ID: 1139765731

View in Genome Browser
Species Human (GRCh38)
Location 16:69228216-69228238
Sequence TAGATTATGACCGGCCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139765731 Original CRISPR TAGATTATGACCGGCCGCGG TGG Intronic
900248274 1:1649984-1650006 GAAATTAAGACCGGGCGCGGTGG + Intronic
904155984 1:28483512-28483534 TAAATCATGGCCGGACGCGGTGG + Intronic
905075347 1:35266078-35266100 AAGATAATGGCCGGGCGCGGTGG + Intergenic
909045934 1:70709783-70709805 TACATGCTGGCCGGCCGCGGTGG + Intergenic
909146690 1:71942787-71942809 TAGATTTAGGCCGGGCGCGGTGG - Intronic
910662147 1:89685400-89685422 TAGACAATGGCCGGGCGCGGTGG - Intronic
912114455 1:106388131-106388153 TAACTTATGGCCGGGCGCGGTGG + Intergenic
912787874 1:112621537-112621559 GAAATTTTGGCCGGCCGCGGTGG - Intronic
913241178 1:116831151-116831173 CAGATTGTGGCCGGGCGCGGTGG + Intergenic
914781827 1:150792492-150792514 TAAATTAAGGCCGGGCGCGGTGG + Intergenic
914868990 1:151458308-151458330 GTGATTATGTCCTGCCGCGGTGG - Intronic
914930409 1:151926265-151926287 AAGAACATGGCCGGCCGCGGTGG - Intergenic
915189358 1:154135706-154135728 ATGATTATGGCCGGGCGCGGTGG - Intronic
915295109 1:154915020-154915042 TAGATCATGGCCGGGCGCAGTGG + Intergenic
915525122 1:156471414-156471436 TTGATTCTGGCCGGGCGCGGTGG - Intronic
915580607 1:156810806-156810828 TAGCTTATGGCCGGGCGCAGTGG - Intronic
916224272 1:162474240-162474262 TAGAGAATGGCCGGGCGCGGTGG + Intergenic
922437605 1:225621577-225621599 TAGATTTAGGCCGGGCGCGGTGG - Intronic
923370668 1:233309252-233309274 TGGAATATGGCCGGGCGCGGTGG + Intergenic
923722274 1:236477226-236477248 TGGATTATGGCCGGGCACGGTGG + Intronic
1063484363 10:6405268-6405290 CAGAATCTGACCGGGCGCGGTGG - Intergenic
1063796602 10:9519722-9519744 TCAATTATGGCCGGGCGCGGTGG - Intergenic
1064434912 10:15302899-15302921 TTGATTAAGGCCGGGCGCGGTGG + Intronic
1065057629 10:21862714-21862736 TAGTTTATGACCGGGCACAGTGG - Intronic
1065986560 10:30959449-30959471 TAAATTTTGGCCGGGCGCGGTGG + Intronic
1066300503 10:34091661-34091683 TAGATTCTGACCGGGTGTGGTGG - Intergenic
1072413477 10:95227778-95227800 TAGAATCTGGCCGGGCGCGGTGG + Intronic
1073414835 10:103372313-103372335 AAGATTATGGCTGGGCGCGGTGG + Intronic
1074787408 10:116853006-116853028 TAGATAATGGCCGGGCGCGGTGG + Intronic
1074797497 10:116963357-116963379 TTTATTATGGCCGGGCGCGGTGG - Intronic
1075366796 10:121897539-121897561 TAGATTCTGGCCGGACCCGGTGG + Intronic
1075530308 10:123223477-123223499 TAGATTTTGACCAGGCGCAGTGG - Intergenic
1075837402 10:125466508-125466530 TAGATTAGTGCCGGGCGCGGTGG - Intergenic
