ID: 1139769716

View in Genome Browser
Species Human (GRCh38)
Location 16:69264199-69264221
Sequence GTGATGCCAAGGCCATTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139769711_1139769716 -9 Left 1139769711 16:69264185-69264207 CCTTCCCAGGACCTGTGATGCCA 0: 1
1: 0
2: 4
3: 32
4: 317
Right 1139769716 16:69264199-69264221 GTGATGCCAAGGCCATTGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1139769709_1139769716 -3 Left 1139769709 16:69264179-69264201 CCTGACCCTTCCCAGGACCTGTG 0: 1
1: 1
2: 1
3: 53
4: 600
Right 1139769716 16:69264199-69264221 GTGATGCCAAGGCCATTGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1139769710_1139769716 -8 Left 1139769710 16:69264184-69264206 CCCTTCCCAGGACCTGTGATGCC 0: 1
1: 1
2: 1
3: 20
4: 247
Right 1139769716 16:69264199-69264221 GTGATGCCAAGGCCATTGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139769716 Original CRISPR GTGATGCCAAGGCCATTGTG AGG Intronic
902281868 1:15380701-15380723 GCGTTGCAAAGGCCATTCTGAGG - Exonic
902669637 1:17964192-17964214 GTGAGGCCAAGGCTAGGGTGGGG - Intergenic
902933466 1:19747244-19747266 GGGATGCCTCGGCCATTCTGAGG + Exonic
903782364 1:25829244-25829266 TAAATGCCAAGGCCATTATGGGG + Intronic
907721561 1:56977214-56977236 TTGCTGCCAATGCCATTATGTGG + Intergenic
909628579 1:77747160-77747182 GTGATGCCAAGACCATTCAGTGG - Intronic
912039825 1:105375830-105375852 GTAATCCCAAGGCCTTTGGGAGG + Intergenic
913253050 1:116928208-116928230 GTGATGACAAGGCCCAGGTGTGG - Intronic
915249781 1:154579761-154579783 GGGAGGCCAAGGGCAGTGTGGGG - Exonic
915823417 1:159050412-159050434 CTGATGTCATGGCTATTGTGAGG + Intronic
917460621 1:175225896-175225918 GTGATTCCTAGGCCAGTGAGTGG - Intergenic
920373540 1:205494179-205494201 GAGATGCCAAGGGCTTTGTGAGG + Intergenic
922856136 1:228776164-228776186 GTGATGCCAATGCTACTGTGTGG - Intergenic
1062826137 10:570356-570378 GTCATGCCCAGGCCTTTGTGGGG - Intronic
1063374669 10:5546979-5547001 GCGATGCCCAGGACTTTGTGTGG - Intergenic
1068556553 10:58465186-58465208 GGGTTGCCATGGCCACTGTGAGG + Intergenic
1075169975 10:120104151-120104173 GTGATGCCAAGTCTGTTGTCTGG - Intergenic
1076439162 10:130468064-130468086 GTGATTCCACTGTCATTGTGTGG + Intergenic
1080896887 11:36455069-36455091 GGGAGGCCAGGGCCTTTGTGTGG - Intronic
1085645259 11:78218486-78218508 GAGATGACAAGGACACTGTGGGG - Exonic
1089927504 11:122273930-122273952 GTGGTGCCAAGGCCTTTGAGAGG - Intergenic
1090951766 11:131479741-131479763 GTGATTCTAAGGTCATTGGGAGG + Intronic
1091081378 11:132672086-132672108 CTGATGGCAAGGGCAATGTGAGG - Intronic
1091639733 12:2227010-2227032 CTGATGCCATGGCCTGTGTGGGG + Intronic
