ID: 1139775101

View in Genome Browser
Species Human (GRCh38)
Location 16:69311767-69311789
Sequence GCTTCGTGTAGCCGGCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139775089_1139775101 5 Left 1139775089 16:69311739-69311761 CCTGCCCGGCTGGCCCAGCCCCA 0: 1
1: 0
2: 8
3: 94
4: 669
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775081_1139775101 25 Left 1139775081 16:69311719-69311741 CCACCCTCAGGCCTTCCGGCCCT 0: 1
1: 0
2: 1
3: 30
4: 389
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775086_1139775101 14 Left 1139775086 16:69311730-69311752 CCTTCCGGCCCTGCCCGGCTGGC 0: 1
1: 0
2: 1
3: 35
4: 338
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775093_1139775101 0 Left 1139775093 16:69311744-69311766 CCGGCTGGCCCAGCCCCAGGGCC 0: 1
1: 2
2: 13
3: 111
4: 938
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775082_1139775101 22 Left 1139775082 16:69311722-69311744 CCCTCAGGCCTTCCGGCCCTGCC 0: 1
1: 0
2: 2
3: 38
4: 311
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775088_1139775101 6 Left 1139775088 16:69311738-69311760 CCCTGCCCGGCTGGCCCAGCCCC 0: 1
1: 1
2: 6
3: 76
4: 760
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775095_1139775101 -9 Left 1139775095 16:69311753-69311775 CCAGCCCCAGGGCCGCTTCGTGT 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775087_1139775101 10 Left 1139775087 16:69311734-69311756 CCGGCCCTGCCCGGCTGGCCCAG 0: 1
1: 0
2: 5
3: 88
4: 701
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775083_1139775101 21 Left 1139775083 16:69311723-69311745 CCTCAGGCCTTCCGGCCCTGCCC 0: 1
1: 0
2: 0
3: 50
4: 505
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775092_1139775101 1 Left 1139775092 16:69311743-69311765 CCCGGCTGGCCCAGCCCCAGGGC 0: 1
1: 1
2: 14
3: 136
4: 788
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1139775094_1139775101 -8 Left 1139775094 16:69311752-69311774 CCCAGCCCCAGGGCCGCTTCGTG 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139775101 Original CRISPR GCTTCGTGTAGCCGGCGCCC CGG Intronic
901040370 1:6359671-6359693 GCCTCCTGTAGCCTGCACCCTGG - Intronic
905217976 1:36423401-36423423 GCTTTGTGTTGCCGGTGTCCGGG - Exonic
1074165812 10:110872501-110872523 CCTTCGTGAACCCGGAGCCCCGG + Intronic
1076434202 10:130428584-130428606 GCTTCGTGTATCTGCAGCCCCGG + Intergenic
1091800231 12:3320440-3320462 GCTTGGTGGAGCCTGGGCCCTGG + Intergenic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1092881546 12:12891254-12891276 CCCTCTCGTAGCCGGCGCCCTGG + Exonic
1094040194 12:26114191-26114213 CCTTCGCGTAACCCGCGCCCAGG + Intergenic
1106187843 13:27424719-27424741 GCTTGGAGGCGCCGGCGCCCTGG + Exonic
1121329332 14:93040266-93040288 GCTTCATGTAGCTGAAGCCCAGG - Intronic
1122535790 14:102461642-102461664 GCTTCGTGGAGCGGGGGCCACGG - Intronic
1126849176 15:52787199-52787221 GGTTCCTGCAGCCTGCGCCCGGG - Intronic
1127288439 15:57550035-57550057 GCTTCTTGTAGCCAGCCCCATGG - Exonic
1131291993 15:91114519-91114541 GCTTGGTGTTGCTGGCGCCCAGG + Intronic
1139354096 16:66357084-66357106 GCTTCTTGGAGCCTGTGCCCAGG - Intergenic
1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG + Intronic
1141054743 16:80804537-80804559 GCTTCCTGCAGGCGGCGCCGGGG - Intergenic
1147333960 17:39715850-39715872 GCTTCGTGCACACGGTGCCCTGG + Exonic
1152892525 17:82890644-82890666 GCTTTCTGTAGACGGAGCCCAGG + Intronic
1154485790 18:14870709-14870731 GCTTCATGGAGCCAGGGCCCAGG - Intergenic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1159894462 18:73983306-73983328 GCTTCATGTAGCCTGTGCCTGGG - Intergenic
1160575297 18:79849562-79849584 GCTTGGTGTAACCCGCGGCCAGG - Intergenic
1160967739 19:1753962-1753984 GCGTCGTGTAGGTGCCGCCCAGG - Exonic
1161219179 19:3110198-3110220 CCTCCGAGTAGCCGGCGCCGTGG - Exonic
1161226427 19:3148640-3148662 CCTCCGAGTAGCCGGCGCCGTGG - Exonic
1163837355 19:19582969-19582991 GCTTGGTGTTCCCGGAGCCCGGG - Intronic
930762307 2:55050028-55050050 ACTTCGTGCCGCCGGCGCCCCGG - Exonic
932581492 2:72995181-72995203 CCCTCGTGTAGCCGGGGCCCAGG + Intronic
934676468 2:96253171-96253193 GCTTCATGTGGCTGGAGCCCAGG - Exonic
937309050 2:120890863-120890885 GCTTCGTGAAGCTGGTACCCAGG + Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948429709 2:237911773-237911795 GCATTGTGTAGGCGGGGCCCAGG + Exonic
1169018723 20:2312533-2312555 GCTTGGTCTAGCCGACGCCCCGG - Intronic
1176795538 21:13368760-13368782 GCTTCATGGAGCCAGGGCCCGGG + Intergenic
968618356 4:1592544-1592566 CCTGGGTGTGGCCGGCGCCCGGG - Intergenic
968850626 4:3075163-3075185 GGTTCGTGTCGCCGGCCCGCAGG - Intronic
969267257 4:6072653-6072675 GCTTCGAGTAGCTGGATCCCAGG + Intronic
969414782 4:7051191-7051213 GCTTCCTGGACCCGGCGACCTGG + Intronic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
984823544 4:183905442-183905464 GCTGCGTGGACCCGGCGCCCCGG + Exonic
990958843 5:61371646-61371668 GCTTTGTGTACCAGGCGTCCAGG + Intronic
994210695 5:97085150-97085172 GCCTAGTGTAGCCGGCACCGGGG + Intergenic
1001979999 5:176031422-176031444 GCTTCATGGAGCCAGGGCCCAGG + Intronic
1002237383 5:177812241-177812263 GCTTCATGGAGCCAGGGCCCAGG - Intergenic
1002276049 5:178104964-178104986 GCTTCATGGAGCCAGGGCCCAGG + Intergenic
1002724581 5:181286208-181286230 GCTTCATGGAGCCAGGGCCCAGG - Intergenic
1014943999 6:127475617-127475639 GCTCCTTCTACCCGGCGCCCGGG - Exonic
1056475013 9:86945580-86945602 ACTTGGTGTAGCCGGTTCCCCGG - Exonic
1185761170 X:2691006-2691028 GCTTCGGGTCGGCGCCGCCCTGG + Intergenic