ID: 1139776511

View in Genome Browser
Species Human (GRCh38)
Location 16:69320050-69320072
Sequence CTGTGGGAAGGGTGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 1, 1: 0, 2: 11, 3: 90, 4: 740}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139776501_1139776511 -6 Left 1139776501 16:69320033-69320055 CCGTGGCCTGCGCCTCCCTGTGG 0: 1
1: 0
2: 4
3: 32
4: 413
Right 1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG 0: 1
1: 0
2: 11
3: 90
4: 740
1139776494_1139776511 28 Left 1139776494 16:69319999-69320021 CCTCACCACCACGTTTTCCGCAA 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG 0: 1
1: 0
2: 11
3: 90
4: 740
1139776497_1139776511 20 Left 1139776497 16:69320007-69320029 CCACGTTTTCCGCAATTCCGGCA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG 0: 1
1: 0
2: 11
3: 90
4: 740
1139776495_1139776511 23 Left 1139776495 16:69320004-69320026 CCACCACGTTTTCCGCAATTCCG 0: 1
1: 0
2: 0
3: 5
4: 30
Right 1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG 0: 1
1: 0
2: 11
3: 90
4: 740
1139776500_1139776511 3 Left 1139776500 16:69320024-69320046 CCGGCATGACCGTGGCCTGCGCC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG 0: 1
1: 0
2: 11
3: 90
4: 740
1139776498_1139776511 11 Left 1139776498 16:69320016-69320038 CCGCAATTCCGGCATGACCGTGG 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG 0: 1
1: 0
2: 11
3: 90
4: 740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139776511 Original CRISPR CTGTGGGAAGGGTGAGAAGA GGG Intronic
900204828 1:1427391-1427413 TGGAGGGAAGGGGGAGAAGAGGG - Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900791457 1:4683717-4683739 CTGTGGGACAAGTGAGAGGAAGG - Intronic
901450065 1:9330651-9330673 GTTTGGGAAGGGAGAGAAAAAGG - Intronic
901955973 1:12785965-12785987 ATATGGGAAGGGTGTTAAGAAGG + Intergenic
902165093 1:14563709-14563731 CTGTGGCAGGGCTGAGAGGATGG - Intergenic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902798664 1:18815899-18815921 CTGAGGGAAGAGTGAGAGGTGGG - Intergenic
902801136 1:18830995-18831017 GTGTGGGGTGGGTGAGAGGAGGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903344373 1:22675075-22675097 CTGTGGCAGCGGTGAGAAGATGG - Intergenic
903385603 1:22924292-22924314 GAGAGAGAAGGGTGAGAAGAAGG - Intergenic
903667737 1:25018178-25018200 CTAGGGGTGGGGTGAGAAGAGGG - Intergenic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904142303 1:28363262-28363284 CATTGGGAAGGCTGAGAGGATGG - Intergenic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
905175667 1:36134041-36134063 CTGTGGGAAGGGGGAGTGGGGGG - Intergenic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905408819 1:37754309-37754331 CTCTGGGCACGGTGAGCAGAGGG + Exonic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905616571 1:39404919-39404941 CTGACAGAAGGGTGGGAAGAAGG - Intronic
905857026 1:41320954-41320976 GTGTGGCAAGAGTGAGAAGCAGG + Intergenic
905864690 1:41370399-41370421 CTAGGGCAAGGGTCAGAAGATGG - Intronic
906915121 1:50000903-50000925 CAGGGGGAAGGGTGGGAGGAGGG + Intronic
907021724 1:51072710-51072732 ATTTTGGAAGGGTGAGAATAAGG - Intergenic
907240630 1:53079092-53079114 CTGTCTGAAGGGTGAGGAGAAGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908796834 1:67838520-67838542 GTGTGGGAAGGGTGTGATGAGGG - Intergenic
909269149 1:73600815-73600837 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
910179366 1:84464205-84464227 CTGAGGGAAGGGTGAGGGAAAGG + Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911114593 1:94233678-94233700 CTGTTGGAAGAATGAGAAGGAGG - Intronic
911754446 1:101536817-101536839 GTGTGGAAAGGGTGGGAAGACGG + Intergenic
912084535 1:105982273-105982295 CTGGGGGAGCTGTGAGAAGAGGG + Intergenic
912099463 1:106188418-106188440 GTGGGGTAGGGGTGAGAAGAGGG - Intergenic
912379995 1:109242197-109242219 ATGTGGGCAGGGTCAGGAGATGG + Intergenic
912429210 1:109620329-109620351 CTGTGGCCAGAGTGACAAGAGGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912950374 1:114116533-114116555 CTTGAGGAAGGGTGAGGAGATGG + Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913323995 1:117610441-117610463 CTGTGGGAAGGGCCTGAAGCTGG - Intronic
914454878 1:147826642-147826664 TTGGGGGAAGCGTGGGAAGAGGG - Intergenic
914830139 1:151165255-151165277 CTGTTGGCAGGGTGAAGAGATGG - Exonic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
916321025 1:163504550-163504572 CTCTGGGAAGGGTGTAAATAGGG + Intergenic
916530939 1:165655713-165655735 CTGCTGGAAGGGTGAGGAGAGGG - Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
917072585 1:171168783-171168805 ATTAGGGAAGGGTGAGATGATGG - Intergenic
917506223 1:175629506-175629528 GTGGGGGAGGGGTGAGAAGAGGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
918106416 1:181419199-181419221 CAGGGGGAAGAGGGAGAAGATGG - Intronic
919306225 1:195842302-195842324 GTGTGGGAAGAGTGAGAAGGAGG - Intergenic
920234481 1:204493926-204493948 CTGTGGACTGGGTGAGAAGTCGG - Intronic
920654608 1:207866518-207866540 AGGTGGGCAGGGTGAGATGATGG - Intergenic
920669338 1:207991221-207991243 ATGTGGGAGGGGTGATGAGAAGG + Intergenic
920867805 1:209767935-209767957 GATTGGGAGGGGTGAGAAGAAGG - Intronic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923383716 1:233446626-233446648 CTGTAGGAAGGGACAGATGATGG + Intergenic
923429433 1:233905796-233905818 CTGTGACAATGGTAAGAAGATGG - Intronic
923499761 1:234555105-234555127 CTGGGGGAGGGGTGAGGAGGAGG - Intergenic
923802939 1:237228120-237228142 GTGGGGAAAGGGTGGGAAGAGGG - Intronic
924013000 1:239686486-239686508 CCCAGGGAAGGGTGAGCAGAAGG - Intronic
924667337 1:246086875-246086897 CTGTCGGAAGGGCGAGGGGAGGG - Intronic
924709161 1:246519640-246519662 CTAGGGGAATGGGGAGAAGAAGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1062989259 10:1800176-1800198 GTGAGGGAAGGGTGAGGAGACGG + Intergenic
1063121188 10:3106599-3106621 CAGTGGCAGGGGTGAGGAGAGGG - Intronic
1063180689 10:3596352-3596374 AGGAGGGAAGGGAGAGAAGAGGG + Intergenic
1063563258 10:7148916-7148938 CTGTGGAAAGGATAAGAAAAAGG + Intergenic
1063564875 10:7163868-7163890 CCGTCGGAAGGGTCAGAAGCAGG + Exonic
1063655772 10:7986958-7986980 CTGGGGGAAGGGTGAGATGTGGG - Intronic
1063740979 10:8819108-8819130 TTGTCGAAAGAGTGAGAAGATGG - Intergenic
1063928417 10:11004028-11004050 CTCTGGGCAGGGGGAGACGAAGG - Intergenic
1064453695 10:15467215-15467237 GTGTGGCAGGGGAGAGAAGAGGG + Intergenic
1064483104 10:15759328-15759350 CTGTGGGAAGGATGAGTGGGAGG - Intergenic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1066479071 10:35777979-35778001 CTGTGTGAAGTGTGAGCAGCTGG - Intergenic
1067068474 10:43116550-43116572 ATGAGGGAAGGGGGAGAAGAGGG - Intronic
1067332375 10:45334071-45334093 CTGTGGGGAGGCTGACAAGATGG - Intergenic