1093154835 12:15669727-15669749 TTGATGCCAAGGGCAAAGTGTGG - Exonic
1099914893 12:88880694-88880716 GTAAACCCAAGGCCCTTGTGAGG + Intergenic
1099915005 12:88882135-88882157 GTAAACCCAAGGCCCTTGTGGGG + Intergenic
1101818168 12:108161975-108161997 GTGATGCATGGGCCATGGTGAGG - Intronic
1107843750 13:44488959-44488981 AAGATGCCATGGCTATTGTGGGG - Intronic
1113961379 13:114128162-114128184 CTGATGCCAAGGCCCATGTGTGG + Intronic
1114054961 14:18960017-18960039 GAGATGGCAAAGCCATTGTATGG + Intergenic
1114107580 14:19441760-19441782 GAGATGGCAAAGCCATTGTATGG - Intergenic
1114867319 14:26612597-26612619 GTTTTGCCAAGGCAATTTTGAGG + Intergenic
1117049331 14:51844687-51844709 CAGATACCAAGGCCATGGTGTGG - Intronic
1118000616 14:61519515-61519537 GTGTTGCCAAGGCTCTTCTGAGG - Intronic
1119661161 14:76452749-76452771 GAGATGGCAAGGCCATTAGGGGG + Intronic
1122268457 14:100557548-100557570 GTGAGGGCAAGGCCAGTGAGGGG - Intronic
1122452299 14:101819399-101819421 GTGGTGCAAAGGCAATGGTGAGG + Intronic
1122679441 14:103446622-103446644 GGGATGCCATGGCCATGGTCAGG + Intronic
1122865214 14:104600848-104600870 GTGAGGGCAAGGCCTGTGTGAGG - Intronic
1123114702 14:105889466-105889488 GTGATGGCATGGGCAGTGTGTGG + Intergenic
1123696166 15:22880648-22880670 CTGATGCCACGTTCATTGTGCGG - Intronic
1126480219 15:49110782-49110804 GTGATCCCCAGGCCCCTGTGGGG - Intronic
1127388185 15:58484339-58484361 TTGATCCCAAGGCCCTTTTGAGG - Intronic
1128445186 15:67753068-67753090 AGGATGCCAAGACCATTCTGTGG + Intronic
1128988195 15:72236549-72236571 GGTATGGCAAGGCCATGGTGTGG + Intergenic
1130816006 15:87433527-87433549 ATTATGCCAGGGCCCTTGTGAGG + Intergenic
1131341144 15:91602277-91602299 GTGATTCCAATCCCATTATGGGG + Intergenic
1132621122 16:868753-868775 TTGATGCCAAGGCTGATGTGGGG + Intronic
1133222803 16:4326388-4326410 GTGTTGTCAAGGGCAATGTGAGG - Intronic
1138142026 16:54577091-54577113 GTTATCCTATGGCCATTGTGAGG + Intergenic
1139301428 16:65948458-65948480 GTGATGCCAAGGCCCATTTCTGG + Intergenic
1139769716 16:69264199-69264221 GTGATGCCAAGGCCATTGTGAGG + Intronic
1142270325 16:89085612-89085634 GTGAGGCCGAGGCGATGGTGAGG - Intergenic
1147551345 17:41444540-41444562 GAGATCCCAAGTCCATGGTGGGG - Intergenic
1147624809 17:41893128-41893150 GCCACACCAAGGCCATTGTGTGG - Exonic
1151598673 17:75093412-75093434 GAGATGCCAAGGCCAACGCGTGG + Intronic
1153831235 18:8924861-8924883 ATGATGCAAAGGCAATTCTGTGG - Intergenic
1154325298 18:13386810-13386832 GGGAGGCCAAGCCCTTTGTGAGG + Intronic
1156774262 18:40768216-40768238 GTGATGCCAATGCTTGTGTGTGG - Intergenic
1158256418 18:55554715-55554737 GTGATGCCAGGGCCACTGCATGG - Intronic
