X:84241612-84241634 AAAAAACTGTGGGCCTGGTGCGG - Intergenic
1193718916 X:84965297-84965319 TAAAAACTGTAGGCCGGGCGTGG - Intergenic
1194222728 X:91215299-91215321 TAAGAAGTGTCGGCCGGGCGCGG - Intergenic
1194745506 X:97623534-97623556 AAAGGACTTTAGGCCGGGTGTGG - Intergenic
1195225260 X:102785638-102785660 GAAGAATAGTTGGCTGGGTGTGG - Intergenic
1195896020 X:109747071-109747093 GAAGAAACTTCGGCCAGGTGCGG + Intergenic
1195903384 X:109821300-109821322 GAATAACTCCCGGCCGGGCGCGG + Intergenic
1196796789 X:119508298-119508320 TAAGAATTCCCGGCCGGGTGTGG - Intergenic
1197210000 X:123820515-123820537 GTGGATTTGTCGGCCGGGTGAGG - Intergenic
1198537452 X:137600665-137600687 TAGGTACTGTGGGCCGGGTGTGG - Intergenic
1198690859 X:139282757-139282779 AAAGAACTGGAGGCCGGGCGCGG - Intergenic
1198767796 X:140095984-140096006 GAAGCACTGTAGGCTGGGCGCGG - Intergenic
1199591888 X:149475413-149475435 GTTGAACTTTCGGCCGGGTGTGG - Intergenic
1200171856 X:154082540-154082562 AAAGCATTTTCGGCCGGGTGTGG - Intronic
1200803600 Y:7409853-7409875 AAAGAATTCTCAGCCGGGTGTGG + Intergenic
1200945860 Y:8836273-8836295 AAACAACAGTCGGCGGGGTGCGG - Intergenic
1201014513 Y:9586713-9586735 GAGGAAAGGTGGGCCGGGTGCGG + Intergenic
1201272432 Y:12268026-12268048 GAAAAATTGTAGGCCGGGTGCGG - Intergenic
1202037912 Y:20654182-20654204 AAAGAAGTGGCGGCCGGGCGCGG + Intergenic
1202360981 Y:24110175-24110197 TGAGAAATGTCGGCCGGGCGCGG + Intergenic
1202509797 Y:25559943-25559965 TGAGAAATGTCGGCCGGGCGCGG - Intergenic