ID: 1139775542

View in Genome Browser
Species Human (GRCh38)
Location 16:69314766-69314788
Sequence GGCCCTGCCAAGAGCCGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139775536_1139775542 11 Left 1139775536 16:69314732-69314754 CCTTGCAGATAAGAGAGGGCTGA 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1139775542 16:69314766-69314788 GGCCCTGCCAAGAGCCGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139775542 Original CRISPR GGCCCTGCCAAGAGCCGGTC AGG Intronic
900122333 1:1054180-1054202 GGCCCTGCCCGGAGCCTGCCGGG + Intronic
900529949 1:3148260-3148282 GGCCCTGGTGAGAGCAGGTCGGG + Intronic
900701004 1:4048590-4048612 GGCCCTGCAAACAGCTGTTCTGG - Intergenic
900804126 1:4756261-4756283 GGCCCTGCCGAAAGCAGCTCAGG + Intronic
901238450 1:7679835-7679857 GGCCCTGCAGAGAGCAGATCAGG + Intronic
901708971 1:11099380-11099402 GCCCCTGCGGAGAGCTGGTCGGG + Intronic
903857612 1:26346021-26346043 GGCCCTGCCACGGGGCCGTCAGG - Exonic
904296183 1:29521209-29521231 GGCTGTGCCAAGAGCCGTGCTGG - Intergenic
904986117 1:34550028-34550050 GGCCCTGGCAGGAGCGGGGCTGG - Intergenic
906149818 1:43581184-43581206 GGCCATGGCAAGAGCCAGTCAGG - Intronic
906156670 1:43617924-43617946 GGCCCTGCCAGGAGGCGGGTGGG + Intronic
907392529 1:54167621-54167643 GGCCTTGCCAAGAGACTGTGTGG - Intronic
916430351 1:164722049-164722071 GGACCTGTAAAGAGTCGGTCAGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
921414356 1:214870078-214870100 TGCCCTGCCGAGACCCCGTCTGG - Intergenic
922488811 1:225999187-225999209 GGCACTGCCAAGATCAGGTGAGG - Exonic
923110554 1:230886443-230886465 GGCCCTCCCCAGTGCCAGTCAGG - Intergenic
923660080 1:235950197-235950219 ACTCCTGCCAAGAGCCAGTCTGG - Intergenic
1063608596 10:7544142-7544164 GGCCCTGCCAAGAGGGTGCCTGG + Intergenic
1064284423 10:13980210-13980232 GGCCGTTCGAAGAGCCCGTCTGG + Intronic
1067325157 10:45259954-45259976 GGCCCGGCCGAGACCCCGTCTGG + Intergenic
1072539485 10:96387305-96387327 GGCTCTGCCAAGAGAAGGCCAGG + Intronic
1075729044 10:124625532-124625554 GGCCTGGCCAGGAGCCGGTGAGG - Intronic
1076747692 10:132522663-132522685 GGGGCTGCCAGGAGTCGGTCTGG + Intergenic
1077421027 11:2450042-2450064 GGCCCTGCCTAGGGCCGAGCAGG - Intronic
1078754252 11:14193796-14193818 GGCCCTGCCATGAGCCCTCCTGG - Intronic
1081726680 11:45334654-45334676 TGCCCTGCCAGGAGCAGGCCCGG - Intergenic
1081773892 11:45665164-45665186 GGCCCGGCCAATACCTGGTCGGG + Exonic
1082238815 11:49851720-49851742 GCCCCTGCCAGGAGCCGTTGGGG + Intergenic
1082996749 11:59261478-59261500 GGCCCTGCCAATAGACACTCTGG - Intergenic
1083339791 11:61951706-61951728 GGCCCTGGTCAGAGCCTGTCAGG - Intronic
1083660976 11:64251627-64251649 GGCCCGGCCAGGGGCGGGTCGGG - Exonic
1083762653 11:64827069-64827091 GGCCCTGCCAACGGGCGGCCCGG - Exonic
1084284139 11:68120862-68120884 GGCCCCGCCAGGCGCCGGGCAGG + Exonic
1084389484 11:68865717-68865739 GGCACTGCCAACAGCCCGCCAGG + Intergenic