1160141429 18:76327222-76327244 GAGATGGTAAGGCCATGGTGTGG + Intergenic
1160364653 18:78313800-78313822 GTGAGGCCAGGGACATGGTGAGG + Intergenic
1161220707 19:3116825-3116847 GCACTGCCGAGGCCATTGTGAGG + Intronic
1161590009 19:5125292-5125314 TGGAGGCCAAGGCCATGGTGAGG - Intronic
1167294064 19:48639241-48639263 GGGATGCCCAGGCCAGTGAGTGG + Intronic
1168342604 19:55634216-55634238 GTAACGCCAAGGCCATAGAGGGG - Intergenic
1168446108 19:56415485-56415507 CTGATGCTGAGGCCTTTGTGGGG + Intronic
1168453433 19:56484680-56484702 GAGTTGTCTAGGCCATTGTGAGG - Intergenic
926731686 2:16040362-16040384 GTGATGTGAGGGCCATTGTCAGG - Intergenic
932949652 2:76278131-76278153 GTGAGGACAAGGGCATTGTGTGG + Intergenic
934606749 2:95700910-95700932 TAGATGCCAAGGCCCTTGAGTGG + Intergenic
935212574 2:100951171-100951193 GTGATACCAGTGCCATTCTGTGG + Intronic
936540149 2:113343043-113343065 TAGATGCCAAGGCCTTTGAGTGG + Intergenic
938121729 2:128638852-128638874 GTGAAGCCAGGGCCCTGGTGTGG + Intergenic
942685468 2:178526230-178526252 GTGCAGCCAATGCCTTTGTGTGG - Exonic
943637107 2:190318554-190318576 GTGAGGCCAGGACCATTTTGGGG - Intronic
948201734 2:236134067-236134089 GTGCTGGCAAGGCCAAGGTGAGG + Intergenic
948662655 2:239516603-239516625 GTGAGGCCAAGGCTGGTGTGGGG - Intergenic
948887659 2:240892196-240892218 GAGATGCCAGGGCCATCGTCAGG - Intronic
1169406455 20:5325151-5325173 ATGATGCCAAGAGCATTCTGTGG - Intergenic
1173527319 20:43743083-43743105 GAGATGCCAAGGCCATGTGGTGG - Intergenic
1173636223 20:44560690-44560712 TTGGTGGCAAGGCTATTGTGAGG - Intronic
1173819293 20:46010287-46010309 CTCCTGCCAGGGCCATTGTGAGG + Intronic
1174910557 20:54603420-54603442 GGGATGACAAGGACATTCTGTGG - Intronic
1177814173 21:25958140-25958162 GTAATGCCAAGGCCAGCCTGGGG - Intronic
1179520581 21:41941772-41941794 GTGTTGCCAAGGCCTGGGTGAGG - Intronic
1179888308 21:44323944-44323966 GCCATGCCCAGGCCCTTGTGGGG + Intronic
1180473443 22:15682567-15682589 GAGATGGCAAAGCCATTGTATGG + Intergenic
1183953857 22:41367814-41367836 GGGAAGCCATGGCCAGTGTGTGG + Intronic
1184615383 22:45634494-45634516 GTGGTGCCAACACCCTTGTGTGG + Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
951117582 3:18882896-18882918 CTCATGGCTAGGCCATTGTGGGG + Intergenic
951415705 3:22419075-22419097 GTGATTCCAAGCTCAGTGTGAGG + Intergenic
952686861 3:36160180-36160202 GTGAGGGCAAGGCCACTGTGTGG + Intergenic
953154762 3:40359558-40359580 GTGATACCAAGGGCTTTGTGAGG + Intergenic
954754075 3:52829590-52829612 GTGAAGCCAGGGCCAGTGTCTGG + Intronic
956560284 3:70567312-70567334 CTGATTTCAAGGCCACTGTGTGG + Intergenic
956626717 3:71273869-71273891 GCAGTGCAAAGGCCATTGTGAGG + Intronic