1067332599 10:45335247-45335269 CTGTGGAAACAGTGAGTAGAAGG - Intergenic
1067718776 10:48710592-48710614 CTTTGGGAGGGAGGAGAAGATGG + Intronic
1068234051 10:54209292-54209314 CTGTTGGCAGTGTGAAAAGATGG + Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069954812 10:72043451-72043473 CTGGGGAAAGGAGGAGAAGAGGG + Intergenic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070224139 10:74483001-74483023 CTATTGGAATGGTGAGAAGAGGG - Intronic
1070445259 10:76493267-76493289 CTGTGGTAATGGTGACAATAGGG - Intronic
1070666880 10:78351244-78351266 CTTCGGGAAGGGTGGGGAGAGGG - Intergenic
1070763839 10:79045071-79045093 CTGTGGGAAGGTGGTGAGGAGGG + Intergenic
1072456848 10:95583924-95583946 CTGTGGGACTGGTGAAAGGATGG + Intergenic
1072667693 10:97406260-97406282 CAGTGGGAAGGCTGAGAAAAGGG + Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073135964 10:101220570-101220592 GTGTGAGAAAGGGGAGAAGAAGG + Intergenic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074575181 10:114662350-114662372 CAGTGGGAAGGCTGTGAAAAAGG + Intronic
1074925217 10:118061997-118062019 CTTTGGGAAGGCAGAGAAGCAGG + Intergenic
1075148869 10:119908176-119908198 CTGGAGGAAGAGTAAGAAGATGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075611675 10:123859742-123859764 CTGTGGTCAGGGTGAAAAGGAGG - Intronic
1075826110 10:125358290-125358312 CTGGTGGAACTGTGAGAAGAAGG - Intergenic
1075842518 10:125517241-125517263 CTGTGGAAAGTGTTGGAAGATGG + Intergenic
1076570446 10:131429331-131429353 CTGTCTGGAGAGTGAGAAGAGGG - Intergenic
1076583325 10:131529657-131529679 GTGTGAGGAGGGTGAGAAGGCGG - Intergenic
1076862957 10:133150605-133150627 GAGTGGGGAGGGTGAGAGGAGGG + Intergenic
1077066742 11:644447-644469 CTGGGGGGACGTTGAGAAGAGGG - Exonic
1078151295 11:8761667-8761689 GCGTGGGAAGGGTGAGAAGGAGG - Intronic
1078430639 11:11285508-11285530 CTGTGGGATGAGGGAGAGGAGGG + Intronic
1078929049 11:15899388-15899410 GTGGGGCAAGGGTGAGATGAGGG + Intergenic
1079103892 11:17558439-17558461 CTGTGGGGAGAGGGAGAGGAAGG - Intronic
1079193229 11:18299965-18299987 TTCTGGGAAGGGTAAGAGGAAGG + Intronic
1079292954 11:19204832-19204854 GTGGGGGATGGGTGAGGAGAGGG + Intronic
1080586845 11:33690295-33690317 TTATGGGAAGGTTTAGAAGAGGG + Intergenic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1082028269 11:47587951-47587973 CTGGGGGAAGGGGCAGAAGCAGG - Intronic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1083842323 11:65311544-65311566 CTGTGGTAGGGGTGAGTAAAGGG - Intergenic
1083844122 11:65321246-65321268 CTGTGGGCAGGGTGAGAGCCTGG - Exonic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1084410161 11:69002260-69002282 ATGTGGGAAGGGTGGGGTGAAGG - Intergenic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084653651 11:70502932-70502954 CTGTGGGAAGGCGGAGAGGATGG + Intronic
1084662519 11:70554542-70554564 CTGGGGGAGGGGGGAGGAGAGGG - Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1084982307 11:72836389-72836411 CTGCTGGAGGGGTGAGAGGAAGG - Intronic
1085251697 11:75148177-75148199 CTGTGAGATGGCTCAGAAGACGG - Intronic
1085304219 11:75476087-75476109 CTGAGGCTAAGGTGAGAAGAAGG - Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085654718 11:78303039-78303061 CTCGGGAAAGGGTGAGAGGAGGG + Intronic
1085705981 11:78787084-78787106 CTGTGGGGAGGAGCAGAAGAAGG + Intronic
1085859923 11:80221164-80221186 GGCTGGGAAGGGTGAGGAGAAGG + Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1085957754 11:81421030-81421052 GGGTAGGAAGGGTGAGAAAAGGG - Intergenic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1087104691 11:94398002-94398024 CAATGTGAAGGGTGAGAAGTTGG - Intronic
1088013025 11:105026183-105026205 GTGTGGGAAGGTTGAGGAAAGGG - Exonic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088824697 11:113483820-113483842 CTGAGGGAAGGCTGGGAACATGG - Intergenic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089204557 11:116749092-116749114 GTGGGGGAAGGGTGTGAACAAGG - Intronic
1089492383 11:118892147-118892169 CTGCGGGAAGGGTTGGCAGATGG + Intronic
1089674193 11:120079026-120079048 CTGTGCAAAGTGTGAGAAGATGG + Intergenic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1089748874 11:120636278-120636300 CTGGGGTAGGGGTCAGAAGACGG - Intronic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090333914 11:125950471-125950493 CTGTGGGAAGGGGAAGGGGAAGG + Intergenic
1090383536 11:126343487-126343509 CTCTGGGAAAGGTGAGGAAAGGG - Intronic
1090738558 11:129634459-129634481 CTACGGGAAGAGTGAGAAGGGGG + Intergenic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091025286 11:132136064-132136086 CTGTGAGGAGGCTGAGAGGAAGG - Intronic
1091701668 12:2667359-2667381 CTGGGGGAAGGGAGACCAGAGGG + Intronic
1091753814 12:3038987-3039009 CTGGGGAAGGGGTGAGGAGAGGG - Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1094654686 12:32408944-32408966 CTCTGGGAAGGTTCAGCAGAGGG + Intronic
1095517646 12:43024233-43024255 CTTTGGGGAGGGTCAGGAGAGGG + Intergenic
1095617375 12:44206812-44206834 GAGTGGGGAGGGTGAGAGGAGGG + Intronic
1096544976 12:52331925-52331947 TTGATGGATGGGTGAGAAGAAGG - Intergenic
1096616141 12:52834524-52834546 CTGGGGGCAGGGGGAGAAGGTGG - Intergenic
1096784046 12:54007068-54007090 ACGAGGGAAGGGTCAGAAGAGGG - Intronic
1097182649 12:57180024-57180046 CTGGGGGGAGGGTGCCAAGAGGG - Intronic
1097295286 12:57956443-57956465 CAGTGGGAAAGATGAGAAAATGG + Intronic
1098030815 12:66251911-66251933 ATGCTGAAAGGGTGAGAAGAAGG + Exonic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098275069 12:68804807-68804829 CAGTGGGAAGGAGGAGAAGGGGG + Intergenic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1099486202 12:83232404-83232426 CTGTGGGAAGGGTCAGCTGTGGG - Intergenic
1099613213 12:84902924-84902946 TTGTGGTAAGGGATAGAAGAAGG + Intronic
1100167544 12:91934054-91934076 CTGTTGTAAGAGTTAGAAGAAGG - Intergenic
1100210477 12:92393661-92393683 CTGCTGGATGGGTGTGAAGAAGG - Intergenic
1100451806 12:94713731-94713753 CAGTGGGAAGTGTGTGGAGAAGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101544070 12:105694170-105694192 CAGGGGGAAGGGTGAGAAGTGGG - Intergenic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1103171404 12:118823258-118823280 CTGTGGGCAGTGTGAGCACAGGG + Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1104639139 12:130456348-130456370 CAATGGGAAGGATGAGAACAGGG - Intronic
1104919767 12:132284788-132284810 TTGTGGGAAGGGTGTGAAGTGGG + Intronic
1105007349 12:132729553-132729575 GTGAGGGAAGGGGGAGATGAGGG + Intronic
1105414675 13:20199697-20199719 GTGTGGGAAGGTGGAGAAGCAGG + Intergenic
1105580352 13:21689940-21689962 ATGTGGGAGAGGTGAGAGGAAGG - Intronic
1105673731 13:22647923-22647945 GTGTGGGAAGGGGGAGGAAACGG - Intergenic