1076656625 10:132028365-132028387 AAGATTTTGGCCGGGCGCGGTGG - Intergenic
1081209903 11:40320216-40320238 TAGAAAATGGCCGGGCGCGGTGG + Intronic
1082172715 11:49025484-49025506 TGGCTTATGACCGGGCGCGGTGG + Intergenic
1083092447 11:60214191-60214213 TAGATTCTGGCCGGGCGCGGTGG - Intronic
1083439908 11:62669205-62669227 CAGATTAAGGCTGGCCGCGGTGG - Intronic
1084995451 11:72973079-72973101 TAAGTTATGGCCGGGCGCGGTGG + Intronic
1085077987 11:73609005-73609027 TTGATTAAGGCCGGGCGCGGTGG + Intergenic
1086467303 11:87068521-87068543 TAATTTCTGACCGGGCGCGGTGG + Intronic
1086693055 11:89810568-89810590 TTGCTTACGACCGGGCGCGGTGG - Intergenic
1087756088 11:102055954-102055976 TAGTTTAGGGCCGGGCGCGGTGG - Intronic
1089491455 11:118886706-118886728 TAGTTTATGACCAGCCTCTGTGG - Intronic
1090713757 11:129411983-129412005 TAGTTTATGGCCGGGCACGGTGG + Intronic
1091863074 12:3804410-3804432 TAGATCAAGGCCGGGCGCGGTGG + Intronic
1091872227 12:3903581-3903603 TATATTAGGGCCGGGCGCGGTGG + Intergenic
1092690648 12:11106225-11106247 TAAGTTATGGCCGGGCGCGGTGG - Intronic
1093690010 12:22100253-22100275 GAGATTCTGGCCGGGCGCGGTGG + Intronic
1095419654 12:42011962-42011984 TTGATTATGACCGGGCGCGGTGG - Intergenic
1096293402 12:50361856-50361878 TGGATAATGGCCGGGCGCGGTGG - Intronic
1097463078 12:59888167-59888189 CAGCTTATGGCCGGGCGCGGTGG + Intergenic
1099704253 12:86129844-86129866 AAGATTGTGGCCGGGCGCGGTGG - Intronic
1100840396 12:98607111-98607133 AAGATTATGGTCGGTCGCGGTGG + Intergenic
1101980820 12:109405595-109405617 TATTTTATGGCCGGGCGCGGTGG - Intronic
1102098702 12:110260837-110260859 AAAATTAAGACCGGGCGCGGTGG + Intergenic
1102376613 12:112426955-112426977 TAGATAATGGCCGGGCGTGGTGG + Intronic
1103386450 12:120536132-120536154 TAGAGTGAGACCGGGCGCGGTGG + Intronic
1105362786 13:19736105-19736127 TAGTTTTTGGCCGGGCGCGGTGG - Intronic
1105474043 13:20716020-20716042 TCGATTCTGGCCGGGCGCGGTGG - Intronic
1105779515 13:23694933-23694955 TACATTAAGGCCGGGCGCGGTGG - Intergenic
1107141363 13:37001120-37001142 AAGATTGTGGCCGGGCGCGGCGG + Intronic
1109161079 13:58975261-58975283 TACATTTTGGCCGGGCGCGGTGG - Intergenic
1110174133 13:72536179-72536201 TAGATTCAGGCCGGGCGCGGTGG - Intergenic
1110807397 13:79772342-79772364 TAGATTAGGGCCGGGAGCGGCGG - Intergenic
1110975085 13:81821474-81821496 TAGAAAATGGCCGGGCGCGGTGG - Intergenic
1111151103 13:84254386-84254408 TAAATTAAGGCCGGGCGCGGTGG + Intergenic
1111446509 13:88351332-88351354 TAGATTTAGGCCGGGCGCGGTGG - Intergenic
1112280403 13:98058086-98058108 TAGAGAATGGCCGGGCGCGGTGG + Intergenic
1112700930 13:102007029-102007051 AAGATTTTGGCCGGGCGCGGTGG - Intronic
