ID: 1139775728

View in Genome Browser
Species Human (GRCh38)
Location 16:69316051-69316073
Sequence CAGCGCCTCCTCGTAGTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139775728_1139775730 -4 Left 1139775728 16:69316051-69316073 CCAAGAACTACGAGGAGGCGCTG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1139775730 16:69316070-69316092 GCTGCGGCTGTACCAGCATGCGG 0: 1
1: 0
2: 0
3: 14
4: 128
1139775728_1139775731 -1 Left 1139775728 16:69316051-69316073 CCAAGAACTACGAGGAGGCGCTG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1139775731 16:69316073-69316095 GCGGCTGTACCAGCATGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139775728 Original CRISPR CAGCGCCTCCTCGTAGTTCT TGG (reversed) Exonic
901052520 1:6432435-6432457 CAGAGCCTCCACGTAGGTCAGGG - Intronic
901635643 1:10668981-10669003 CAGCCCCTCCTCGGATTCCTAGG + Intronic
913418829 1:118641301-118641323 CAGCTCCTCCTTGTACCTCTGGG - Intergenic
915615515 1:157034689-157034711 CAGTGTCTCCTCATTGTTCTGGG - Intronic
920402265 1:205683366-205683388 CAGCCCCTCCTCATTGTCCTTGG + Intergenic
1065143812 10:22746459-22746481 CAGCTCCTCCTTGTACCTCTAGG - Intergenic
1076521304 10:131082911-131082933 CAGCTCCTCCTCCAAATTCTGGG + Intergenic
1082328531 11:51179891-51179913 CAATGCTTCCTTGTAGTTCTGGG - Intergenic
1082356740 11:51589968-51589990 CAATGCTTCCTTGTAGTTCTGGG - Intergenic
1082387089 11:52031304-52031326 CAGTGCTTCCGTGTAGTTCTGGG - Intergenic
1082410550 11:52371484-52371506 CAATGCTTCCGCGTAGTTCTGGG - Intergenic
1082428574 11:52632460-52632482 CAATGCCTCCCTGTAGTTCTGGG - Intergenic
1083313673 11:61800654-61800676 CAGAGCCTCCACTTAGTTTTGGG - Exonic
1083654730 11:64224116-64224138 CAGGGCCTCCTTGAAGTACTTGG + Exonic
1085282523 11:75340532-75340554 CAGCCTCTCCTCGTAGTGCTGGG - Intronic
1087248827 11:95873195-95873217 CAGTTCCTCCTTGTACTTCTGGG + Intronic
1089619644 11:119714813-119714835 CACTGCCTCCTCCTAGATCTGGG + Intronic
1095953952 12:47796076-47796098 CAGAGCCTCCTGGGTGTTCTGGG - Intronic
1096895250 12:54815151-54815173 CAGCTCCTCCTCGTACCTCTGGG + Intergenic
1097683772 12:62673308-62673330 CAGCACCTCCACTTAGTGCTCGG + Intronic
1108221045 13:48233419-48233441 GAGCGCCTCCTCGCCGCTCTTGG - Exonic
1112919292 13:104591394-104591416 CAGAACCTCCTAGTAATTCTAGG + Intergenic
1125598635 15:40903304-40903326 CTGCTCCTCCTCGTAGCGCTGGG - Exonic
1126660167 15:51025537-51025559 CAGCTCCTCTTCAGAGTTCTAGG + Intergenic
1129906282 15:79189901-79189923 CATGGCCTCCTACTAGTTCTTGG + Intergenic
1131306026 15:91243870-91243892 CCGCCCCTCCTGGAAGTTCTAGG - Intronic
1133056070 16:3146003-3146025 CAGCGCCTCCACGTCATGCTGGG - Exonic
1133252821 16:4495299-4495321 CAGGGCCTGCTGGTAGTGCTGGG + Intronic
1134636531 16:15796092-15796114 CACCGCCTCTTCCTAGTTCAGGG - Intronic
1139775728 16:69316051-69316073 CAGCGCCTCCTCGTAGTTCTTGG - Exonic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1151683036 17:75631626-75631648 CAGCGCATCCCCGAAGTACTTGG + Exonic
1151731465 17:75914021-75914043 CTCCCCCTCCTCGTACTTCTCGG + Exonic
1156427148 18:37026285-37026307 CAGCTCCTCCTTGTACCTCTGGG - Intronic
1158673250 18:59495776-59495798 CAGTGCCCCCTCGTACATCTTGG - Intronic
1162328183 19:10010814-10010836 CTGCACCTCCTCCTAATTCTAGG - Intergenic
1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG + Exonic
1165922604 19:39308125-39308147 CAGCGCCTCGTAGTGGTCCTGGG + Exonic
942846560 2:180432977-180432999 CAGCGCCTCTTCTCAGTTTTGGG + Intergenic
942924121 2:181411641-181411663 CCTCCCCTCCTGGTAGTTCTGGG + Intergenic
946391424 2:219418917-219418939 CAGCTCCTCCTCGTAGAGCTCGG - Exonic
947766413 2:232640789-232640811 CAGGGGCTCCTGGTCGTTCTGGG + Intronic
948854212 2:240722518-240722540 CAGCGCCTCCTCCCCGCTCTCGG - Exonic
