ID: 1139766610

View in Genome Browser
Species Human (GRCh38)
Location 16:69235804-69235826
Sequence CTAAGTTTCTTCAAATATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139766609_1139766610 6 Left 1139766609 16:69235775-69235797 CCAATATCAGGGGCACATCAGCT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1139766610 16:69235804-69235826 CTAAGTTTCTTCAAATATCCTGG 0: 1
1: 1
2: 0
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139766610 Original CRISPR CTAAGTTTCTTCAAATATCC TGG Intronic
906183814 1:43844408-43844430 CTAAATTCCTTCAAATTTCCTGG - Intronic
906489666 1:46258550-46258572 GTAAGGTTCTACAAATATCCAGG - Intronic
909578646 1:77206207-77206229 CTATGTCTCTTCTAATATCTAGG + Intronic
910000213 1:82332370-82332392 TTCTATTTCTTCAAATATCCAGG - Intergenic
910093681 1:83495612-83495634 TTATTTTTCTTCAAATAACCAGG - Intergenic
911798450 1:102103824-102103846 CTAAGTTCCTTCCAAAGTCCAGG + Intergenic
911889192 1:103345250-103345272 CTAAGTTCCTTGGAATTTCCTGG - Intergenic
911988032 1:104656702-104656724 CCAAGTTCTTTCAAATATCTGGG - Intergenic
912573713 1:110644425-110644447 CTGAGGTTCTTCATATATGCAGG - Intergenic
912895003 1:113576913-113576935 ATAAGATTTTTCCAATATCCTGG - Intronic
914401141 1:147321267-147321289 CTTAATTTCGTCATATATCCAGG - Intergenic
917203558 1:172544078-172544100 GTAAATTTTTTCAGATATCCAGG + Intronic
917405826 1:174707745-174707767 CTTAATTTCTTCAATTATCTAGG + Intronic
917695013 1:177513368-177513390 CTAAATTCCTTAAAATATCCTGG + Intergenic
919507247 1:198414732-198414754 TTAAGGTTCTTCAAATTTCAAGG + Intergenic
924933570 1:248749337-248749359 TTTAATTTCTTCTAATATCCAGG - Intronic
1064119953 10:12609899-12609921 CTATTTTTCTTCAACTCTCCAGG - Intronic
1064132984 10:12726683-12726705 CTCAGTTTCTTCAATCATCATGG - Intronic
1068014616 10:51500521-51500543 CCCAGTTTCTACCAATATCCAGG + Intronic
1068210963 10:53919875-53919897 CTAAGTTTTTATAAATACCCAGG + Intronic
1068883759 10:62077262-62077284 AAAAGTTTCTTGAAATATCCAGG - Intronic
1068974789 10:62996887-62996909 CTGATTTTTTTCCAATATCCTGG - Intergenic
1070233678 10:74599968-74599990 CTAAGTATCAGCAAATATCCAGG - Intronic
1071304882 10:84290491-84290513 CTAAGTCTCTTCCAAATTCCTGG + Intergenic
1072432329 10:95384215-95384237 GTAAGTGACTTCAAATAACCTGG - Intronic
1074136101 10:110627474-110627496 CTAAGTTTCTTCACCTTCCCAGG + Intergenic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1084890772 11:72235893-72235915 CTCTGGTTCTTCAAATAACCTGG - Exonic
1087424418 11:97969819-97969841 GTAATTTTCTTCCAATATCAGGG + Intergenic
1088109393 11:106245043-106245065 CTAAATATCTTGAAATTTCCTGG - Intergenic
1088415486 11:109584218-109584240 CTAACATTCCTCAAATCTCCAGG - Intergenic
1091870705 12:3888606-3888628 CTAAGTTTTCTCATTTATCCTGG + Intergenic
1094016353 12:25868807-25868829 CTAATTTTCTTGTAATATCTTGG - Intergenic
1098574968 12:72030709-72030731 TTAAGTATCCTCAAATATACAGG + Intronic
1100167215 12:91929623-91929645 CTAGGTTTCCTCAAATCCCCTGG - Intergenic
1101095184 12:101331352-101331374 ATATGTTTTTTCAAATATCAGGG + Intronic
1102006800 12:109594330-109594352 CTAGGTTTCTTCAGTTATGCAGG - Intronic
1105329764 13:19404766-19404788 CTAAATATCATAAAATATCCAGG - Intergenic