1115164216 14:30429789-30429811 TGCATTAAGACCGGGCGCGGTGG - Intergenic
1115175375 14:30556419-30556441 TAAATTGTGGCCGGGCGCGGTGG + Intergenic
1116817508 14:49597934-49597956 AAAATTATGGCCGGGCGCGGTGG - Intronic
1117407929 14:55422534-55422556 TATTTTATGACCGGGCGCGGTGG - Intronic
1118074441 14:62283003-62283025 TAGCTTCTGGCCGGGCGCGGTGG + Intergenic
1118398881 14:65361498-65361520 TAGACTATGGCCGGGTGCGGTGG + Intergenic
1119659897 14:76443101-76443123 CACTTTATGACCGGGCGCGGTGG - Intronic
1120546819 14:85821599-85821621 TATAATACGACCGGGCGCGGTGG - Intergenic
1123702970 15:22929344-22929366 TAGATTATGACCGGGTGCAATGG + Intronic
1124448400 15:29761203-29761225 GAGATCGTGACCGGCTGCGGCGG + Exonic
1125576427 15:40758789-40758811 TAGCTTATGGCCGGGTGCGGTGG + Intergenic
1125663128 15:41410042-41410064 CAGATTCTGGCCGGGCGCGGTGG + Intronic
1126187652 15:45846375-45846397 TAGTTTATGGCCGGGCGTGGTGG + Intergenic
1126627834 15:50702095-50702117 TAGATTCTGGCCGGGCACGGTGG - Intergenic
1128168556 15:65489703-65489725 TACATTATGGCCGGGCGTGGTGG - Intronic
1131136600 15:89941443-89941465 TAGATCTTGGCCGGGCGCGGTGG - Intergenic
1131388361 15:92026799-92026821 TAGATTATGGCCGGGCACAGTGG + Intronic
1132030649 15:98436120-98436142 AAGTTTATGGCCGGGCGCGGTGG - Intergenic
1132109790 15:99094304-99094326 TAAATTTTGGCCGGGCGCGGTGG - Intergenic
1132922815 16:2407822-2407844 TAGATCTTGACCGGGCGTGGTGG - Intergenic
1136583067 16:31165980-31166002 AAAATTATGGCCGGGCGCGGTGG + Intergenic
1137416645 16:48288438-48288460 TACATTCTGACTGGGCGCGGTGG - Intronic
1137437334 16:48466452-48466474 TAAATTAAGGCCGGGCGCGGTGG - Intergenic
1137761970 16:50948335-50948357 TAACTAATGACCCGCCGCGGAGG - Intergenic
1139765731 16:69228216-69228238 TAGATTATGACCGGCCGCGGTGG + Intronic
1139900688 16:70326184-70326206 TACATTCTGGCCGGGCGCGGTGG + Intronic
1140386529 16:74544785-74544807 TAAATAATGGCCGGGCGCGGTGG - Intronic
1140400741 16:74669226-74669248 AACATTATGGCCGGGCGCGGTGG - Intergenic
1141082417 16:81064090-81064112 AGGAATATGGCCGGCCGCGGTGG + Intronic
1142742368 17:1938583-1938605 GAGATTCTGGCCGGGCGCGGTGG - Intronic
1142788153 17:2241676-2241698 GAGATAATGACCGGGTGCGGTGG - Intronic
1143074062 17:4324788-4324810 TAGTTTAAGGCCGGGCGCGGTGG + Intronic
1143535409 17:7535946-7535968 CAGTTTATGACCCGGCGCGGTGG - Intergenic
1143954871 17:10660386-10660408 TAGTTTCTGGCCGGGCGCGGTGG + Intergenic
1144101150 17:11943389-11943411 TAGGTTAGGGCCGGGCGCGGTGG + Intronic
1144507002 17:15840362-15840384 TAATTTATGGCCGGGCGCGGTGG - Intergenic
1145830907 17:27915404-27915426 TAAATTAGCACCGGCCGTGGTGG + Intergenic