1174339674 20:49887908-49887930 CAGCTCCTGCTCGTCGTCCTCGG - Exonic
1174895202 20:54441720-54441742 CAGCGCCTTCTGGGACTTCTAGG + Intergenic
1175838984 20:62014747-62014769 CAGGGCCTCCTCATGGCTCTGGG - Intronic
1176412983 21:6458768-6458790 CAGCGCCTCGTCCTGGTTCTAGG - Intergenic
1179688478 21:43067090-43067112 CAGCGCCTCGTCCTGGTTCTAGG - Intronic
1181134234 22:20752998-20753020 CAGCTCCTCCTCGTTCTCCTTGG + Exonic
1182319183 22:29467304-29467326 CAGCGCATCCTTGTGGTTCCAGG - Intergenic
1184256488 22:43289967-43289989 CAGCGCCTCCTCCTTGTTAAGGG + Intronic
1185163211 22:49241951-49241973 CGTCGCCTCCGCGTACTTCTGGG + Intergenic
957555567 3:81761464-81761486 GAGCGCCGCCTCGTAGTCCTCGG + Exonic
968548542 4:1210764-1210786 CAGCCCCTCCTCGTACTACCTGG + Intergenic
968659725 4:1793988-1794010 CGGCGCCTCCTCGGAGTCCTTGG + Exonic
972538676 4:40020469-40020491 CATGGCCTCCTTATAGTTCTGGG - Intergenic
992811542 5:80393704-80393726 CAGCTCCTCCTTGTACCTCTGGG + Intergenic
997758831 5:136425051-136425073 CAGCGCCCCCTGGTGTTTCTAGG + Intergenic
997975663 5:138440108-138440130 CAGGGGCTCCTCGTGGTTCTCGG + Intronic
998318670 5:141208842-141208864 CAGCGCCTCTTCGCAGTTGTGGG - Exonic
1002158267 5:177299943-177299965 CAGAGCCGCCTCCTAGGTCTTGG + Exonic
1002499628 5:179639496-179639518 CAGCGCCTGCTCATAATCCTTGG + Intergenic
1004532415 6:16465555-16465577 CATTGCATCCTCCTAGTTCTTGG - Intronic
1006540636 6:34737122-34737144 CAGCGCATCCTCATTCTTCTTGG + Intergenic
1007414239 6:41682839-41682861 TGGCGCCTCCTCCTAGTTCCAGG - Intergenic
1009905674 6:69867516-69867538 CGGCGCCGCCTCCTGGTTCTCGG - Intronic
1011210690 6:84953194-84953216 CAAGGCCTCCTTTTAGTTCTTGG + Intergenic
1019655936 7:2195774-2195796 AAGCACCTCCTGGCAGTTCTGGG - Intronic
1022537090 7:31105027-31105049 CAGCCCCTCCTCTCAGTGCTGGG - Intronic
1025263385 7:57437703-57437725 CAGCGCCTCCTCGGAGCTCCTGG + Intergenic
1025635864 7:63318420-63318442 CAGCGCCTCCTCAAAGCTCCTGG - Intergenic
1025646832 7:63429760-63429782 CAGCGCCTCCTCAAAGCTCCTGG + Intergenic
1030056333 7:105586776-105586798 CAGCGCATCCTCATTCTTCTTGG - Intronic
1035894132 8:3378311-3378333 CAGCTCCTCTTTGTACTTCTGGG - Intronic
1041978848 8:63831985-63832007 CAGCACCTCCTCATTCTTCTTGG + Intergenic
1042268321 8:66931092-66931114 CATGGCCTACTCTTAGTTCTTGG + Intergenic
1045265047 8:100611870-100611892 CAGAGCCTTCTCTAAGTTCTTGG + Intronic
1047674834 8:127189456-127189478 CAGCCCCTCCTCTCAGCTCTTGG + Intergenic
1049634813 8:143681985-143682007 CAGAGCCTCCTCATTCTTCTTGG - Intergenic
1049654004 8:143789807-143789829 CAGCGCCTCCTCGGCCTTCTGGG - Intergenic
1049755194 8:144308298-144308320 CAGCGCCTCCTGATAGCTCTGGG + Intronic
1050887283 9:10781832-10781854 CAGCTCCTCCTTGTACCTCTGGG - Intergenic
1051353395 9:16219013-16219035 CATCGCATCCTCGTAGCTTTGGG - Intronic
1051865253 9:21673250-21673272 CAGCTCCACCTCAAAGTTCTTGG - Intergenic
1052938844 9:34116023-34116045 CAGGGCCTCCTCTTAGTACTGGG + Intronic
1054670344 9:67784173-67784195 AAGAGCCTCCTGGTATTTCTTGG - Intergenic
1059409526 9:114123457-114123479 CAGCGCCTCCCTGTAATGCTGGG + Intergenic
1188005431 X:25013305-25013327 CAGCTCCTCCTCGTCGTCCTCGG + Exonic
1190569733 X:51769075-51769097 CAGCGCATCCTCATTCTTCTTGG + Intergenic
1190705616 X:53024311-53024333 CAGCGCATCCTCATTCTTCTTGG + Intergenic
1199051999 X:143246566-143246588 CAGCTCCTCCTTGTACTTCTGGG + Intergenic
1199483928 X:148328045-148328067 CAGCTCCTCCTTGTACCTCTGGG + Intergenic
1199486061 X:148349485-148349507 CAGCTCCTCCTTGTACCTCTGGG + Intergenic
1200714813 Y:6526209-6526231 CAGCTCCTCCTTGTACCTCTGGG + Intergenic
1200905435 Y:8477051-8477073 CAGCTCCTCCTTGTAACTCTGGG + Intergenic
1201019012 Y:9634922-9634944 CAGCTCCTCCTTGTACCTCTGGG - Intergenic