1105888786 13:24666816-24666838 ACGTGGCAAGGGTGAGATGAAGG + Intergenic
1106142050 13:27019743-27019765 CTGAGGGAAGCGTGAGAATGTGG + Intergenic
1106232359 13:27830398-27830420 CTGGGGTAAGGGTGGGAAGGGGG + Intergenic
1106512280 13:30422000-30422022 ATGTGGGAGGGGAGAGAAGGAGG + Intergenic
1107021020 13:35751698-35751720 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
1107790190 13:43994296-43994318 CTGGGGCAAGAGTGTGAAGAAGG - Intergenic
1109276141 13:60306392-60306414 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1109507889 13:63331007-63331029 GGGTGGGAAGGGTGAGAAGGGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110367558 13:74704236-74704258 CTTTGTGAAGGGTGAGAGGAGGG - Intergenic
1110390393 13:74966970-74966992 CAGCGGGAAGTGTGAGAAGCTGG + Intergenic
1111276596 13:85956090-85956112 CATTGGGAAGGCTGAGAAGTAGG + Intergenic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1112210414 13:97371629-97371651 CTCTAGGAAGAGTGAGCAGATGG + Intronic
1112265573 13:97920359-97920381 CTGGGGGTCGGGGGAGAAGAGGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112629201 13:101141739-101141761 CTGTGGGAAGGGAAAGAAAGCGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1115093227 14:29603770-29603792 CTGTGGAAAGCCTGAGAAGTTGG - Intronic
1115095900 14:29635320-29635342 TTGTGGGAAGGGGGACAAGGAGG - Intronic
1115227680 14:31121271-31121293 GTGTGGAAGGGGTGAGAGGAGGG - Intronic
1115707207 14:36011577-36011599 GTGTGGAAAGGGTGGGAAGGGGG - Intergenic
1115801074 14:36994353-36994375 TTGTGGGAAGGAAGAGAATAAGG + Intronic
1115906503 14:38208691-38208713 CTGCGGGACGGGAGAGAAGCTGG + Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115945281 14:38652912-38652934 CTGTTGGAAGTTTGAGAAGAAGG - Intergenic
1117531183 14:56661881-56661903 CTGTGAGAAGGGGGAGAAAGAGG + Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118655018 14:67937755-67937777 CTGTGGTAAGGGGCTGAAGAAGG - Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119669423 14:76507294-76507316 GTGAGGGAGGGATGAGAAGAGGG - Intergenic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1119726379 14:76924210-76924232 CGGTGGGGAGGGGGAGAAGGGGG + Intergenic
1119731380 14:76953490-76953512 CTGTGGGATGGGTTAGAAGCTGG - Intergenic
1121108165 14:91294129-91294151 CTGTGGTGAGGGTGCGGAGAGGG + Intronic
1121321699 14:92995273-92995295 CTGTGGAGTGGGTGAGCAGAGGG - Intronic
1121529066 14:94640013-94640035 CTGTGGAAAGGGCGAGAGCAAGG + Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121715895 14:96074022-96074044 TGTTGGGAAGGGTGGGAAGAGGG + Intronic
1121982183 14:98464432-98464454 CTGTCAGAAGGGTGAAAAGATGG + Intergenic
1122008473 14:98726069-98726091 CAGTGGGAAGGATGCGACGAAGG - Intergenic
1122306989 14:100772709-100772731 CTGTGGGAAGGGCCAGCAAAGGG - Intergenic
1122437887 14:101711907-101711929 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437899 14:101711947-101711969 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437946 14:101712082-101712104 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438021 14:101712358-101712380 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438027 14:101712378-101712400 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438043 14:101712438-101712460 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438076 14:101712558-101712580 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438091 14:101712614-101712636 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438106 14:101712670-101712692 CGGTGGGTGGGGTGAGATGATGG - Intergenic
1122438112 14:101712690-101712712 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438124 14:101712730-101712752 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438146 14:101712806-101712828 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438152 14:101712826-101712848 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438170 14:101712886-101712908 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438176 14:101712906-101712928 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438340 14:101713502-101713524 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438346 14:101713522-101713544 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438352 14:101713542-101713564 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438382 14:101713654-101713676 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122557648 14:102590334-102590356 CTGTGGGAGGTGTAAGGAGAGGG + Intergenic
1122825965 14:104370605-104370627 CTGTGGAAAGAGCGTGAAGACGG - Intergenic
1123141513 14:106083490-106083512 GTGTGGGATGCCTGAGAAGAAGG + Intergenic
1123166693 14:106331712-106331734 GTGTGGGATGCCTGAGAAGAAGG + Intergenic
1123169379 14:106356762-106356784 GTGTGGGACGCCTGAGAAGAAGG + Intergenic
1123199946 14:106652838-106652860 GTGTGGGATGCCTGAGAAGAAGG + Intergenic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1125580694 15:40783395-40783417 CTCTGGGATGGGTGAGAGGAAGG + Intronic
1126308067 15:47283785-47283807 CTGTGGCAAGGGTGAGTAGGTGG - Intronic
1126457923 15:48884816-48884838 CTCTGGGAAGGGAAAGATGAGGG - Intronic
1126844121 15:52743409-52743431 ATGTGGGAAGCGGGAGTAGATGG - Intergenic
1127611821 15:60644691-60644713 CTTTGGGAAGAGAGAGAAGGAGG - Intronic
1127716476 15:61653930-61653952 ATGGGGGATGGTTGAGAAGATGG + Intergenic
1128109809 15:65069053-65069075 CTGCGGGAAGGGGAAGGAGAAGG - Intronic
1128332780 15:66766707-66766729 CTGTGTGATAGGTGAGAGGAGGG - Intronic
1129656562 15:77528713-77528735 CTGTGAGAAGGAGGAGATGAAGG + Intergenic
1129660020 15:77548308-77548330 GGGTGGGCAGGGTCAGAAGAAGG + Intergenic
1129705923 15:77794176-77794198 CTGAGAGATGGGTGAGAAGATGG - Intronic
1129945914 15:79539231-79539253 GTGTGGGATGGGTAAGAATAAGG + Intergenic
1130133250 15:81160959-81160981 CTTTGGGAAGGGTGGGAGAATGG + Intronic
1130255199 15:82322741-82322763 CTGTGGCAGAGGTGAGAAGTGGG + Intergenic
1130332555 15:82933554-82933576 CTGTGAGAATGATGAGAAGGTGG - Intronic
1130599775 15:85267265-85267287 CTGTGGCAGAGGTGAGAAGTGGG - Intergenic
1130742566 15:86616452-86616474 CAGTGGGCAGGGTGATAAAATGG + Intronic
1130929844 15:88416258-88416280 CTGAGAGAATGGTCAGAAGAGGG - Intergenic
1131693962 15:94855981-94856003 CTGTGGGAGGGTTGAGGAGCCGG - Intergenic
1131719355 15:95150373-95150395 CTGGAGGGAGGGTGCGAAGAGGG + Intergenic
1132482817 16:175083-175105 CTGTGGGCAGAGTCAGAAGAGGG + Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG + Intronic
1133467092 16:6038011-6038033 CTGTAGGAAGTTAGAGAAGATGG + Intronic
1133809831 16:9152833-9152855 CCCTGGGAGGGGTGAGCAGAGGG - Intergenic