1147282502 17:39373932-39373954 TAGATTATGGCCGGACACGGTGG + Intronic
1147730471 17:42597472-42597494 TAGATTCTGGCTGGGCGCGGTGG - Intronic
1148607755 17:48943180-48943202 CAGAATATGGCCGGGCGCGGTGG + Intronic
1148903253 17:50894435-50894457 TGAATTATGGCCGGGCGCGGTGG - Intergenic
1150016052 17:61558632-61558654 AAGAATATGGCCGGGCGCGGTGG + Intergenic
1152465275 17:80462777-80462799 TAGGTTAGGGCCGGGCGCGGTGG - Intergenic
1152478434 17:80533712-80533734 TAAATAATGACCGGGTGCGGTGG - Intergenic
1153367145 18:4269639-4269661 TAGAATATGGCCGGGCGCGGTGG - Intronic
1156813560 18:41281176-41281198 GAGATCATGGCCGGGCGCGGTGG - Intergenic
1157135321 18:45048683-45048705 AAGATTAGGGCCGGGCGCGGTGG + Intronic
1158998854 18:62952103-62952125 TTGATTATGGCCGGGCGCGGTGG - Intronic
1160198007 18:76773031-76773053 TTTATTTTGACCGGGCGCGGTGG + Intergenic
1161837412 19:6657410-6657432 TAGATGCTGGCCGGGCGCGGTGG - Intergenic
1162097586 19:8320139-8320161 AACATTCTGACCGGGCGCGGTGG - Intronic
1162229343 19:9252894-9252916 TACATTATGGCCGGGCGCGGTGG + Intergenic
1162448662 19:10740662-10740684 AAGATTTTGGCCGGGCGCGGTGG - Intronic
1163054462 19:14707836-14707858 AAGTTTATGGCCGGGCGCGGTGG - Intronic
1163234184 19:16021409-16021431 GAGTTCATGACCGGGCGCGGTGG + Intergenic
1163565562 19:18049127-18049149 TAGTTTATGGCCGGGCGCGGTGG + Intergenic
1163818408 19:19482115-19482137 TAAAATATGACCGAGCGCGGTGG + Intronic
1163890251 19:20005348-20005370 TAGTTTAAGGCCGGGCGCGGTGG - Exonic
1164802722 19:31091073-31091095 TAAATTAAGGCCGGGCGCGGTGG + Intergenic
1165019568 19:32912753-32912775 TAAAATATGGCCGGGCGCGGTGG + Intronic
1165664122 19:37611312-37611334 GAGATTATAGCCGGGCGCGGTGG - Intronic
1167306145 19:48710872-48710894 TAGGTTTTGGCCGGGCGCGGTGG - Intergenic
1167447291 19:49545170-49545192 TAGTTTATGGCCGGGCACGGTGG + Intronic
1167885131 19:52493701-52493723 TAAATAAGGACCGGGCGCGGTGG + Intronic
1168037202 19:53729391-53729413 TATATGATGACTGGGCGCGGTGG - Intergenic
1168569928 19:57458075-57458097 TAAATTATGGCCGGGCGAGGTGG - Intronic
1168708281 19:58482079-58482101 TTGATTTTGGCCGGGCGCGGTGG - Intronic
929627756 2:43427667-43427689 TATAATATGGCCGGGCGCGGTGG + Intronic
932154383 2:69402868-69402890 CAGATAAAGACCGGGCGCGGTGG - Intronic
932482599 2:72055472-72055494 TAGATCATGGCTGGGCGCGGTGG - Intergenic
932668234 2:73714758-73714780 TACATTATGGCTGGGCGCGGTGG - Intergenic
935479819 2:103572452-103572474 GAGAGTTTGACCGGGCGCGGTGG - Intergenic
935660520 2:105462877-105462899 AAGTTTATGGCCGGGCGCGGTGG - Intergenic
935820569 2:106888282-106888304 AAAATTATGGCCGGGCGCGGTGG + Intergenic
