ID: 1139778852

View in Genome Browser
Species Human (GRCh38)
Location 16:69334470-69334492
Sequence CCATTACCAGAGAAGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139778845_1139778852 15 Left 1139778845 16:69334432-69334454 CCGTCAAATAGACGGGTTTATTA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1139778852 16:69334470-69334492 CCATTACCAGAGAAGGCCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 169
1139778842_1139778852 30 Left 1139778842 16:69334417-69334439 CCATGTCAGCAGACACCGTCAAA 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1139778852 16:69334470-69334492 CCATTACCAGAGAAGGCCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139778852 Original CRISPR CCATTACCAGAGAAGGCCCA GGG Intronic
902294848 1:15460113-15460135 CCATTTCCAGAGAAGGCAACTGG + Intronic
903340425 1:22650997-22651019 CCATTAGCGGTCAAGGCCCAGGG + Intergenic
905024322 1:34839475-34839497 CAGTTCCCAGAGAAGGCACATGG - Intronic
905078544 1:35296182-35296204 ACATTTCCTGAGAAGGCCCAGGG - Intronic
905447854 1:38038914-38038936 CCAGCTCCAGGGAAGGCCCAAGG + Intergenic
906021283 1:42631752-42631774 CCATTACCATCACAGGCCCATGG + Intronic
906940137 1:50248709-50248731 TCCTTTCCTGAGAAGGCCCATGG - Intergenic
907297841 1:53466867-53466889 CTATTACCAGGGGAGGGCCAGGG + Exonic
907782952 1:57583843-57583865 GCATTTCCAGAGAAGAACCAAGG - Intronic
908648702 1:66308466-66308488 CCAATTCCATAGAAGGCCCCTGG + Intronic
910841365 1:91565232-91565254 GCATTTCCATGGAAGGCCCAGGG - Intergenic
912232990 1:107817298-107817320 CCATTATCAGAGAAGGGCATTGG + Intronic
913410224 1:118542751-118542773 TCATCACCAGAGAGGGCCCCTGG + Intergenic
914824526 1:151131948-151131970 CCATTACCCGGGAGAGCCCAGGG + Exonic
917437003 1:175031955-175031977 CCAACACCAAAGAAGCCCCAGGG - Intergenic
918218086 1:182410459-182410481 CCATAACAAGAGTAGGTCCAAGG + Intergenic
918478930 1:184956275-184956297 CCAGCACCTTAGAAGGCCCAAGG - Intronic
918502805 1:185217260-185217282 CCAATACCAGTCATGGCCCAGGG - Intronic
923556536 1:235005051-235005073 CAATTACCAAAGCAGGACCATGG - Intergenic
1065111557 10:22444970-22444992 CCATCACTAGAGTAGGCACAGGG + Intronic
1065845541 10:29739714-29739736 CCATAGCCAGAGATGGGCCACGG - Intergenic
1066134230 10:32427130-32427152 CCCTTCACAAAGAAGGCCCAAGG + Intergenic
1066961225 10:42230231-42230253 CCAAGGCCAGAGAAGGACCACGG + Intergenic
1067569135 10:47359010-47359032 CCCTTTCCAGATCAGGCCCAGGG - Intergenic
1067812948 10:49444523-49444545 GCATTACGAAAGAAGGACCAAGG + Intergenic
1068661064 10:59623864-59623886 CCATAGCCAGAGCAGCCCCAAGG + Intergenic
1069579490 10:69555734-69555756 TCATTCCCAGGGAAGGCTCATGG + Intergenic
1069727487 10:70590328-70590350 CCATAAGCAGAGCAGTCCCAAGG + Intergenic
1070346055 10:75543092-75543114 CAATTACCAGGGAAGGACCTTGG - Intronic
1070571162 10:77639934-77639956 CCAGTACCAGAAAAGGCCCAGGG - Intergenic
1070576002 10:77679489-77679511 CCATTGGCAGAGCAGCCCCAAGG - Intergenic
1070827975 10:79402120-79402142 CCTTTACCAGAGGAGGCAGAAGG + Intronic
1073295925 10:102438666-102438688 CCACTTCCAGAGAATGCCCCAGG + Intergenic
1074632825 10:115277538-115277560 CCATTACATGAGAAGGCCTGAGG + Intronic
1075153720 10:119956957-119956979 CCTTTACCAGTGATGGCCCAGGG + Intergenic
1077704690 11:4473298-4473320 CCATTTCCAGAGAAGAAACAGGG + Intergenic
1081712300 11:45225115-45225137 CCAGTACCAGAGAAAGGCAACGG - Intronic
1084219791 11:67670908-67670930 CCGCTACCAGAGAAGGGCCCAGG - Intronic
1084948606 11:72652435-72652457 CCATTTCCAGATATGGCCCCTGG + Intronic