1134069560 16:11252426-11252448 CTCTGGGAAGTGTGATCAGAGGG + Intronic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1134354964 16:13473536-13473558 CTCTGGGAAAGGTCAGAAAAAGG - Intergenic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1134855834 16:17518296-17518318 TTGGGGAAAGGGTGGGAAGAGGG - Intergenic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1135943175 16:26840566-26840588 AAGGGGGAAGGGAGAGAAGATGG + Intergenic
1136143608 16:28302452-28302474 CTCTGGGCAGGGTGTGAAGGGGG + Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136197955 16:28667010-28667032 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136259022 16:29061032-29061054 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1137371158 16:47907013-47907035 CTTAGGGAAGGGAGAGCAGATGG + Intergenic
1137420191 16:48326812-48326834 CTGTGGGAAGAGGGAGGAAAGGG - Intronic
1137598802 16:49742604-49742626 CTCTGGGAAGGGGGAGATGGGGG + Intronic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1138044338 16:53705136-53705158 TTGAGGGAAGGGAGAGAAGGTGG - Intronic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138532694 16:57643447-57643469 CTGTGGGAAGAGTGACAAAGGGG - Intronic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1141148330 16:81547441-81547463 CTGTGGGCACGCTGAGCAGAGGG + Intronic
1141589063 16:85055740-85055762 CTGGGGGAGAGGTGAGAAGAAGG - Intronic
1141675916 16:85517240-85517262 CTGTGGGAGGCGGGAGGAGATGG + Intergenic
1142478617 17:204557-204579 GTGAGGGATGGGTGAGGAGATGG - Intergenic
1142623371 17:1178792-1178814 CTCAGGGAAGGGTGGGGAGAAGG + Intronic
1142888845 17:2929974-2929996 CAGAGGGAAGGGTGAGCAGGTGG - Intronic
1143037455 17:4007505-4007527 CTGTGGGGGGGGTCAGAAGAGGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143444399 17:6998827-6998849 CTGAAGGCAGGGTGAGAAAAAGG + Exonic
1143646761 17:8235238-8235260 CAGTGGGAGGGGGGACAAGAAGG - Exonic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144328409 17:14203787-14203809 CTGTGGGAATGTTCAGAAAAAGG - Intronic
1144527554 17:16003108-16003130 CTGCAGGAAGGGGGAGAAGATGG + Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144764759 17:17726281-17726303 GTGTGGGAAGGGTGGGGAGCAGG - Intronic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146451903 17:32981414-32981436 CTGGTGGAACTGTGAGAAGAGGG - Intronic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1146685325 17:34837569-34837591 GTGTTGGAAGGCTGAGATGATGG + Intergenic
1146919704 17:36702533-36702555 CTGTGGGAAGGGGATGATGAGGG - Intergenic
1147396757 17:40149438-40149460 CTGAGGGAAGGCTGAAGAGATGG + Intronic
1147748091 17:42708269-42708291 TTGTGGGGAGGGTGTGGAGATGG + Intronic
1147782855 17:42956166-42956188 CTGTGGAGTGGCTGAGAAGAGGG - Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148080653 17:44966332-44966354 CTGTGGGAAGGGTTCCAACAAGG + Intronic
1148380536 17:47193654-47193676 GTGTAGGGTGGGTGAGAAGAAGG - Intergenic
1148478750 17:47946295-47946317 CAGGGGGAAGAGTTAGAAGAAGG - Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148976122 17:51530434-51530456 CAGGGGGAAGGATGAGAGGAGGG + Intergenic
1149448437 17:56731760-56731782 CTGAGGGAAGTGTCAAAAGATGG - Intergenic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152404562 17:80089233-80089255 CTGTGGAAAGGGTGCGGAGCAGG + Intronic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1152570067 17:81117783-81117805 CTGTGGGAAGGGTGGGCTTACGG + Exonic
1152643899 17:81460178-81460200 CGGTGGGGAGGGTGAGGGGAGGG - Intronic
1154080108 18:11248078-11248100 GTGTGGGGAGCGTGAGGAGAGGG - Intergenic
1154429127 18:14294903-14294925 AGGTGGGTAGGGTGAGAAGTAGG + Intergenic
1155123220 18:22843684-22843706 CTGGGGGAAGGAGGAGAAGGTGG - Intronic
1155633526 18:27923384-27923406 CTGTTTTAAGGGTGAGCAGATGG + Intergenic
1156232764 18:35170729-35170751 CAGTGGGGAGTGTGAGAGGAGGG + Intergenic
1156275267 18:35578078-35578100 TTGTGGGAAGGAACAGAAGAGGG - Intergenic
1156424862 18:36998598-36998620 CTGTGGTAAGGTTGTGATGAGGG - Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157106993 18:44783104-44783126 CTTTGGGAAAAGTGAGAACAGGG - Intronic
1157421758 18:47553798-47553820 CAGTCAGATGGGTGAGAAGAAGG + Intergenic
1157523393 18:48360842-48360864 CTGGCGGAAGGGTGAGGAAAGGG + Intronic
1157742243 18:50103634-50103656 TTCTGGGAAGGCTGAGAGGATGG + Intronic
1157749385 18:50164739-50164761 CTGTTGGAGGGGTGGCAAGAGGG - Intronic
1157818638 18:50749523-50749545 CCGTGGGGAGGGTGAGATGAGGG - Intergenic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1159563534 18:70022331-70022353 CGGAGGGAAGGCTGAGAGGAAGG - Intronic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1160979816 19:1811783-1811805 CTGTGGGACGGGGGAGAGGTGGG + Exonic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161748289 19:6075125-6075147 AGGTGGGAAGTCTGAGAAGAGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1163124184 19:15235752-15235774 CTGTGGGAAGGGTTGGGAAATGG + Exonic
1163230306 19:15997469-15997491 TTGGGGGATGGGTAAGAAGAGGG - Intergenic
1163668885 19:18616166-18616188 GGGTGGGCAGGGTAAGAAGATGG + Intronic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164613336 19:29648526-29648548 CTTTGGGAAGGTTTAGGAGAGGG + Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1164884692 19:31768408-31768430 ATGTGGGAAGGGGGAGAGGAGGG + Intergenic
1165491500 19:36126043-36126065 AGGTGGGAATGATGAGAAGATGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166357695 19:42236747-42236769 CTGTGAGAAGAGTGAGGAGGGGG + Intronic
1166858065 19:45792937-45792959 CTGTGGGCGGGGCGAGAAGGTGG + Intergenic
1166949406 19:46416556-46416578 CTGTGCGAAGGGGGAGGCGAGGG - Intergenic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167744867 19:51344858-51344880 CAGTGAGGTGGGTGAGAAGAAGG - Intergenic
1167776305 19:51559909-51559931 CTCTGGACATGGTGAGAAGATGG - Intergenic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
1168243049 19:55096737-55096759 CTGCGGGGAAGGTGTGAAGACGG - Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
1168630627 19:57953531-57953553 CTGCTGGAAGGGTGAGTACATGG - Intergenic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
924981124 2:222542-222564 CTATGGGATGGGTAAGAGGACGG + Intronic
926151342 2:10427195-10427217 CTGTGGGAAGGGTGGGGACGAGG + Exonic
926526849 2:13991955-13991977 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
926706851 2:15843262-15843284 CTGTGGGTTGGGTAAGCAGAGGG + Intergenic
927292842 2:21421609-21421631 CTTGGGGAAGGATGAGGAGATGG - Intergenic
927433409 2:23046429-23046451 CTGGGGGAAGGGGGAGAGGTAGG - Intergenic
927588081 2:24328204-24328226 CTGTTGGAAGTGTGAGCTGAAGG - Intronic
927726165 2:25424967-25424989 CTGTGGGATGGGAGATAATAGGG - Intronic
928089309 2:28364308-28364330 CTGAGGGAGGGATGAGAATAAGG - Intergenic