1105675319 13:22665023-22665045 TTAAGTTTCTTTAACTATACGGG - Intergenic
1105729955 13:23202631-23202653 CACAGTATTTTCAAATATCCAGG - Intronic
1105863742 13:24440544-24440566 CTAATATTTATCAAATATCCAGG + Intronic
1106213672 13:27674631-27674653 CTATTTTTCTTAAAATATCTAGG - Intergenic
1107026481 13:35806885-35806907 CTCATTTTCTTCAACTGTCCAGG - Intronic
1107441962 13:40435886-40435908 CTAGTTTTCTCCAAATATACTGG + Intergenic
1107502888 13:40998750-40998772 CTAAAGTGCATCAAATATCCTGG + Intronic
1107826300 13:44331827-44331849 GTAAGTTTCTGAAAATATACAGG - Intergenic
1110481269 13:75980008-75980030 ATAATTTACTTCAAAGATCCTGG + Intergenic
1110627392 13:77666638-77666660 CTTAATCTCCTCAAATATCCAGG + Intergenic
1110916659 13:81030031-81030053 CCAAGTTCCTTCAAATACCTGGG - Intergenic
1112171278 13:96974847-96974869 CTAAGTATACACAAATATCCTGG - Intergenic
1112539952 13:100299025-100299047 CTAACTTGCTTCAATTTTCCAGG - Intronic
1115602522 14:34968951-34968973 CAAAGTTTCTAAATATATCCTGG + Intergenic
1115641909 14:35340491-35340513 CTCAGTTCCTTCATATTTCCAGG + Intergenic
1118372794 14:65152169-65152191 CTAAGGTTCCTCAAATGCCCAGG + Intergenic
1120282704 14:82459302-82459324 TTAAACTTCTTAAAATATCCCGG - Intergenic
1120794524 14:88617835-88617857 CCAAATTTGTTCAAATTTCCTGG - Exonic
1122790811 14:104183450-104183472 CTCAGTTTCCCCAAATGTCCCGG - Intergenic
1123961101 15:25402135-25402157 CTCAGCTTCTTCAAATGTGCAGG - Intronic
1124189291 15:27559095-27559117 GTAAGTTTCTTAAAATATATGGG - Intergenic
1128039848 15:64562350-64562372 CAAAGTTTCTTCAAATGCCAAGG - Intronic
1129419136 15:75409401-75409423 CTAACTTCCTCCAAATATCTAGG + Intronic
1129907049 15:79195780-79195802 CAAAGTTTCCCCAAATAGCCAGG - Intergenic
1130449075 15:84032787-84032809 CTAAGCTTCAGTAAATATCCTGG + Intronic
1133927766 16:10207104-10207126 CTAAGTTTTTTAAATTATCATGG + Intergenic
1134847414 16:17451562-17451584 ATAAGTGTCTGCAAACATCCTGG + Intronic
1138941091 16:61791209-61791231 CTGAATTTCTTCAATTATCCTGG - Intronic
1139766610 16:69235804-69235826 CTAAGTTTCTTCAAATATCCTGG + Intronic
1143401028 17:6642325-6642347 GTAAGTATCTTTAAATATGCTGG + Intronic
1144593974 17:16550314-16550336 TTTAGTTTCTTCTAATAACCAGG + Intergenic
1155811252 18:30238607-30238629 CTACGTTTCTTAAAATTTTCTGG - Intergenic
1157025480 18:43837352-43837374 CTTAGTTTCTTCATAAATTCAGG - Intergenic
1157364225 18:47048795-47048817 CTAAGTTTATACGCATATCCTGG - Intronic
1157584650 18:48793287-48793309 CTAAGTCTCTTGACATTTCCTGG + Intronic
1158107172 18:53898898-53898920 CTCAGTTTCTTGAAACATTCAGG - Intergenic
1158619315 18:59017840-59017862 GCAAGTTTCTTCTTATATCCAGG - Intergenic
1163923050 19:20311425-20311447 ATAAGTTTTTTGAAATTTCCTGG + Intergenic
1163973368 19:20822287-20822309 ATAAGTTTTTTGAAATTTCCTGG + Intronic
1164097374 19:22023576-22023598 ATAAGGTTCTTCAAAGATTCAGG + Intergenic
1165107986 19:33485737-33485759 CCAATTGTCTTCAAATATGCAGG + Intronic
1166987359 19:46669153-46669175 CCAAGTTTCTGCAATTATACAGG - Intergenic
926997350 2:18750790-18750812 CTAAGTTGCTTCAATTGTCTGGG + Intergenic
928019701 2:27693948-27693970 CTTAGTATCATCAAATATCCAGG - Intronic
928893576 2:36235243-36235265 CTACGTATCTTCAAATAGCTGGG + Intergenic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