1085323159 11:75587186-75587208 CCAGTACCAGCAAAGGACCAAGG - Exonic
1089312947 11:117572080-117572102 CCATAAACAGAGCAGCCCCAAGG - Intronic
1090023882 11:123151166-123151188 CCACTACCAGGGCAGGGCCATGG + Intronic
1091182787 11:133621856-133621878 CCATTAGCAGCGAGAGCCCATGG - Intergenic
1093089068 12:14901415-14901437 ATATTAGCTGAGAAGGCCCATGG - Intronic
1096531730 12:52246820-52246842 CTATGACAACAGAAGGCCCAGGG - Intronic
1096699321 12:53371681-53371703 CCATTCCCAGAAAAGGAGCATGG - Intergenic
1097137565 12:56871497-56871519 GCACTGCCAGAGGAGGCCCATGG - Intergenic
1100025634 12:90124412-90124434 CCTTTATCAGCCAAGGCCCAGGG - Intergenic
1102580166 12:113881376-113881398 CCGTAGCCAGAGGAGGCCCACGG + Intronic
1102970825 12:117164826-117164848 ATATTTCCAGAGAAGGGCCAGGG + Intronic
1108255080 13:48602065-48602087 ACATCACCAGAGGAGGCCTAGGG - Intergenic
1108256640 13:48617780-48617802 CAATTATCAGAGAAGCCCCTGGG - Intergenic
1111313743 13:86523551-86523573 ACATTACCTGAGAAGGCCCCAGG - Intergenic
1114668551 14:24396733-24396755 CCATCAGCAGAGAGGCCCCATGG + Intergenic
1117666145 14:58058393-58058415 CCATAGGCAGAGCAGGCCCAAGG + Intronic
1119125250 14:72119394-72119416 CCACTAGCACAAAAGGCCCATGG - Intronic
1124382201 15:29176565-29176587 CCTTTGCCAGAGAAGCCCCCAGG + Intronic
1124412844 15:29451233-29451255 CCATCATCAGCGAAGGACCAGGG - Intronic
1130156539 15:81355237-81355259 CCATTCCCAGGGAAGGGCAATGG - Intronic
1130717918 15:86354442-86354464 CCATTGTCAGAAAAGGACCAGGG + Intronic
1133942956 16:10325699-10325721 CCATAAGCAGAGCAGCCCCAAGG + Intergenic
1139778852 16:69334470-69334492 CCATTACCAGAGAAGGCCCAGGG + Intronic
1143449811 17:7029323-7029345 CCATAATCAGATAAGCCCCAGGG - Exonic
1144323925 17:14159029-14159051 CTATTAAAAGACAAGGCCCAAGG - Intronic
1147256617 17:39185647-39185669 CCAACACCAGAGCAGGCCCCTGG + Intronic
1147606000 17:41774018-41774040 CCCTTAGCTGAGAAGCCCCAGGG - Intronic
1154176202 18:12088266-12088288 CCAATACCAGGGCAGGGCCAGGG - Intergenic
1155069281 18:22299204-22299226 CCATCCACAGAGAAGACCCAGGG + Intergenic
1155850660 18:30769883-30769905 CCATAGACAGAGAAGCCCCAAGG - Intergenic
1157282320 18:46354158-46354180 CTATGTCCAGCGAAGGCCCAGGG + Intronic
1157630662 18:49092262-49092284 TGAGTACAAGAGAAGGCCCAAGG - Intronic
1157806484 18:50661718-50661740 CCATCTCCAGATAAGGACCACGG + Intronic
1157874557 18:51260304-51260326 CCATGGCCAGAGAAAGCCCTTGG + Intergenic
1158940082 18:62399716-62399738 CTAATACCAGAGCATGCCCAGGG - Intergenic
1159328781 18:66960413-66960435 CCATTACCAGAAAACGACCAAGG - Intergenic
1159477723 18:68944534-68944556 CCCTTATCAAAGAGGGCCCAGGG - Intronic
1164679230 19:30122785-30122807 CCCTTAACAGATAATGCCCAGGG - Intergenic
1166639944 19:44487664-44487686 CCATAAGCAGAGCAGCCCCAGGG - Intronic
1167829928 19:52011269-52011291 CCATGAGCAGAGGATGCCCAAGG + Intergenic
926140686 2:10366097-10366119 CCACCACCAGACAGGGCCCAGGG - Intronic
927470542 2:23372589-23372611 CCTGTAGCTGAGAAGGCCCAAGG + Intergenic
928834230 2:35523378-35523400 GCATGCCCAGAGAAGGCCCTGGG + Intergenic
929453470 2:42051161-42051183 CCATGACCAGAGAAAGCCCTGGG - Intronic
933427614 2:82132477-82132499 CCATCAACAGAGAAGACTCAAGG - Intergenic
935415107 2:102807037-102807059 TCATTAACAGAGAATGACCATGG - Intronic
936857623 2:116979666-116979688 TCATTCCCAGTGAAAGCCCAGGG + Intergenic
943319837 2:186433100-186433122 CCAATTCCAGAAAATGCCCAAGG + Intergenic
948810190 2:240471060-240471082 CTATTGCCAGAGATGGGCCAGGG + Intergenic