928314955 2:30237838-30237860 CTGTGGGGTGGGTGAGTAAATGG + Intronic
929375405 2:41280981-41281003 CTGGGGGTAGGGGGAGTAGATGG + Intergenic
930149213 2:48041255-48041277 CTGTTGGAGGGGTGAGTGGAGGG - Intergenic
930512129 2:52358737-52358759 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
930636728 2:53814462-53814484 TAATGGGTAGGGTGAGAAGATGG - Intronic
932449489 2:71800491-71800513 CAGTGGGAAGGCTGGGCAGATGG - Intergenic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932708897 2:74047773-74047795 CTGTCGGACAGGTGGGAAGAGGG - Exonic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933177387 2:79190915-79190937 CTATGGGTAGAGTGAGAAGATGG - Intronic
934909079 2:98234189-98234211 CTGTGGGAACTGTGAAAAGCAGG + Intronic
935445852 2:103155763-103155785 TTGTGGGAAGGGGGAGAAACAGG - Intergenic
935754714 2:106268056-106268078 TTGTGGGAAGGGTTATATGAAGG - Intergenic
935817060 2:106856321-106856343 CTGTGGGAAGGATTAAAAGGTGG - Intronic
936113739 2:109685750-109685772 TTGTGGGAAGGGTTATATGAAGG + Intergenic
936504018 2:113090360-113090382 ATTTGGGAAGGGTGAGAAGTGGG + Intergenic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936705949 2:115073959-115073981 CTCTGTAAAGAGTGAGAAGAAGG + Intronic
936859148 2:116995019-116995041 CAATGGGAAGGGGAAGAAGAGGG + Intergenic
936919805 2:117676278-117676300 CAGTGGGGAGGGTGAGAACAGGG + Intergenic
936957388 2:118036462-118036484 CTGTTGGAGGGGTGAGGGGAGGG - Intergenic
937105861 2:119312053-119312075 CTGTGGTAAGGGTGACAGGATGG + Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937479207 2:122241572-122241594 AGGAAGGAAGGGTGAGAAGAAGG + Intergenic
937879026 2:126851228-126851250 CTTTGGGGAGAGTCAGAAGAGGG + Intergenic
938013467 2:127847848-127847870 CTCTGCGAAGTGTGAGATGAGGG - Exonic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
939289530 2:140176186-140176208 TTGTGGTAGGGCTGAGAAGATGG - Intergenic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
939450455 2:142367062-142367084 CAGTGGGATGGATGAGAAGCTGG + Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
941135683 2:161715492-161715514 CTGAGGGGTGTGTGAGAAGAGGG - Intronic
941677118 2:168355720-168355742 CTGGGTGCAGGGTGAGAAGATGG - Intergenic
942101513 2:172588857-172588879 CTGAGTGAAGGATGAGAAGGAGG - Intronic
942909582 2:181227009-181227031 AGGTGAGAAGGGTGAGAAGAAGG - Intergenic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
944386574 2:199171502-199171524 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
945348134 2:208744158-208744180 AGGTGTGAAGGGTGAGAAAAAGG - Intronic
945977633 2:216283125-216283147 AGGTGGGAGGGGTGAGGAGAAGG - Intronic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947352894 2:229264820-229264842 GTGGGTGAAGGGTGAGAAGAAGG - Intronic
948389403 2:237601261-237601283 CTCTGTGCAGGGTGAGAGGATGG - Intronic
948768102 2:240233662-240233684 CTGTGGGCGGGGTCAGAGGAGGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
948790075 2:240372455-240372477 ATGTGGGAGGGATGGGAAGAGGG + Intergenic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1170045700 20:12083179-12083201 GGGTGGGAAGGATGAGATGACGG - Intergenic
1170195500 20:13685046-13685068 ATGGGGGAAGGGTGAGAAGATGG - Intergenic
1170710558 20:18786906-18786928 CTATTGGAACTGTGAGAAGAAGG - Intergenic
1171062037 20:21974366-21974388 CAGTGGGAAGGATGGGAGGAGGG - Intergenic
1171241826 20:23575640-23575662 TTGGGGGAAGGGTGAGAGGAGGG - Intergenic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172160765 20:32866537-32866559 ATTTGGGAAGGATGAGTAGAAGG + Intronic
1172429385 20:34876909-34876931 CTGAGGGGTGGGTGAGGAGATGG + Intronic
1172477627 20:35250745-35250767 CAGGGGGAAGAGTGAGAAGGGGG + Intronic
1172623853 20:36336422-36336444 CAGGGAGAAGGGTGAGAGGAGGG - Intronic
1172793869 20:37524005-37524027 CTTTGGGAAAGATGAGAGGAGGG + Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1172949830 20:38715789-38715811 CCGTGGGGAGGGTGAGATGCAGG - Intergenic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174292569 20:49519497-49519519 TGGTGGGAAGGGTGAGGAGGAGG - Intronic
1174391891 20:50222912-50222934 CTGTGGGAAGTGTGGGGCGAGGG - Intergenic
1174577499 20:51546979-51547001 CTCAGGGAAGGATGAGAAGATGG + Intronic
1174672858 20:52324144-52324166 CTGTGGGAGGGATGTGAAGACGG + Intergenic
1174800250 20:53557392-53557414 CTGTGGGGAGGTTTAGCAGAGGG - Intergenic
1175159790 20:56999747-56999769 CTGTGGGAGGGGACAGAACATGG - Intergenic
1175292512 20:57886004-57886026 CGGGGGGAAGGGTGGGAGGAGGG - Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175529779 20:59666479-59666501 CTGTGGGCAGGTGGAGCAGAAGG + Intronic
1175872977 20:62217077-62217099 CAGTGGGGAGGGTTAGAGGAAGG - Intronic
1176102168 20:63369595-63369617 GGGTGGGCAGGGTGAGCAGAGGG - Intronic
1176906614 21:14509396-14509418 TTGGGGAAAGGGTGAGAAGGTGG + Intronic
1178029626 21:28509253-28509275 TTGGGGGAAGGGTCACAAGAAGG + Intergenic
1178219887 21:30644329-30644351 TGGGGGGAAGGGTGAGAAGGAGG + Intergenic
1178788161 21:35673606-35673628 CTGTGGGGTGGGTCAGAGGAGGG + Intronic
1179250468 21:39667482-39667504 CTCTGGGAATGGTAAGAACAAGG + Exonic
1179575738 21:42307209-42307231 CAGTGGGATGGGGGAGCAGAGGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180004747 21:45015201-45015223 CTGTGGGATGGTTGAGATGGGGG - Intergenic
1180124850 21:45783810-45783832 CAGTGGTGAGGGTGTGAAGATGG + Intronic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181235080 22:21443751-21443773 CTCTGGTAGGGGTGAGAGGATGG + Intronic
1182267366 22:29128073-29128095 CTGGGGGAAGGGGAAGAATATGG + Intronic
1182300746 22:29335584-29335606 CTGTGGAAAGGGGGAGAGGGTGG - Intronic
1182420995 22:30248517-30248539 CTGGGGGAGGTGTAAGAAGAAGG - Intergenic
1182449326 22:30409355-30409377 CTGTGGGATGGGTGAGGCAATGG + Intronic
1182786508 22:32912258-32912280 CTGAGGAAAGGATGAGCAGAAGG + Intronic
1183029437 22:35092389-35092411 CAGTGGGCAAGGTGAGAACAGGG - Intergenic
1183165464 22:36144233-36144255 CTGGGAGTAGGGTGAGAAGAGGG - Intronic
1183240237 22:36652413-36652435 ATGTTTGCAGGGTGAGAAGAAGG - Intronic
1184103360 22:42353366-42353388 TTGGGGGAAGGGTGAGAAGAGGG + Intergenic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184673620 22:46028371-46028393 CTGTGGGAAGGATGATGATAAGG - Intergenic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
949773719 3:7607877-7607899 CTTGGGGGAGGGTGAGAGGAAGG - Intronic
950021820 3:9792832-9792854 CTGTGGCAAAGGTGACAAGAAGG + Intronic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
950649937 3:14401083-14401105 GGGTGGGAAGGGTGACAGGAAGG + Intergenic
950721584 3:14886568-14886590 CTGTGGCAAGGGTGTGGACACGG + Intronic