931101174 2:59002580-59002602 CTCATTTTCTTCTAATATCCAGG - Intergenic
931371244 2:61665047-61665069 CTTAGTGTCTTCAAAAATCCAGG - Intergenic
932105946 2:68943125-68943147 CTAAGTTGATTCAAAGAACCAGG + Intergenic
932425119 2:71628259-71628281 CTAAGTTCCTTGTAATATTCTGG - Intronic
934147336 2:89108378-89108400 TTTAGTTTCCTCAAATATCAGGG + Intergenic
934221936 2:90092216-90092238 TTTAGTTTCCTCAAATATCAGGG - Intergenic
935451082 2:103210234-103210256 AAAAGTTTCATTAAATATCCTGG - Intergenic
938021530 2:127909635-127909657 CTGAGTTTCCTGAAATGTCCAGG - Intergenic
939794418 2:146624116-146624138 ATATGTTTCTGCAAAAATCCCGG + Intergenic
940806904 2:158197780-158197802 ACAAGTTTCTTCCAGTATCCTGG + Intronic
942406788 2:175664346-175664368 CTCACTTTCTTCAAATTACCTGG - Intergenic
945680819 2:212911935-212911957 CTCTATTTCTCCAAATATCCTGG - Intergenic
947452950 2:230225189-230225211 CTAAGTTTTCTCAAATATGTGGG - Intronic
1169652160 20:7881293-7881315 CTAAGTTTCTTGAAATATGTTGG - Intergenic
1172319517 20:33985352-33985374 ATAAGTTTCTTCAACTAGACAGG + Intergenic
1172350740 20:34238212-34238234 CAATGTTTCTTCAAATATTCTGG + Intronic
1180055034 21:45353272-45353294 ATAAGTTTATTCACAGATCCTGG - Intergenic
1181953691 22:26572878-26572900 ATAAGTTTCCTCAGATATCAGGG + Intronic
1182196646 22:28525607-28525629 ATAAGTTTGTTTAAATAGCCTGG + Intronic
1182680929 22:32079344-32079366 CTAGGTTTCTTCAATTCACCAGG + Intronic
1182834093 22:33327460-33327482 TTAACTTTCCTCAAATAGCCTGG + Intronic
951861290 3:27256162-27256184 ATAAGTTTTTTCAATTATCTAGG - Intronic
952681740 3:36101264-36101286 TAATGTTTCTTCAAATATCTGGG - Intergenic
954005497 3:47587341-47587363 CTTAGTTTCCTCAACTAGCCTGG - Exonic
954378475 3:50206943-50206965 CTCAGTTTCTCCAACTGTCCAGG - Intronic
956039423 3:65130753-65130775 CTCAGTTTCTTCATATGTCAAGG - Intergenic
956493017 3:69794239-69794261 TTAAGTTTCTTCACATTTGCAGG + Intronic
957124758 3:76144314-76144336 CTAAAATACTTCAAATATCGAGG - Intronic
957482275 3:80813635-80813657 CTAATTTTCCTCAAATACCAAGG - Intergenic
957911816 3:86628167-86628189 CTAAGTTTCTGAAAACATGCTGG - Intergenic
959304785 3:104648337-104648359 CTGAGTAAATTCAAATATCCTGG + Intergenic
959798003 3:110456314-110456336 CGAAATCTGTTCAAATATCCAGG - Intergenic
960395012 3:117126351-117126373 TTAAATGTCTTCAAATTTCCAGG + Intronic
963747333 3:149138073-149138095 CTAAGTTTGTTCACTTTTCCAGG - Intronic
963837386 3:150070883-150070905 CTACTTTTCTTCAAGTAGCCAGG + Intergenic
964023084 3:152038729-152038751 CTAAGTTCCTTCCAAAGTCCAGG - Intergenic
964380029 3:156089059-156089081 CTGAATTTTTTCAAAGATCCTGG - Intronic
966299928 3:178467166-178467188 CTAAGTACCTTGAAATGTCCAGG + Intronic
967132720 3:186487567-186487589 CTCAGTTTCTGCAAGAATCCTGG + Intergenic
968043230 3:195606097-195606119 CTAAGTTCCTCCAAAAGTCCCGG + Intergenic
969630794 4:8334852-8334874 CCAAGTTCCTGGAAATATCCAGG + Intergenic
972087412 4:35236490-35236512 CTGAGCTTCCACAAATATCCAGG - Intergenic
972218804 4:36929001-36929023 CAATGTTTCTTCACATTTCCAGG - Intergenic
972890101 4:43547610-43547632 CAAAGATTATACAAATATCCTGG - Intergenic
974415195 4:61597492-61597514 CTAAGTAAATTCAAATCTCCAGG - Intronic