1089620646 11:119720341-119720363 GGGCCTGCCAGCAGCTGGTCTGG - Intronic
1090414043 11:126528494-126528516 GACCCTGCCAAGATCTTGTCAGG - Intronic
1095439431 12:42227519-42227541 TGCCCTGCCGAGACCCCGTCTGG + Intronic
1095752553 12:45728790-45728812 GGCCCTTCCAACAGCCGGGCCGG + Intergenic
1097029065 12:56079149-56079171 GGACCTGGCCAGAGGCGGTCGGG - Intergenic
1102490075 12:113285344-113285366 GGCCCTGCCCAGAGACAGGCAGG + Intronic
1105033304 12:132900245-132900267 GGCCCTGGGAAGAGCCTGTGGGG + Intronic
1106134249 13:26962361-26962383 GACCCTGCCCACAGCAGGTCAGG + Intergenic
1113924385 13:113932373-113932395 GGCCCTGCCAAGGGCTGGCGAGG - Intergenic
1115851666 14:37594731-37594753 GGCCCGGCCAAGGCCCGGCCGGG + Intronic
1120922352 14:89766388-89766410 GGCACTGGCAAGAGCTGGACAGG - Intergenic
1121127428 14:91417378-91417400 GGCCGGGCCAGGAGCCGGGCGGG - Intronic
1122071576 14:99208663-99208685 GGCCCTGCCCCGAGCCTGCCCGG - Intronic
1123125729 14:105944813-105944835 GGCCCTGGCAAGAGGGCGTCGGG - Intergenic
1125768655 15:42151052-42151074 GGCCCTGCCCAGAGCCTGTGGGG + Intronic
1125930213 15:43594560-43594582 GGACCTGCCAAGACCAGCTCTGG + Intronic
1125943381 15:43694392-43694414 GGACCTGCCAAGACCAGCTCTGG + Intronic
1127207298 15:56733739-56733761 CGCCCCGCCACGCGCCGGTCCGG + Intronic
1128749693 15:70140187-70140209 CGTCCTGCCAAGAGCTGGGCAGG - Intergenic
1129876108 15:78976807-78976829 GGCCCTGCCAAGGGCAAGACTGG - Intronic
1130331221 15:82923752-82923774 GGCCCTGCCAGGAGCCGAGAGGG - Intronic
1132552426 16:559088-559110 GGCTCTGCCAGCAGCCGGACCGG + Intergenic
1132657318 16:1046717-1046739 GGCCCTGCCACCAGCCGCGCGGG - Intergenic
1133525930 16:6605678-6605700 GGCCCTGCCCAGAGCCTGGCGGG - Intronic
1134854318 16:17506085-17506107 TGCCCAGCCAAGACCCCGTCTGG - Intergenic
1138864764 16:60803300-60803322 GGCCCTTCAAAGAGCCCTTCAGG + Intergenic
1139775542 16:69314766-69314788 GGCCCTGCCAAGAGCCGGTCAGG + Intronic
1140475814 16:75238792-75238814 GGACCTGCCAACAGCGGGGCAGG + Intronic
1140660804 16:77190331-77190353 GGCCCTGCCACGGGCCAGTGTGG - Intergenic
1140866523 16:79067122-79067144 GGCCCTGTCTAGGGCCTGTCTGG + Intronic
1141445685 16:84056447-84056469 GGCCCTGGAAGGAGCCTGTCAGG + Intronic
1143369013 17:6426813-6426835 GGGCCTGCCCAGTGCCGGCCAGG - Intronic
1143585755 17:7849389-7849411 GGCCCCGCCAAGATCGGGCCGGG - Exonic
1145970099 17:28951260-28951282 GGCACTGGCGACAGCCGGTCCGG + Exonic
1148650208 17:49244962-49244984 GCCCCTGCCAATAGCCAGTGAGG + Intergenic
1148748675 17:49932222-49932244 GGCTCTGCCCAAAGCCGGCCTGG + Intergenic
1149637020 17:58179156-58179178 GGCCCTGCCAACACCCAGCCAGG + Intergenic
1149908815 17:60551194-60551216 TGCCCTGCCGAGACCCCGTCTGG + Intergenic
1152382696 17:79950365-79950387 GGCCCCGCGGAGAGCCGGCCGGG - Intronic
1152552012 17:81034798-81034820 GGCCCGGGCAACAGCCGGGCTGG - Intergenic
1152680709 17:81666488-81666510 GGCGCTGCCAAGACCCGTCCTGG + Exonic