950806073 3:15604069-15604091 CTGGTGGAACTGTGAGAAGAGGG - Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951252974 3:20415892-20415914 CTGGGGCAAGGGTGAGCAGCTGG + Intergenic
951534676 3:23729862-23729884 GAGTGGGCAGGGTGAGAAGTAGG - Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951829922 3:26915048-26915070 CTGAGGGAAGGCTGGGGAGAAGG + Intergenic
953374989 3:42421040-42421062 CTGTGTGAGGGGTGAGGAGGTGG - Intergenic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
953866994 3:46592881-46592903 TGGAGAGAAGGGTGAGAAGAGGG + Intronic
954330960 3:49890061-49890083 CTGTGGAAAGGGGGAGGTGAGGG + Intronic
954540110 3:51387829-51387851 CTGTGAGAAGCTTAAGAAGAAGG + Exonic
955311017 3:57886517-57886539 CTGTAGGAAGATTGAGGAGAAGG + Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
956022978 3:64951756-64951778 CTTTGGGGAAGCTGAGAAGAAGG + Intergenic
956299249 3:67751869-67751891 TGGGGGGAAGGGTGAGAAGTGGG + Intergenic
956504475 3:69922813-69922835 TTGTGAGAAGGATGAGATGAGGG - Intronic
956786408 3:72646285-72646307 CTCAGGGAAGGGAGATAAGAAGG + Intergenic
957555807 3:81763076-81763098 CAGCAGGAAGGATGAGAAGACGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958018084 3:87966153-87966175 CTGAGGTTAGAGTGAGAAGACGG - Intergenic
959027559 3:101257928-101257950 CTCTGGGAAGGAGGAGAGGATGG - Intronic
959254088 3:103989061-103989083 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
959306411 3:104671831-104671853 CTATGGTAATGGTGAGCAGATGG + Intergenic
959682000 3:109106657-109106679 CCGTGTGAGGGGTGAGGAGATGG - Intronic
960246640 3:115407096-115407118 GTGTATGAAGGATGAGAAGATGG + Intergenic
960296623 3:115952562-115952584 CAGGGGGAATGGTGAGAGGAGGG + Intronic
960615080 3:119589143-119589165 CTGTGGGAGGAGTGAGGAGAAGG - Exonic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962339465 3:134569714-134569736 CTGGTGGAACTGTGAGAAGAGGG - Intronic
962350478 3:134652152-134652174 CAGTGATAAGGGTGAGAAGGTGG - Intronic
963422048 3:145073178-145073200 CTGGTGGATGTGTGAGAAGAGGG - Intergenic
964928838 3:161990676-161990698 CTGTGGGAAGGGACAGATAAAGG - Intergenic
965249717 3:166327597-166327619 CTATTGGAATTGTGAGAAGATGG - Intergenic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
966131896 3:176650822-176650844 CTGACAGAAGGTTGAGAAGAAGG + Intergenic
966746383 3:183281191-183281213 AGGGGAGAAGGGTGAGAAGAAGG + Intronic
966889389 3:184395606-184395628 CTGAGGGAAGGTGGGGAAGAGGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967331651 3:188296172-188296194 CTGGGGGAAGGATGAGAAGGAGG + Intronic
967459081 3:189724472-189724494 CCGGGGAAAGGGTGGGAAGAGGG - Intronic
968535823 4:1128215-1128237 CGGGGGAAAGGGTGAGAAGGAGG + Intergenic
968824818 4:2887455-2887477 CTGGGGGGAGGGGGACAAGACGG + Intronic
969010085 4:4054860-4054882 CTGGGGGAAAGGGGAGGAGATGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969834264 4:9826804-9826826 CTCTGGGAAAGATGAGAAAATGG + Intronic
969858958 4:10020968-10020990 CCCTGGGGAGGGTGAGAAGAGGG + Intronic
970261440 4:14229108-14229130 CTGAGCCAAGGGTTAGAAGATGG + Intergenic
971225511 4:24748028-24748050 CAGTGGGAAGGGTCATAAGAAGG + Intergenic
971306795 4:25490082-25490104 GAGGGGGATGGGTGAGAAGAAGG + Intergenic
971474610 4:27060865-27060887 CTATGGGAAGAGTGAGATGAAGG + Intergenic
972426584 4:38938687-38938709 CTGTGAAAAGGGTAACAAGAGGG - Intronic
972669927 4:41205389-41205411 TTTTGGGAATGGTGAGAAAATGG - Intronic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
975060093 4:69986189-69986211 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
975233212 4:71959242-71959264 CTGAGGGAAGGGGAAAAAGATGG - Intergenic
976075044 4:81288370-81288392 CTGTGGGAGGGGTGAAGGGAAGG - Intergenic
976664073 4:87571604-87571626 CTGAGGAAAGGGTGAGAGGGGGG - Intergenic
977059327 4:92237730-92237752 ATTTTGGAAGGGTGAAAAGAGGG + Intergenic
977293867 4:95191527-95191549 TGGTGGGGAGGGTGAGCAGAGGG - Intronic
977554150 4:98471717-98471739 ATTTTGGCAGGGTGAGAAGAAGG + Exonic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978267765 4:106846979-106847001 TTGTGGGAAGGGTCAGAAGATGG - Intergenic
978436645 4:108692795-108692817 CTGTGGATAGGGTGAGATCAAGG - Intergenic
979197132 4:117933264-117933286 CTGTGGGAAGGGGAAGACCATGG - Intergenic
980425887 4:132627661-132627683 AAGTGGGAAGGGTCAGAATATGG + Intergenic
980719250 4:136672272-136672294 CTGTGGTAAATGTTAGAAGAAGG + Intergenic
980874331 4:138645760-138645782 CTGTGGAAAAGGTGAGAAGCAGG + Intergenic
981567694 4:146117781-146117803 CTCAGGGAAGGGGGAGAAGGAGG + Intergenic
981678499 4:147366806-147366828 CTTGGGGAAGGGTGAGGAGGTGG + Intergenic
981817029 4:148842729-148842751 CTGGGGGAAGGGGGAATAGATGG - Intergenic
982343862 4:154334213-154334235 TTGAGGGAAGGGAGAGAGGAAGG + Intronic
982403516 4:154995403-154995425 CAGTGAAAAGGGTGAGCAGAGGG - Intergenic
982670481 4:158314267-158314289 CTGGGGAAAGGGTGAGTAAAGGG - Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983967653 4:173832600-173832622 CAGTAGGAAGGGTGAGAGAAGGG - Intergenic
984228397 4:177063719-177063741 CAGGGGGAAGGGTGTGAGGAGGG + Intergenic
985589018 5:755265-755287 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985603698 5:847781-847803 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
986057883 5:4157284-4157306 CTTTGAGAGGGGTGAGAACATGG - Intergenic
986517654 5:8580959-8580981 ATGTGGCAGGTGTGAGAAGAAGG - Intergenic
986612137 5:9579707-9579729 CAGGGGAAAGGGTGAGAAGTGGG + Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987069315 5:14321178-14321200 CTGTTTGAAGGATGAGGAGAAGG + Intronic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987419395 5:17700912-17700934 CTGTTCGCGGGGTGAGAAGAAGG + Intergenic
987506200 5:18776331-18776353 CTGTGAGAGGTGTGAGAAGTTGG + Intergenic
988600854 5:32638414-32638436 CTGGGGCAAGGGTAAGAAGGAGG - Intergenic
991370176 5:65910371-65910393 CGGGGGAAAGGGTGAGAGGAGGG + Intergenic
991997199 5:72400004-72400026 CTGTGCGGAGGGTGAGAACCAGG + Intergenic
992134250 5:73727216-73727238 CTGTGGGAATACTAAGAAGATGG + Intronic
992431715 5:76716468-76716490 CTGAGGCAGGGGTGAGGAGAAGG - Intronic
993440767 5:87954281-87954303 CTGTGGCAGGGGTGAGGAGTAGG - Intergenic
993833663 5:92789821-92789843 GTGTGTGAAGGGTGAGAGGAGGG - Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994032587 5:95161434-95161456 CTGGGGGAAGGGGGTCAAGAGGG + Intronic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994165924 5:96608107-96608129 CTGGGGGAAGGGTGTGGACAGGG - Intronic
994426743 5:99599317-99599339 GAGGGGGAAGTGTGAGAAGAAGG - Intergenic
994828571 5:104747295-104747317 CTAGGGGAGGTGTGAGAAGAGGG + Intergenic
994900397 5:105762563-105762585 CTGGGGGAGCTGTGAGAAGAGGG - Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