975817868 4:78237947-78237969 TTAAGTTGCTTAAAATCTCCAGG - Intronic
975850155 4:78563792-78563814 CTATATTTCTCCATATATCCAGG + Intronic
976048394 4:80981032-80981054 CTAAGTTACTTGAACTTTCCCGG - Intergenic
977459972 4:97312715-97312737 CTAAATTTCTTGGAATTTCCTGG - Intronic
977850961 4:101828799-101828821 TAAAATTTCTTCACATATCCAGG - Intronic
977867596 4:102048486-102048508 TGAATATTCTTCAAATATCCTGG + Intronic
978829134 4:113061697-113061719 TGAAGATACTTCAAATATCCAGG - Intronic
979040960 4:115794057-115794079 CTAAATTATTTCAAATATCAAGG + Intergenic
980182850 4:129423201-129423223 CTGAGATTCTTCATATATTCAGG + Intergenic
981769309 4:148289003-148289025 ATAAGTTTCTTTTAATATACTGG - Intronic
982166913 4:152621705-152621727 CTTACTTTCTTCTAATATCAAGG + Exonic
982303272 4:153901598-153901620 CTATCTTTCTTCAAATATCATGG - Intergenic
983461101 4:168026872-168026894 GTAATTTTCTTCTAATATCAGGG + Intergenic
986146893 5:5086659-5086681 TTTAGTTTCTTCCAATATCTGGG + Intergenic
987898767 5:23983303-23983325 CTGGTTTTCTTCAAATTTCCAGG + Intronic
988092192 5:26558022-26558044 GTAAGTATTTTCAAATATCTTGG - Intergenic
988214106 5:28248996-28249018 CTAAGTTTTTACAGATATCAGGG + Intergenic
988434859 5:31162322-31162344 CAAGCTTTGTTCAAATATCCTGG - Intergenic
988655488 5:33206879-33206901 CTAAGATTCTTCTAATCTTCTGG + Intergenic
993686268 5:90942219-90942241 ATAAGTTTCTTCAAAGATTATGG - Intronic
993700205 5:91110190-91110212 ATAAGTTTCTTAAACTATTCAGG + Intronic
995417337 5:111925566-111925588 GTAATTTTCTTCTAATATCAGGG + Intronic
996001898 5:118374486-118374508 ATAAGTACCTTCAAATATACAGG + Intergenic
996928953 5:128862736-128862758 CTAAGTTTCTGCCAACATTCCGG - Intronic
997799090 5:136841967-136841989 CTCAGTTTCTTCATATATAAAGG - Intergenic
999022429 5:148182743-148182765 CTTAGGTTCTTCACATATCTTGG + Intergenic
999063783 5:148662932-148662954 TTAGGTCTTTTCAAATATCCAGG - Intronic
999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG + Intergenic
1000016718 5:157284463-157284485 CCAAGTTTCTTCAAAAATGATGG - Intronic
1000518341 5:162268573-162268595 CTAAGTTTCTTCAAATATCTAGG + Intergenic
1001068547 5:168561593-168561615 CTAATTTTATAAAAATATCCAGG - Intronic
1003986387 6:11439690-11439712 CAAAGTTTCTTCAAATAAAAGGG - Intergenic
1004570737 6:16842178-16842200 CTAGGTTTTCTCAAAGATCCAGG - Intergenic
1005412037 6:25559719-25559741 TTAAGTTTGTTCACAGATCCTGG + Intronic
1005702958 6:28421795-28421817 CTAAGTTTCTTTTAATATATGGG - Intergenic
1008692904 6:54000936-54000958 CTTAATTGCTTCAAATATTCTGG + Intronic
1009762132 6:68020930-68020952 CCAAGTTTCTTCAAATCTAGAGG + Intergenic
1010857652 6:80861670-80861692 AAAAGTTTCTTTAAATATGCTGG + Intergenic
1011400108 6:86952076-86952098 TTGAGTTTCACCAAATATCCTGG - Intronic
1012524855 6:100165188-100165210 ATCAGTTTCTTTAAATCTCCAGG + Intergenic
1013954420 6:115824232-115824254 CTAAGTTTCTTCAACTGTAAAGG + Intergenic
1014333100 6:120095894-120095916 CTATAGTTCTTCAAATATTCTGG - Intergenic
1016533513 6:145085146-145085168 GAAGTTTTCTTCAAATATCCAGG - Intergenic
1016968112 6:149737435-149737457 CAAAATTTCTTAAAATAGCCTGG - Intronic
1017450450 6:154549971-154549993 CTTTGTTTCTTCCAATATCCAGG - Intergenic