1152889043 17:82869723-82869745 GGCTCTGCCCAGAGCAGGTCTGG - Intronic
1155356514 18:24958851-24958873 GGCCCTGGCAAGGGTCTGTCAGG - Intergenic
1155392699 18:25352230-25352252 GGGCCCGCCAAGACCCGGACTGG + Intergenic
1156445712 18:37235368-37235390 GGCCCTGCAAAGAGTGGGCCAGG + Intergenic
1160697316 19:491453-491475 GGCCCAGCCAGGAGCCGCACAGG - Intronic
1160702174 19:512925-512947 GCCGCTGCCAAGAGCCGCGCGGG + Intronic
1163836780 19:19579784-19579806 GGCCCGGCCCAGAGCCCATCAGG + Intronic
1163945537 19:20530583-20530605 GGCCCGGCCACGACCCCGTCTGG - Intergenic
1164531195 19:29049495-29049517 GGTCCTGCCAGGAGCCAGTGAGG + Intergenic
1165484922 19:36089814-36089836 GGCTCTCCCTAGAGCCGGTGTGG + Intronic
1166094431 19:40530391-40530413 GGCCCCGCAAAGAGGCGGGCAGG + Intronic
1166703618 19:44896236-44896258 GGGCCTGCCGTGTGCCGGTCAGG + Intronic
1167461074 19:49625052-49625074 GGGGCTGCCAAGTGCCGGGCTGG + Intronic
928642730 2:33317740-33317762 AGCCCTGCTTAGAGCCGGGCAGG - Intronic
931238646 2:60433215-60433237 TGCCCTTCCAAGAAACGGTCTGG + Intergenic
932413296 2:71559710-71559732 GGCCCTGCCAGGTGCAGCTCAGG + Intronic
932566854 2:72916227-72916249 GCCGCTGCCAAGACCCGGCCTGG + Intergenic
932761099 2:74439840-74439862 GGCCCTGCCGGGAGCCAGGCAGG + Intronic
937855618 2:126670415-126670437 GGCCCTGCCATGAGCCAGTGAGG + Intronic
938139142 2:128782328-128782350 GGCTCTGGCAAGGGCAGGTCTGG - Intergenic
945813254 2:214573551-214573573 GGCCCTGGCAAGACCCTGTTTGG + Intronic
946407024 2:219497229-219497251 GGCCGTGCCCAGAGCTGGGCTGG - Intronic
947750141 2:232527757-232527779 TGCCCCGCCCAGAGCCGGTGGGG + Intronic
948492209 2:238320803-238320825 GGCCCGGCCAGGTGCGGGTCGGG + Intronic
948506765 2:238433702-238433724 GGCGCTGCCCAGGGCTGGTCCGG + Intronic
1169327462 20:4686998-4687020 GGCCTTGCCAAGGGGCGTTCTGG - Intronic
1171366162 20:24626391-24626413 GGCCCGGCCACGACCCTGTCTGG - Intronic
1172098901 20:32474060-32474082 GGCCCTGCGCGGAGGCGGTCAGG + Intronic
1172183936 20:33019928-33019950 GGCCATGCCAAGAGCCAGGGTGG - Intronic
1172504446 20:35451175-35451197 GCCCATGCCAAGAGGCCGTCTGG - Intronic
1175628054 20:60505635-60505657 GGCCCTTCCAAGTGCTTGTCAGG - Intergenic
1176243162 20:64084277-64084299 GGCCCTGCCGAGGGGCGGGCAGG - Exonic
1178900372 21:36593278-36593300 GGCCCTGACAAGAGCCTCCCAGG + Intergenic
1179251320 21:39673771-39673793 GGCACTGCCAAGACCTGGCCAGG - Intergenic
1180235767 21:46458694-46458716 GGCCCAGCGCAGAGCCTGTCGGG + Intergenic
1181416427 22:22762661-22762683 GGCCAAGCCATGAGCAGGTCTGG + Intronic
1183023571 22:35046841-35046863 GCCTCTGCCAAGAGCCCTTCTGG - Intergenic
1183701705 22:39454727-39454749 TGCCCTGCCCAGAGCTGGCCAGG - Intergenic
1184600100 22:45538396-45538418 GACCCTGCCAAGAGGCGGGCAGG - Intronic
1185089293 22:48756897-48756919 GGCCCGGCCAAGGCCTGGTCAGG + Intronic
953138919 3:40209521-40209543 GGCCCAGGCAAGGGCTGGTCAGG + Intronic