938007971 2:127804032-127804054 TAGATTGGGACCGGGTGCGGTGG + Intronic
938008543 2:127809721-127809743 TGGCTTATGGCCGGGCGCGGTGG - Intronic
941496799 2:166214799-166214821 AAGATTGTGGCCGGGCGCGGTGG - Intronic
941682894 2:168418074-168418096 GAAAATATGACCGGGCGCGGTGG + Intergenic
941723579 2:168837594-168837616 TATATTGTGACCGGGCGCGGTGG - Intronic
943813270 2:192217953-192217975 TATATTTTGGCCGGGCGCGGTGG + Intergenic
945617832 2:212095643-212095665 TAAATTTTGGCCGGGCGCGGTGG + Intronic
946899475 2:224358228-224358250 TACATTTTGGCCGGGCGCGGTGG + Intergenic
948036168 2:234859732-234859754 TAGATTCTGGCCAGGCGCGGTGG - Intergenic
1169436780 20:5599838-5599860 TAGATTTTGGCTGGGCGCGGCGG - Intronic
1169691808 20:8340709-8340731 TAGAATTTGGCCGGGCGCGGTGG - Intronic
1170531899 20:17301643-17301665 TATATTATGACCAGGCACGGTGG + Intronic
1172489420 20:35323132-35323154 TAGATTGGGGCCGGGCGCGGTGG - Intronic
1173731805 20:45334282-45334304 TAGATTTTGGCCGGGCGCGGTGG - Intronic
1173818189 20:46003618-46003640 TTGATTTTGACCGGGTGCGGTGG - Intergenic
1174133338 20:48361070-48361092 TGGTTTATGGCCGGGCGCGGTGG + Intergenic
1174541200 20:51291108-51291130 AACATTATGGCCGGGCGCGGTGG - Intergenic
1176698447 21:10010202-10010224 TATTTTATGGCCGGGCGCGGTGG - Intergenic
1177032205 21:15994930-15994952 GAGAATATGGCCGGGCGCGGTGG - Intergenic
1177451582 21:21275151-21275173 TAAATTTGGACCGGGCGCGGTGG + Intronic
1178925518 21:36771709-36771731 AAAATTATGGCCGGGCGCGGTGG + Intronic
1180660399 22:17462115-17462137 AAGATCTTGACCGGGCGCGGTGG + Intronic
1180697496 22:17761719-17761741 AAGATTATGGCCGGGTGCGGTGG - Intronic
950741308 3:15053967-15053989 AAGAATATGGCCGGGCGCGGTGG + Intronic
953302500 3:41792885-41792907 TAGAGTATGGCCGGGCGCAGTGG + Intronic
954265611 3:49468822-49468844 AAAATTTTGACCAGCCGCGGTGG - Intronic
954919230 3:54175327-54175349 CAGATTAAGGCCGGGCGCGGTGG + Intronic
957333746 3:78799626-78799648 TAGAGTAGGGCCGGGCGCGGTGG - Intronic
957535175 3:81493021-81493043 TAGACTATGACTAGCTGCGGTGG - Intronic
959094178 3:101935092-101935114 TAGATTTCGGCCGGGCGCGGTGG - Intergenic
959922648 3:111885354-111885376 TGGATTATCACCGGCGGCAGAGG + Exonic
961765430 3:129206686-129206708 TACATAATGGCCGGGCGCGGTGG + Intergenic
961976833 3:131034672-131034694 TAAATTGTGGCCGGGCGCGGTGG - Intronic
963915052 3:150851608-150851630 TAGCTTAAGGCCGGGCGCGGTGG + Intergenic
964162957 3:153668238-153668260 TAGTTTCTGGCCGGGCGCGGTGG + Intergenic
965124718 3:164611511-164611533 AAGATTATGCCCGGGCACGGTGG - Intergenic
966764334 3:183446642-183446664 TAGATGTTGGCCGGGCGCGGTGG - Intergenic
