ID: 1139773627

View in Genome Browser
Species Human (GRCh38)
Location 16:69298951-69298973
Sequence GTAAACTCATTGGCATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139773627_1139773630 -4 Left 1139773627 16:69298951-69298973 CCTGTCTATGCCAATGAGTTTAC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1139773630 16:69298970-69298992 TTACAAAGTCCTTGAGAGCAGGG 0: 1
1: 1
2: 4
3: 53
4: 442
1139773627_1139773629 -5 Left 1139773627 16:69298951-69298973 CCTGTCTATGCCAATGAGTTTAC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1139773629 16:69298969-69298991 TTTACAAAGTCCTTGAGAGCAGG 0: 1
1: 0
2: 3
3: 35
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139773627 Original CRISPR GTAAACTCATTGGCATAGAC AGG (reversed) Intronic
905825037 1:41020786-41020808 GTACACAGATTGGCAGAGACTGG + Exonic
907854616 1:58290195-58290217 GTAAAGTTAATGGCATAGAGTGG + Intronic
910903543 1:92148813-92148835 GTAAACCCACTGGCAAAGAAGGG + Intergenic
911255906 1:95633277-95633299 GCAAACTCATTGGCATTGGATGG + Intergenic
912892666 1:113551243-113551265 GTAAACTGCTTGGCCTAGAGAGG + Intronic
913189073 1:116398171-116398193 GGAAGCTCATAGGCATAGAGAGG + Intronic
918052608 1:180987430-180987452 GCAAACTCTTTGGCAGAGATGGG + Intronic
920749251 1:208658534-208658556 GTAAACCCATTGCCAGTGACTGG + Intergenic
921910438 1:220543538-220543560 CTAAACTCTGTGGCATAGAATGG - Intronic
1066097329 10:32084737-32084759 GTCACCTCATTGGAAGAGACGGG + Intergenic
1066160823 10:32725768-32725790 GTGAACTCATTACCATAGAGAGG + Intronic
1068002646 10:51354109-51354131 TTAAACTCATTGAGATAGAGAGG + Intronic
1068577490 10:58700461-58700483 GTAAACACATTAGCAGAGACAGG + Intronic
1068948430 10:62753477-62753499 ATAAAATCATTGTCATAGAAAGG - Intergenic
1071722439 10:88160527-88160549 GTAAACTGATTTGCACAGAAGGG + Intergenic
1071812402 10:89198008-89198030 GTGAACACATTGGAAGAGACTGG + Intergenic
1072280750 10:93863223-93863245 GTAAACTCATTATCATGGAGAGG - Intergenic
1078465975 11:11550606-11550628 GGATACTCATTGACACAGACAGG + Intronic
1079639498 11:22786682-22786704 GTAACTTCATTGTCAGAGACAGG - Intronic
1085603845 11:77879860-77879882 GTTAACTGTTTGGCATAGAATGG - Intronic
1089895275 11:121924366-121924388 GTAAAGTCATCTGCATACACCGG - Intergenic
1091117241 11:133024858-133024880 GGAAAATCACTGGCATAGAAGGG - Intronic
1098577671 12:72061963-72061985 GTAAACTTATTGATATACACTGG - Intronic
1099238163 12:80107107-80107129 GTAAACTGACTGGCCTAGAATGG + Intergenic
1100565907 12:95793346-95793368 GTAAAATAAATGGCATAGCCAGG + Intergenic
1104169324 12:126264828-126264850 TAAAACTCAATGTCATAGACTGG - Intergenic
1107695673 13:42997562-42997584 GTAGACTCAGTGGCGTTGACAGG + Intergenic
1110286341 13:73754059-73754081 GAAAACATATTGGCATAGAAAGG - Intronic
1113532631 13:111040105-111040127 TTAAAGTCATTGGGATAGATGGG + Intergenic
1117951928 14:61091380-61091402 GTATTCTCTTTGGCATTGACAGG + Intergenic
1119025030 14:71145856-71145878 GTCAAATCATTGGAAAAGACAGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1137906419 16:52326510-52326532 GTAAACTCAAAGTCATACACAGG + Intergenic
1139773627 16:69298951-69298973 GTAAACTCATTGGCATAGACAGG - Intronic
1140187302 16:72786980-72787002 GTAAAATCACCGGCATAGATAGG + Exonic
1141329744 16:83099700-83099722 GTAAAGTAATTGGCAAAGAATGG - Intronic
1143911497 17:10253795-10253817 GTAAACACATTGGGATAAAGTGG - Intergenic