955015349 3:55064387-55064409 GGCCCAGCCAGGTGCCGGTGAGG + Intronic
961653061 3:128426797-128426819 GGGTCTGCGAAGAGCCGGCCTGG + Intergenic
964749102 3:160038426-160038448 TGCCCTGCCAGAAGCAGGTCAGG - Intergenic
968201865 3:196762052-196762074 TGCCCGGCCAAGACCCCGTCTGG - Intronic
970617429 4:17781248-17781270 AGCCCTGGCAAGTGCCGGGCGGG + Exonic
985553255 5:543752-543774 GGCCCTGCCCAGAGCCCCCCAGG - Intergenic
988551950 5:32207919-32207941 TGCCCTGCCGAGACCCCGTCTGG + Intergenic
990354724 5:54955244-54955266 GGCCCTGCACAGAGCCTGGCAGG + Intergenic
994434663 5:99711604-99711626 AGCCCTGCCAATTGCAGGTCTGG - Intergenic
998134002 5:139665313-139665335 GGCCATGCCAAGACCCGCTGTGG + Intronic
998614995 5:143730254-143730276 TGACCTGCCAACAGCAGGTCTGG - Intergenic
1001629348 5:173163265-173163287 GATCCTGCAAAGTGCCGGTCTGG + Intronic
1001808494 5:174609215-174609237 AACCCTGCCAAAAGCCGTTCTGG + Intergenic
1002059685 5:176619234-176619256 AGCCACGCCAAGAGCCAGTCCGG + Intergenic
1007674348 6:43581209-43581231 TGCCCTGCCGAGACCCCGTCTGG - Intronic
1007831462 6:44641973-44641995 GGCCCGACCCAGAGCCTGTCTGG - Intergenic
1010317621 6:74468793-74468815 GGGCCTGCCAAGCGCTGCTCTGG - Intergenic
1013586342 6:111582303-111582325 GGTCCTGCCAGGAGACAGTCTGG - Intronic
1014763771 6:125388211-125388233 TGCCCGGCCACGACCCGGTCTGG - Intergenic
1022477370 7:30720333-30720355 AGCCCTGCCCAGAGCCTGTGTGG + Intronic
1023044157 7:36197052-36197074 GGCCCGGCCACGACCCCGTCTGG + Intronic
1025220645 7:57104701-57104723 GGGCCTACCAAGAGCTGGTGGGG + Intergenic
1025631461 7:63276513-63276535 GGGCCTACCAAGAGCTGGTGGGG + Intergenic
1034342709 7:150368665-150368687 GCCCCCGCCAAGAGCGGGCCGGG - Intronic
1034979195 7:155465586-155465608 TGCCCTGCCAGGAAGCGGTCTGG + Intergenic
1035038642 7:155911636-155911658 GGCCCTGCTCAGAGCTGGGCTGG - Intergenic
1036359120 8:8065311-8065333 GGGCCTGGCCAGAGCGGGTCTGG + Intergenic
1036891838 8:12601641-12601663 GGGCCTGGCCAGAGCGGGTCTGG - Intergenic
1040277291 8:46020582-46020604 GGCCCTGCCTAGAGGCTGCCAGG + Intergenic
1041089565 8:54289518-54289540 CGCCCTGCAAAGAGCCTGTGGGG - Intergenic
1042555759 8:70032891-70032913 AGCTCTGCCAGGAGCGGGTCTGG + Intergenic
1047290690 8:123527233-123527255 GGCCCTGCCACTAGCCAGTGAGG - Intronic
1047498578 8:125426065-125426087 GGCCCTGCCAGGAGCTGGCATGG + Intergenic
1049288057 8:141787230-141787252 GGCCCTCCCGAGAGCTGGTAAGG + Intergenic
1052492565 9:29188597-29188619 TGCCCGGCCACGACCCGGTCTGG - Intergenic
1060849033 9:126860197-126860219 TGCCCTGCCAGGAGCAGCTCGGG + Intergenic
1061961753 9:133992291-133992313 AGCACTGCCCTGAGCCGGTCGGG - Exonic
1062579503 9:137223072-137223094 GGCTCTGCCTAGAGCAGGTGCGG - Intergenic
1190241408 X:48659883-48659905 GGCCCGGCCACGACCCCGTCTGG - Intergenic
1192621166 X:72681205-72681227 TGCCCGGCCAAGACCCCGTCTGG + Intronic
1192795221 X:74420685-74420707 GGCCCGGCCCAGACCCGGCCCGG + Intergenic