998203481 5:140143539-140143561 GTGAGGGAAGGAGGAGAAGAGGG - Intergenic
998205272 5:140153180-140153202 CTGGGGGAGGGGTGAGGAGATGG - Intergenic
998781330 5:145659889-145659911 ATGTGGGAAGGGATAGAAAAGGG + Intronic
999361506 5:150990040-150990062 GTGTTGGAAGGGGGAGAAGAGGG + Intergenic
999595728 5:153202071-153202093 CTGGGGGAAGAGTGATAAGGGGG - Intergenic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
1000232569 5:159329811-159329833 CTGTGAGAAGGGGGAAAAAAAGG - Intronic
1000440709 5:161259790-161259812 CAGGGGCAAGGGTCAGAAGAGGG - Intergenic
1000711000 5:164578482-164578504 CTGTGGAAAGGACGAAAAGATGG - Intergenic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1000957470 5:167559980-167560002 GAGTGGGAGGGGTGAGAGGAGGG - Intronic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001014569 5:168128524-168128546 ATGTGGGAAGGGGGAGCAAAGGG - Intronic
1001161998 5:169327577-169327599 CAGGGGGAAGGGTGGGAGGAGGG + Intergenic
1001262901 5:170247679-170247701 GTTTGGGAAGGATGAGGAGAAGG + Exonic
1001403648 5:171461155-171461177 ATTTGGGAAGGATGAGAAGAAGG - Intergenic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1001883730 5:175269762-175269784 CTGGGGGAAGGGGGAGAGAAAGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002473258 5:179450135-179450157 CTGTGGGAAGGAATAGATGAGGG + Intergenic
1002480964 5:179500518-179500540 CTGTGGGAAGGAATAGATGAGGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002816708 6:687781-687803 CACTGGGATGGGTGAGAAGTTGG + Intronic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003335419 6:5167286-5167308 CTTTGGGGAGGGTGACCAGAGGG - Intronic
1003511585 6:6785710-6785732 CAAGGGGAAGGGGGAGAAGAGGG + Intergenic
1003521933 6:6865587-6865609 CTGCGGTAAGGGTGAGATGGGGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004004662 6:11627879-11627901 TTGTTGGAAGTGTGAGAAGATGG + Intergenic
1006134927 6:31889341-31889363 CTCTGGGAAGGGGGAGGAGGAGG + Exonic
1006173259 6:32107590-32107612 CTGTGGGGAGGGTGCCAAGAGGG - Intronic
1006376929 6:33676881-33676903 CAGTGGCAAGGGTGAGGAGGTGG + Exonic
1006936614 6:37723277-37723299 CTGTGGGAAGGGTGAGGGTTGGG - Intergenic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1006989682 6:38203739-38203761 GGGTGGGAAGGGTGTGAAGGTGG + Intronic
1007958945 6:45941373-45941395 CTGTGTCAAGGGGGACAAGATGG + Intronic
1008001163 6:46361209-46361231 CTGGGGGAAGGGTGAGAGAAAGG + Intronic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008494984 6:52124167-52124189 CTGTGAGAAGGCTAAGATGAGGG + Intergenic
1008585973 6:52949685-52949707 CTCTGAGAAGGGAGAGAGGAAGG + Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1010467166 6:76181706-76181728 GAGTGGGGAGGGTGAGAGGAGGG + Intergenic
1011334518 6:86245578-86245600 CAGAAGGAAGGGTGATAAGAGGG - Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012225272 6:96696085-96696107 AGGGGGAAAGGGTGAGAAGAGGG + Intergenic
1013054507 6:106570481-106570503 CTCTTTGAAGGGTGAGATGAGGG - Intergenic
1013250878 6:108332014-108332036 CTCTTGGAAGGGTGAGGAGGAGG - Intronic
1013414436 6:109912364-109912386 CTGGGGGAAGGGGGAGAAAGGGG + Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013789998 6:113825778-113825800 CTGTGGCCAGAGTGAGGAGAAGG + Intergenic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1014041740 6:116835125-116835147 CTCTGAGTAGGCTGAGAAGAAGG - Intergenic
1014263055 6:119241865-119241887 CTGGGGGAAGGGAAAGATGAAGG + Intronic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1014691717 6:124570794-124570816 CTATTGGAACTGTGAGAAGAGGG + Intronic
1014883034 6:126746404-126746426 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1015389629 6:132666699-132666721 CTGTGGGAAGTGTGAAATAAAGG - Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015561182 6:134517723-134517745 CTGTGGGAGGGGTGAGGAAGAGG - Intergenic
1015585092 6:134768432-134768454 GTGTGGGAAAGATGAGATGATGG - Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1018083337 6:160277599-160277621 CTGAGGTCAGGGGGAGAAGATGG - Intronic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018450432 6:163902325-163902347 TTGTGGCAAGGGTGAGTAGGTGG - Intergenic
1018484895 6:164231040-164231062 CCATGGGAAGGATGTGAAGACGG + Intergenic
1018528826 6:164742114-164742136 AGGTGGGAAGAGTGAGAAGATGG - Intergenic
1018528879 6:164742283-164742305 AGGTGGGAGGGGTGAGAAGGTGG - Intergenic
1018528913 6:164742384-164742406 AGGTGGGAGGGGTGAGAAGGTGG - Intergenic
1019648722 7:2144721-2144743 CTGTGTGAAGCGTGAGCAGAGGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020406985 7:7847602-7847624 CTGTGGGAAGTGTTATAAGGGGG - Intronic
1020407104 7:7849257-7849279 CTGTGGGAAGTGTTATAAGGAGG - Intronic
1020446672 7:8276139-8276161 CACTGGGAAGGGTGAGAGGGTGG - Intergenic
1020467396 7:8496266-8496288 GTGTGTGAAGGGTGAGCACAAGG + Intronic
1020572489 7:9883444-9883466 CTATGGGGAGGGTAAGCAGAAGG - Intergenic
1020605104 7:10327240-10327262 CTGTGGCAAGGGGGTGAAGGTGG - Intergenic
1022016885 7:26357837-26357859 CTGTGGGAAGGGTATGGACATGG + Intronic
1022280928 7:28908417-28908439 CTGAGGGAAGGGGGTGAGGAGGG + Intergenic
1022466918 7:30658170-30658192 GTGTGGGCAGGGTGACCAGAAGG - Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024080906 7:45854085-45854107 CTGTCGGGAAGGGGAGAAGAGGG + Intergenic
1024121136 7:46241979-46242001 GAGTGGGGAGGGTGAGAGGAAGG - Intergenic
1024317784 7:48036976-48036998 CTGTAGGAGGGTAGAGAAGAGGG + Intronic
1024527150 7:50358408-50358430 CTGTGGGACGGGGCAGGAGAGGG + Intronic
1024579146 7:50787878-50787900 GTGTGGCCAGGGTGAAAAGATGG + Intronic
1025123599 7:56327754-56327776 CTGTCGGGAAGGGGAGAAGAGGG - Intergenic
1025762749 7:64409850-64409872 CTGAGGGATGGGTGACAGGAGGG + Intergenic
1026233619 7:68507297-68507319 CTGTTGGAAAGGTCAGAAAAAGG + Intergenic
1027184587 7:75963314-75963336 CTGTGGGAACGGCGAGGACATGG + Intronic
1027781284 7:82523569-82523591 CTGTGGGAAGATTGAGAGGGTGG + Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028900804 7:96098625-96098647 CTTTGGTAAAGGTGAGAAGGAGG - Intronic
1029025997 7:97417597-97417619 ATTTGAAAAGGGTGAGAAGAGGG - Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030960295 7:115912062-115912084 CTTTGGGAAGAGTGAAAAGATGG - Intergenic
1031256990 7:119465557-119465579 CTGGTGGAAGGGTGTGAAAAAGG - Intergenic
1031489237 7:122367517-122367539 CTGGGGGAAGGTTTAGAATATGG - Intronic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031989285 7:128186455-128186477 TTGAGGGAAGGAAGAGAAGAAGG - Intergenic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032444921 7:131974080-131974102 ATGTTGGAAGACTGAGAAGAGGG - Intergenic
1032796438 7:135280867-135280889 CTGTGGGAAGTGTTAGAATATGG - Intergenic
1032881078 7:136091190-136091212 CTTTGGGAAGAGTGATTAGATGG + Intergenic