1161060658 19:2213234-2213256 ATAAACTCCTTGGCATTGGCCGG + Intronic
925758244 2:7155990-7156012 GTAAACTCATTGCTATAGTTTGG - Intergenic
927842465 2:26454398-26454420 GTAAACTGATTGGGAGAGAGAGG + Intronic
932546767 2:72719611-72719633 ACAAACTCATTAGCAAAGACTGG + Intronic
939296599 2:140273753-140273775 CTAACCTCAGTGGCATAAACTGG + Intronic
941920850 2:170849329-170849351 ATAAACTCAACGGCATAGAAAGG + Exonic
944135128 2:196390938-196390960 TTATACTCATTGGCATTGGCTGG + Intronic
947977781 2:234382413-234382435 GAAAAGTCATTGGGAAAGACTGG + Intergenic
1172438688 20:34949647-34949669 GTAAAATAATTGGCAGAGCCAGG - Intronic
956610750 3:71120479-71120501 ATAAACTTATTTGCAAAGACTGG - Intronic
959204608 3:103289526-103289548 GACAACTCATTGGCTTATACTGG - Intergenic
965592642 3:170376961-170376983 GTAAAGGCTTTAGCATAGACCGG - Intronic
968853030 4:3096366-3096388 GCAACCTCATTGGCATTTACAGG + Intronic
971804022 4:31331630-31331652 TTGTACTCATTGGCAAAGACTGG - Intergenic
979833559 4:125331425-125331447 GTTAACTGATTGGAAAAGACTGG + Intronic
983369261 4:166838654-166838676 TTAAAATCCTTGTCATAGACCGG + Intronic
985225596 4:187758018-187758040 GTCTACACATTGGCAGAGACAGG + Intergenic
989598271 5:43178097-43178119 GTCATCTCATTAGCATAAACTGG + Intronic
993981822 5:94551667-94551689 GGAAACTCATTGACATATATTGG + Intronic
996192886 5:120567229-120567251 CAAAACCCAGTGGCATAGACTGG - Intronic
996836796 5:127802510-127802532 GCAAACTCAATGGCAGGGACAGG - Intergenic
999732298 5:154483747-154483769 GTAAACACATTGTCATTTACGGG - Intergenic
1001843800 5:174903366-174903388 GGAAACTCATTTTCAGAGACAGG - Intergenic
1014684424 6:124477920-124477942 GGATATTCATTGGCATTGACAGG - Intronic
1015744101 6:136491321-136491343 TTAAAATCATTGGCATAAATTGG - Intronic
1016207166 6:141482927-141482949 CTTCAATCATTGGCATAGACTGG - Intergenic
1016502535 6:144737946-144737968 CTCAACTCATTGGGATAGACAGG - Intronic
1017608295 6:156156569-156156591 GGAAATACATTGGTATAGACTGG - Intergenic
1020050951 7:5081267-5081289 TTAAATTCATTGGCATGGCCAGG - Intergenic
1020377307 7:7502530-7502552 GTAAATTCATAGACATAGGCAGG + Intronic
1022510318 7:30931291-30931313 GTGAAATCATTGACAGAGACAGG + Intergenic
1031793859 7:126146070-126146092 GTAAATTATTTGGCATAGAGTGG + Intergenic
1034588223 7:152115192-152115214 TTAAACTCATTTTCATAGTCAGG + Intronic
1039008814 8:33070598-33070620 GAACACTCATTGGAATAAACAGG + Intergenic
1039686351 8:39806130-39806152 GTAAATCCATTGGCAAAGAGTGG + Intronic
1039847842 8:41338311-41338333 GTAAACTCAATGGCTGAGCCTGG - Intergenic
1042581023 8:70279359-70279381 GTACAATCAATGGCATAGAGTGG + Intronic
1045787218 8:105935782-105935804 GTGAACTCAGTGGCTTAGATTGG + Intergenic
1049152726 8:141045845-141045867 GTAATCTCATTGGCATCTCCTGG - Intergenic
1050911745 9:11080307-11080329 ATAAACCCATTGGCAAAAACAGG - Intergenic
1052208824 9:25876429-25876451 GTAAACTAATTAGCATGGGCAGG + Intergenic
1055163089 9:73155398-73155420 ATGAACTCATTGGCTTAGGCAGG + Intronic
1059161695 9:112040881-112040903 GGAAACTTATTGGCATGGCCAGG + Intronic
1203774644 EBV:65946-65968 GTGGACGCATTGGCATAGAAGGG - Intergenic
1189205276 X:39232911-39232933 GAAACCTAATTAGCATAGACTGG + Intergenic
1190850606 X:54237097-54237119 GGAAAGTCAGTGGCAAAGACTGG - Exonic
1193422409 X:81297490-81297512 GTAAAATCATTGGTGTATACAGG - Exonic
1199247969 X:145629497-145629519 TTCAACTTATTGGCATATACTGG - Intergenic