957776222 3:84759629-84759651 GGCTTGCCAAGGCCACTGTGGGG - Intergenic
961672340 3:128542378-128542400 GAGATGCTGTGGCCATTGTGGGG - Intergenic
962823320 3:139074173-139074195 CTGCTGCCAGGGCCATGGTGTGG + Intronic
967379776 3:188844563-188844585 GTGATTCCAAGGGAATTGAGAGG + Intronic
969591575 4:8125182-8125204 GTGATGCCAAAGACATCGTGAGG - Intronic
970735303 4:19159971-19159993 GTGTTGCCAAGAACATTGTCTGG - Intergenic
971449164 4:26784082-26784104 TTGAAGCCAAAGCCATTGAGTGG - Intergenic
973793051 4:54395599-54395621 GGCATGCCAAGGCCAATGTTGGG - Intergenic
977249758 4:94676745-94676767 GAGAAGCCAAAGTCATTGTGGGG - Intergenic
977932323 4:102762037-102762059 GCAATTCCAAGGCCATTGTAAGG - Intergenic
985903284 5:2813753-2813775 CTGAGGCCAGGGCCAATGTGGGG - Intergenic
986290799 5:6397291-6397313 GTGCTGACAAGGCCCATGTGAGG + Intergenic
988679482 5:33471067-33471089 GCGATGCCCAGGCCACAGTGTGG + Intergenic
991594393 5:68288207-68288229 GAAATGAGAAGGCCATTGTGAGG - Intronic
991932225 5:71765246-71765268 CTGATCCCACGGCCATTGTTAGG - Intergenic
995213709 5:109570795-109570817 GTCACGCCATGGCTATTGTGTGG + Intergenic
996449517 5:123603752-123603774 GTAATGCCAAGGCCTTTAAGTGG + Intronic
997434074 5:133861588-133861610 GTGCTGCCAAAGCCATGGTGGGG - Intergenic
999685905 5:154102870-154102892 GTGATGCCACGGGAATAGTGTGG - Intronic
1007012419 6:38430479-38430501 GTCATGCCTAGCCCTTTGTGAGG - Intronic
1007822921 6:44574643-44574665 GGGATGCCAAGACCATTCAGTGG + Intergenic
1007840811 6:44714546-44714568 GAGAGGCCAAGGACATTGAGTGG - Intergenic
1010432339 6:75792818-75792840 CTGTTGCCCAGGCCAATGTGTGG + Intronic
1011635819 6:89372161-89372183 GAGATGCCAAGGCCCCTGGGAGG + Intronic
1017644579 6:156527296-156527318 GTGCAGCTAAGGCCATTTTGAGG - Intergenic
1021571778 7:22073176-22073198 GCGATGACAAAGGCATTGTGGGG + Intergenic
1030125248 7:106147024-106147046 GTGATGCCAAAGTGATTCTGTGG + Intergenic
1030312602 7:108083409-108083431 GTGCTGCCAAGGCCATAGAATGG - Intronic
1033016625 7:137678202-137678224 GTGGGGCCAAGGCCTGTGTGTGG - Intronic
1038141509 8:24850251-24850273 TTGATGCAAAGGTAATTGTGGGG - Intergenic
1042137912 8:65649796-65649818 GTGCTGCAAAGGACAGTGTGGGG - Intronic
1043579459 8:81695585-81695607 ATGCTGCCAAGGCCAGTGTCTGG - Exonic
1049287191 8:141782245-141782267 GTGTTGCCAGTGCCAATGTGGGG + Intergenic
1053000907 9:34576982-34577004 GTGATGCCAGGGCTTTGGTGGGG - Intronic
1060204570 9:121674963-121674985 GTGATCCCAAGACCCCTGTGGGG + Intronic
1189223229 X:39390780-39390802 CTGATGTCCAGGCCATTGTTGGG + Intergenic
1201435158 Y:13950914-13950936 GTGATGCAAATGTCATTCTGTGG + Intergenic