967940888 3:194765534-194765556 TAAATTCTGGCCGGGCGCGGTGG - Intergenic
970885954 4:20987710-20987732 TAGATATTGGCCGGGCGCGGTGG + Intronic
971663891 4:29457229-29457251 TAGATTTTGGCCGGGCGTGGTGG + Intergenic
971719397 4:30226370-30226392 GAAATTATGGCCGGGCGCGGTGG + Intergenic
973241619 4:47962056-47962078 TTAATTATGGCCGGGCGCGGTGG + Intronic
974856990 4:67473216-67473238 GAGATTTTGGCCGGGCGCGGTGG - Intronic
975576795 4:75871205-75871227 TAGATTTTGGCCGGGCGCGGTGG - Intronic
976229014 4:82821259-82821281 CAGATTATGGCCGGGCGTGGTGG + Intronic
976589730 4:86837029-86837051 TATATTATGGCCGGGCGTGGTGG - Intronic
976668803 4:87629032-87629054 TAGGTTATGGCCGGGCGCAGTGG + Intergenic
977487926 4:97672463-97672485 TAGTTTGTGACCGGGCGTGGTGG - Intronic
980219089 4:129892365-129892387 TAGATTTTGGCCGGGCACGGTGG + Intergenic
981323171 4:143416481-143416503 TAGATTATGGCCGGGCACAGTGG + Intronic
982795722 4:159641340-159641362 CAGCTTATGGCCGGGCGCGGTGG + Intergenic
983127563 4:163972842-163972864 TACATTAAGGCCGGGCGCGGTGG - Intronic
984263728 4:177471670-177471692 TAGTTTTTGGCCGGGCGCGGTGG + Intergenic
984537707 4:180997339-180997361 TAGATGATGGCCGGGCACGGTGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984962937 4:185115360-185115382 TAGATAAGGGCCGGGCGCGGTGG + Intergenic
985113048 4:186565464-186565486 TAGATTATGGCCGGGCACGGTGG - Intergenic
985320586 4:188706497-188706519 TAGAACATGGCCGGGCGCGGTGG - Intergenic
987936246 5:24468896-24468918 TAGTTTGTGACCGGGCGCGGTGG - Intergenic
988807165 5:34751136-34751158 AAAATTATGGCCGGGCGCGGTGG - Intronic
991698527 5:69296262-69296284 TAGATTCTGGCCAGGCGCGGTGG + Intronic
992070953 5:73148706-73148728 TAACTTATGACCTGGCGCGGTGG + Intergenic
998736248 5:145144652-145144674 TAATTTATGGCCGGGCGCGGTGG + Intergenic
999207368 5:149859110-149859132 TAGATGTTGGCCGGGCGCGGTGG - Exonic
999950655 5:156646269-156646291 TAGGTTCTGACAGGCAGCGGTGG - Intronic
1001627810 5:173151120-173151142 TAAGTTTTGACCGGGCGCGGTGG - Intronic
1001734335 5:173986677-173986699 TAAATTAGGCCCGGGCGCGGTGG + Intronic
1002962873 6:1932823-1932845 TACATTTTGAGCGGGCGCGGTGG - Intronic
1004157339 6:13181944-13181966 TAGAAAATGGCCGGGCGCGGTGG + Intronic
1004910105 6:20274643-20274665 TAGATTTAGGCCGGGCGCGGTGG + Intergenic
1004995872 6:21192306-21192328 TGAATTATGGCCGGGCGCGGTGG - Intronic
1005595257 6:27372992-27373014 TAGCTCATGGCCGGGCGCGGTGG - Intergenic
1005614026 6:27555777-27555799 AAGATTAAGACCGGGCGCGGTGG - Intergenic
1005903216 6:30237458-30237480 TAGGTTTTGGCCGGGCGCGGTGG - Intergenic