1032999126 7:137483593-137483615 CTGTTGTAAGGGTGGGAAGAAGG - Intronic
1033423922 7:141226219-141226241 TTGGGGGGAGGGTGTGAAGAAGG + Intronic
1033598259 7:142871440-142871462 CTGTCGGAAGGGTGATGAGCAGG + Exonic
1033970958 7:147038982-147039004 TTGTTGGAAGAGTGTGAAGAAGG - Intronic
1034350392 7:150411348-150411370 CTCTGGGCAGGGTGAGAGGTCGG + Intronic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034943188 7:155245163-155245185 CCCTGGGATGGGTGAGAGGAGGG - Intergenic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035242167 7:157539376-157539398 CTGTGGGAAGGGCGGGATGGAGG + Exonic
1035520815 8:273922-273944 CTGGGTGAGGGGTGAGAAGTGGG + Intergenic
1035734919 8:1881132-1881154 CTGTGGGAAGTGGGAAAGGAAGG + Intronic
1036373538 8:8181050-8181072 GTGTGGTAAGGGTGAGAAACAGG - Intergenic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1038996626 8:32930277-32930299 AGTTGGGAAGGGTAAGAAGAGGG - Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039403723 8:37294935-37294957 GTGTGGCAAGGGTGTGAGGATGG - Intergenic
1039415105 8:37386666-37386688 CTTTGGGAAAGGTGGGAAGCTGG - Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1040391001 8:46950488-46950510 TAATGGGAAGGGTGAGATGAAGG + Intergenic
1040721573 8:50330493-50330515 CAGTTTGGAGGGTGAGAAGAAGG - Intronic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042472646 8:69208915-69208937 CTCTGGGAAGGCTGAGGAGAAGG - Intergenic
1042643763 8:70963100-70963122 CTGGGGGAAGGGGGAGCATAAGG - Intergenic
1042823056 8:72952754-72952776 CTGAGGGAAGAGGGTGAAGAGGG - Intergenic
1043028926 8:75106645-75106667 CTGGGGGAAGGCTGTGGAGATGG + Intergenic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043154007 8:76754838-76754860 CACTGGGAAGGGTAAGAGGAAGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044997974 8:97855304-97855326 CTATGGGAAGGGTGTGATGTTGG + Intergenic
1045299070 8:100895185-100895207 ATGTGAGAACAGTGAGAAGATGG + Intergenic
1045519549 8:102891926-102891948 CTGTGGGAAGAGTGTGTATAAGG + Intronic
1046564231 8:115878294-115878316 CTGGAGGAAGGGGGATAAGAGGG - Intergenic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1047210964 8:122839974-122839996 CTGCCTGAAGGGTGAGAAAATGG + Intronic
1047268182 8:123328728-123328750 CTGTGAGAAGGTGGAGAAGTGGG + Intronic
1047275828 8:123404182-123404204 TGATGGGAAGGGTGACAAGATGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047551061 8:125872683-125872705 CTGTGGGAAGTGTAAGATAAGGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048277830 8:133080588-133080610 CTGTGGGAAAGGGATGAAGATGG - Intronic
1048282014 8:133112592-133112614 GTGAGGGAAGGGAGAGAAAAGGG + Intronic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1049298661 8:141857183-141857205 CTGGATGATGGGTGAGAAGATGG + Intergenic
1050368982 9:4901679-4901701 CTGGGGGAAGGGGGAGCAGTGGG - Intergenic
1051302743 9:15670636-15670658 CTATGGAAAGGATGGGAAGAGGG - Intronic
1051926627 9:22335393-22335415 CTGTGCAAAGGTTCAGAAGAAGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1054943832 9:70773107-70773129 ATGAGAGAAGGGAGAGAAGATGG + Intronic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055075564 9:72211808-72211830 CTGGGGGCAGTGGGAGAAGAGGG + Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1056608925 9:88112552-88112574 ATGCGGGAAGGGTAAAAAGAGGG - Intergenic
1057138201 9:92710007-92710029 CAGAGGGAAGGCTGAGCAGAAGG + Intergenic
1057139270 9:92716925-92716947 ATCTGGGGAGGGTGAGGAGAGGG - Intronic
1057565084 9:96160213-96160235 GGGAGGGAAGGGAGAGAAGAAGG + Intergenic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1059009146 9:110437784-110437806 TTGAGGGAAGGGTGAGAAGTGGG - Intronic
1059658411 9:116377553-116377575 CTGTGGGAAGAGGGAGAGAAAGG - Intronic
1060763066 9:126272452-126272474 ATGTTGGAAGGATGGGAAGAGGG - Intergenic
1060831758 9:126722089-126722111 CAGGAGGAAGGGTGAGCAGAGGG - Intergenic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061550465 9:131331556-131331578 CTGTGGGCAGGATTTGAAGAGGG + Intergenic
1061763280 9:132865234-132865256 CTGACAGAAGGGTGAGCAGATGG + Intronic
1062264271 9:135679692-135679714 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264315 9:135679815-135679837 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264329 9:135679850-135679872 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062269776 9:135703113-135703135 CTGAGGGATGGGGGAGAGGATGG - Intronic
1062518925 9:136949687-136949709 CTGTGGGGAGGCCGAGATGAAGG + Intronic
1062540684 9:137040437-137040459 CTGTGGGAAGGAGGAGGCGAGGG + Intronic
1185478876 X:431267-431289 CTGTCGCCAGGGTGAGAAGGTGG + Intergenic
1185726625 X:2426878-2426900 AGGAGGGAAGGGTTAGAAGATGG - Intronic
1186147293 X:6637629-6637651 CTAGGGGAAGGGTGGGATGAAGG - Intergenic
1186313946 X:8348940-8348962 CATAGGGAAGGGTGAGAAGTTGG - Intergenic
1186355502 X:8785010-8785032 AGGGGGGAAGGGTGAGAAGGGGG + Intergenic
1186560245 X:10603918-10603940 CTGTGGCAAGGGTGATGATAAGG + Intronic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1187431844 X:19232235-19232257 GTGAGGGCACGGTGAGAAGACGG + Intergenic
1187548287 X:20275111-20275133 ATGTGGGAGGTGCGAGAAGAAGG - Intergenic
1187974362 X:24690607-24690629 CTCTGGGAAAGGTGAGAAGGAGG - Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189317223 X:40064600-40064622 CTGGGGGAGGGGAGACAAGAGGG + Intronic
1189733455 X:44045878-44045900 CGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1192332372 X:70186583-70186605 CTGTGGAAAGAGCCAGAAGATGG - Intronic
1192961595 X:76137251-76137273 CTGTGGGAAGGAATAGAAAAAGG - Intergenic
1193117015 X:77785569-77785591 GCGGGGGGAGGGTGAGAAGAGGG - Intronic
1193197388 X:78649231-78649253 CAGGGGGAAGGGTGAGAGGGTGG + Intergenic
1193971856 X:88065122-88065144 TTGTAGGAAGGGAAAGAAGAGGG - Intergenic
1193976450 X:88125447-88125469 CTGTGGGGAGGGTGTGGAGCTGG + Intergenic
1195067478 X:101250619-101250641 TTGCAGGAAGGGTGGGAAGAAGG + Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195908080 X:109864930-109864952 TTCTGGGAAGGGCCAGAAGAAGG + Intergenic
1196194738 X:112827845-112827867 ATGTGGGAGGGTTTAGAAGAGGG - Intronic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198566961 X:137914854-137914876 ATGTGGGTAGGGTGAGGGGAGGG + Intergenic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1199093625 X:143716980-143717002 GTGTTGGAAGGGGGAGGAGAGGG - Intronic
1199095944 X:143738663-143738685 CTGTTGGAGGGGTGGCAAGAGGG + Intergenic
1199214709 X:145251180-145251202 GTGTTGGAAGGGGGAGGAGAGGG + Intronic
1199928458 X:152494251-152494273 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
1202116154 Y:21470354-21470376 CTGTGGCAAAGGTGACAAGGAGG - Intergenic