1017924681 6:158900906-158900928 CTAAGTCCCTTCAAATAACTGGG - Intronic
1020862873 7:13516424-13516446 CTAAGATTCTTATAATCTCCAGG - Intergenic
1021949204 7:25757959-25757981 CCAAGTTTCTTCAAAGACTCTGG + Intergenic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1023526560 7:41109559-41109581 CTTAGTGTCTTGAAATTTCCTGG + Intergenic
1023680795 7:42685241-42685263 CTAAATTTCTTCTATTATCTGGG - Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026218151 7:68367840-68367862 CTAAATCCCTTCAAATTTCCTGG - Intergenic
1027500370 7:78942437-78942459 CTAAGTTTCCACATATATCATGG - Intronic
1028811600 7:95094259-95094281 CTAAGTTTCTCCATATTACCTGG - Intronic
1032349759 7:131149923-131149945 CTAAGTTTGTTAAAAGATCAAGG + Intronic
1033463579 7:141569693-141569715 CTAAGTTTCTTCATCTATATAGG - Intronic
1034504793 7:151479822-151479844 CTAATTTTCTTCACATATCAAGG + Intronic
1036386413 8:8285560-8285582 CTGACTTGCTTCAAATTTCCAGG + Intergenic
1037195121 8:16179570-16179592 ATAATTTTCTTAAAAGATCCAGG - Intronic
1037525834 8:19723219-19723241 ATAAGTTCCTTCAAATATAAGGG - Intronic
1038967429 8:32590623-32590645 CCAAGTATCTTCTAATACCCAGG - Intronic
1041795123 8:61738848-61738870 CTAGGTTTCTGCAGATGTCCAGG - Intergenic
1042864199 8:73343339-73343361 CTAACTTTCTTCAGGTAACCTGG + Intergenic
1044347482 8:91122002-91122024 CTATGTATCTTCATATATCTGGG + Intronic
1045834727 8:106506732-106506754 CTAAGTATTTTGGAATATCCAGG - Intronic
1047757371 8:127928870-127928892 CTGACTTTCTTCAAACTTCCAGG - Intergenic
1051565319 9:18490536-18490558 CTACGTCTCTTCCAATCTCCAGG - Intronic
1055015270 9:71610137-71610159 CTAAGTTTGTTGCATTATCCTGG + Intergenic
1058110180 9:101023852-101023874 CTAGGTTTCTTCATATACCGTGG - Intergenic
1058576742 9:106411994-106412016 TTTAGTATCATCAAATATCCAGG - Intergenic
1058709870 9:107669901-107669923 GTTAGTATCTTCAAAAATCCTGG + Intergenic
1061333190 9:129910513-129910535 AGAAATTTCTTCAAATAACCAGG + Intronic
1186684730 X:11913590-11913612 CTAATTTTCTTCTATGATCCAGG - Intergenic
1188895527 X:35663715-35663737 CTTAGTATCATCAAATATTCAGG - Intergenic
1189505602 X:41610741-41610763 TTAAGTTTCTTCTCATAACCAGG + Intronic
1189804111 X:44718378-44718400 CTAAGTTTATACATAAATCCAGG + Intergenic
1191608251 X:63084437-63084459 CTAAATTTCTTCACATATAGAGG + Intergenic
1192102894 X:68283938-68283960 TTAAGTTGCTGCAAATACCCAGG + Intronic
1192807976 X:74526499-74526521 CTAAGTACCCTCAAATATCTTGG + Intronic
1193751515 X:85351108-85351130 CTATGTGACTTCACATATCCTGG + Intronic
1193812026 X:86063245-86063267 CTTAGTTTAGTCAATTATCCTGG + Intergenic
1194591648 X:95806361-95806383 CCAAGTTCTTTCAAATATCTGGG + Intergenic
1194872839 X:99154064-99154086 GTAAGATTCTTTAATTATCCTGG - Intergenic
1195343585 X:103927045-103927067 CAAAGTTCCTTCATATGTCCTGG + Intronic
1195685065 X:107577968-107577990 CTGAGTTGCTTCAAGTCTCCAGG + Intronic
1195715656 X:107816010-107816032 CTAAATTAGTTCAAATATTCTGG - Intergenic
1196709521 X:118748307-118748329 GTAAGTTGTTTCAAATCTCCTGG - Intronic
1197171148 X:123435870-123435892 CTCAGTTTCTTCATTTATCAGGG + Intronic
1197607489 X:128601178-128601200 CCAACTTTCTCAAAATATCCTGG + Intergenic
1197786646 X:130204510-130204532 ATAAGTTTCAAAAAATATCCAGG - Exonic