1006895331 6:37464980-37465002 TATATTATGGCCGGGCGCGGTGG + Intronic
1009949711 6:70381365-70381387 AACATTATGGCCGGTCGCGGTGG + Intergenic
1009976774 6:70679304-70679326 TAGATTCTGGCCAGGCGCGGTGG - Intronic
1010068285 6:71711378-71711400 TAAATTCTGGCCGGGCGCGGTGG - Intergenic
1010222634 6:73461069-73461091 TAGATTCGGGCCGGGCGCGGTGG - Intergenic
1012293032 6:97482282-97482304 TAAATGATGACTGGGCGCGGTGG - Intergenic
1013084316 6:106842477-106842499 TAGACTCTGGCCGGGCGCGGTGG - Intergenic
1014597758 6:123366803-123366825 TAGACTATGGCCGGGCGTGGTGG - Intronic
1016063824 6:139658046-139658068 AAGAGTATGGCCGGGCGCGGTGG - Intergenic
1016435191 6:144029964-144029986 TAAATTTTGACTGGGCGCGGTGG + Intronic
1020062952 7:5166293-5166315 TAGGGTCTGGCCGGCCGCGGTGG - Intergenic
1020433319 7:8135312-8135334 AAGATTCTGGCCGGGCGCGGTGG - Intronic
1023268414 7:38433436-38433458 AAGATCATGGCCGGGCGCGGTGG + Intronic
1023403308 7:39806459-39806481 TATATTATGGCCGGGCGCGGTGG - Intergenic
1024271566 7:47646275-47646297 CAGATTCTGGCCGGGCGCGGTGG + Intergenic
1027982605 7:85244996-85245018 TAGATTCTGGCCGGGCGCAGTGG - Intergenic
1029109878 7:98207798-98207820 AAGATTTTGGCCGGGCGCGGTGG + Exonic
1029348321 7:99994689-99994711 TAGATTAAGGCCAGGCGCGGTGG - Intergenic
1029416792 7:100448199-100448221 TAAATTATGGCCGGGCGTGGTGG + Intergenic
1030120630 7:106107451-106107473 TGGATTATGGCCGGCTGCAGTGG + Intronic
1033135075 7:138777325-138777347 AATATTATGGCCGGGCGCGGTGG + Intronic
1033195602 7:139324681-139324703 CAGAATATGGCCGGGCGCGGTGG + Intergenic
1033983908 7:147199247-147199269 TTGATTAGGGCCGGGCGCGGTGG - Intronic
1034104141 7:148476249-148476271 TAATTTATGGCCGGGCGCGGTGG - Intergenic
1035207997 7:157307331-157307353 TACTTTCTGACCGGGCGCGGCGG + Intergenic
1037368774 8:18150821-18150843 TAAATAATGGCCGGGCGCGGTGG + Intergenic
1042272911 8:66973591-66973613 TAGATTTTGGCTGGGCGCGGTGG - Intronic
1042285208 8:67102303-67102325 AAGGTTATGACAGGTCGCGGTGG + Intronic
1042403900 8:68381443-68381465 TATATTAAGGCCGGGCGCGGTGG + Intronic
1042550976 8:69993911-69993933 AAAATTAAGACCGGGCGCGGTGG - Intergenic
1043061684 8:75512749-75512771 AAGATGTTGACCGGGCGCGGTGG - Intronic
1044023440 8:87137487-87137509 TGGAATCTGGCCGGCCGCGGTGG - Intronic
1044655526 8:94544383-94544405 AAGATTATGGCCGGGCGCAGTGG + Intronic
1044710877 8:95056617-95056639 TAGATAATGGCCGGGTGCGGTGG + Intronic
1045231209 8:100309510-100309532 GATATTATGACGGGCCGAGGCGG - Intronic
1045277988 8:100723665-100723687 TAAAATGTGACCGGGCGCGGTGG + Intergenic
1046437482 8:114210759-114210781 TATATTATGGCCAGGCGCGGTGG - Intergenic
1047450825 8:124963636-124963658 TAGAGCAAGTCCGGCCGCGGTGG - Intergenic
1047451898 8:124972720-124972742 TAGATTGAGGCCGGGCGCGGTGG + Intergenic
1049342790 8:142122321-142122343 TAAAATATGACCTGCCTCGGCGG + Intergenic
1049524256 8:143113390-143113412 TACATTATGGCCGGGCGCAGTGG + Intergenic
1050890952 9:10823928-10823950 TAGATTAAGGCCGGGGGCGGTGG + Intergenic
1052141622 9:24992074-24992096 AAGATTTTGGCCGGGCGCGGTGG - Intergenic
1052916947 9:33930608-33930630 CAGATGATGGCCGGGCGCGGTGG + Intronic
1055330730 9:75180644-75180666 GAGTTTATGGCCGGGCGCGGTGG + Intergenic
1055636071 9:78280712-78280734 TAGATTTGGGCCGGGCGCGGTGG + Intergenic
1055826207 9:80328175-80328197 TAGATTAAGACCGGGTGCGGTGG + Intergenic
1056172895 9:84005378-84005400 TAGATTAGGGCCGGGCGTGGTGG + Intergenic
1056594267 9:87993069-87993091 TAGGACATGACCGGGCGCGGTGG - Intergenic
1056783520 9:89570550-89570572 TAGATTTTGGCCGGTCGCGGTGG + Intergenic
1057041473 9:91851063-91851085 TAGATTCCGGCCGGGCGCGGTGG + Intronic
1057356018 9:94332280-94332302 GAGAGTCTGACCGGGCGCGGTGG - Intergenic
1057507024 9:95643140-95643162 TACCTTATGGCCAGCCGCGGTGG - Intergenic
1057651735 9:96925348-96925370 GAGAGTCTGACCGGGCGCGGTGG + Intronic
1058782551 9:108352881-108352903 AAAATTATGGCCGGGCGCGGTGG + Intergenic
1059023887 9:110604050-110604072 GGAATTATGACCGGGCGCGGTGG - Intergenic
1059535850 9:115079971-115079993 TAAATTGTGGCCGGCCGTGGCGG + Intronic
1060347673 9:122830853-122830875 TTGAATATGGCCGGGCGCGGTGG - Intergenic
1061171062 9:128954669-128954691 GACATTGTCACCGGCCGCGGTGG - Intronic
1062355297 9:136159152-136159174 TGGATTAGGACCGGCTGCTGCGG - Intergenic
1186467435 X:9794655-9794677 TAGTTTATGGCTGGGCGCGGTGG - Intronic
1187350011 X:18504642-18504664 CAGATTTTGGCCGGGCGCGGTGG + Intronic
1189801616 X:44696877-44696899 TAGATCTTGGCCGGGCGCGGTGG + Intergenic
1189811390 X:44784022-44784044 TATCTCATGACCGGGCGCGGTGG + Intergenic
1190308476 X:49100521-49100543 TACATTTTGGCCGGGCGCGGTGG - Exonic
1190833881 X:54082694-54082716 TAGTTTAGGACCGGGCACGGTGG - Intronic
1192012881 X:67293916-67293938 GACATCATGACCGGGCGCGGTGG - Intergenic
1194723623 X:97369193-97369215 TAGATTCTGGCTGGTCGCGGTGG - Intronic
1196300850 X:114048265-114048287 TAAATTATAGCCGGGCGCGGTGG + Intergenic
1198237671 X:134750667-134750689 TGAATTATGACCGGACGCAGTGG + Intronic
1198998205 X:142601006-142601028 AAGCTTATGGCCGGGCGCGGTGG - Intergenic
1199833596 X:151566777-151566799 CAGATTTTGTCCGGACGCGGTGG + Intronic
1201330438 Y:12814239-12814261 TTGTTTATGGCCGGGCGCGGTGG + Intronic
1201608243 Y:15811431-15811453 TAGATTGTGGCCAGGCGCGGTGG + Intergenic