949058845 2:241944980-241945002 CCATGGCCAGGGAAGGACCAAGG + Intergenic
1169651139 20:7868783-7868805 GCATTTCCAGAGAAGGCAGAGGG - Intergenic
1170097401 20:12662006-12662028 CAATTTCCAGGGAAGGCCAAGGG - Intergenic
1173906486 20:46633479-46633501 CCATCCTCAGAGAATGCCCAGGG + Intronic
1175605093 20:60306252-60306274 CCATTACCAGATAAGGTGGAGGG + Intergenic
1175825438 20:61934160-61934182 CCAGTACCCGATCAGGCCCATGG + Exonic
1176858374 21:13987661-13987683 CCATGCCCAGAGCAGGGCCAAGG - Intergenic
1180724968 22:17940048-17940070 AGATCACCAGAGAAGGCCCCTGG + Intronic
1181267861 22:21641735-21641757 CCAGTATCAGAGAGGGCCTAGGG + Intergenic
1182160119 22:28113094-28113116 CCATTACCAGCAAAGACCAAGGG + Intronic
1184310493 22:43638113-43638135 CCATTCCCAGAAGAGGCTCAGGG + Intronic
1184358247 22:43996758-43996780 CCGTTGTCAGAGGAGGCCCACGG + Intronic
951494868 3:23315227-23315249 CCATTACCAACACAGGCCCACGG + Intronic
951622563 3:24621356-24621378 CCATTGGCAGAGAAGGCCAGGGG - Intergenic
951793357 3:26510923-26510945 CCACTGCCAGAAAAAGCCCAGGG + Intergenic
953580138 3:44146207-44146229 TCGGTACCAGAGAAGGTCCATGG + Intergenic
954858395 3:53666365-53666387 CCATTCCCTGAGAACGCACATGG - Exonic
956353380 3:68363563-68363585 CCCTATCCAGAGAAAGCCCAAGG + Intronic
956752624 3:72355459-72355481 CCATTACCAGAGAGTGAGCAAGG + Intergenic
960555150 3:119019971-119019993 CCATTATAAAAGAAGCCCCAGGG + Intronic
961133732 3:124491526-124491548 CCATTCCCAAAAGAGGCCCATGG - Intronic
964212197 3:154240936-154240958 CCATTACCTAAGAAGGCTTATGG - Intronic
968343067 3:197974927-197974949 CCATAGGCAGAGCAGGCCCAAGG + Intronic
969713896 4:8859396-8859418 CCAATCCCAGAAAAGGCCCGCGG + Intronic
973708053 4:53599490-53599512 CCATAGACAGAGCAGGCCCAAGG - Intronic
973942845 4:55927681-55927703 CCATAGGCAGAGCAGGCCCAAGG - Intergenic
974436254 4:61861134-61861156 GGATTACCAGGGAAGGACCAGGG + Intronic
975313090 4:72925264-72925286 CCAGCACCAGTTAAGGCCCATGG + Intergenic
976208968 4:82648314-82648336 GCATCAACAGAGAAGTCCCAAGG + Intronic
978223514 4:106305971-106305993 CCATAGCCAGAGTAGCCCCAAGG - Intronic
978703920 4:111682027-111682049 CCATAAGCAGAGCAGCCCCAAGG - Intergenic
981824613 4:148926038-148926060 CCGTTGCCAGTGAAGGCCAAAGG - Intergenic
984675751 4:182545593-182545615 CCAAAACAGGAGAAGGCCCAAGG - Intronic
986370601 5:7076963-7076985 CCATTACCAGTGCAGGAACAGGG + Intergenic
986723701 5:10578564-10578586 CCTTGATCAGAGAGGGCCCATGG + Intronic
988693910 5:33599579-33599601 CCATTAACAGTGAAGGGTCAGGG - Intronic
991456370 5:66808624-66808646 CCATTGCCAGATCAGGGCCAGGG + Intronic
996968330 5:129331827-129331849 CCACCACCAGCAAAGGCCCATGG - Intergenic
997026414 5:130067621-130067643 CCACTCCTAGAGAAGGTCCAGGG + Intronic
999612968 5:153390724-153390746 CCAAGACCTGAGAAGGCCCTAGG - Intergenic
1001698941 5:173692646-173692668 TCATTTCCAGAGAGGGCTCAAGG - Intergenic
1001971523 5:175958680-175958702 CCATTACAAGCAAAGGCACATGG + Intronic
1002245919 5:177885096-177885118 CCATTACAAGCAAAGGCACATGG - Intergenic
1002436883 5:179236952-179236974 CCCTTATCAAAGAAGCCCCATGG + Intronic
1002890889 6:1330727-1330749 CCATTGGCTGAGAAGGCCCCAGG + Intergenic
1003675701 6:8202429-8202451 CCCTTTCCAGAGTAGTCCCAGGG - Intergenic
1005119123 6:22370944-22370966 CCATTCCCAGAAGAGGCCTAGGG - Intergenic
1008972650 6:57387623-57387645 CCAGTCACAGAGCAGGCCCAAGG + Intronic
1011229405 6:85143182-85143204 CCATCACCAGAGAGGGCCCTGGG - Intergenic
1011316080 6:86032804-86032826 ACATTACCATAGAATGCTCAGGG - Intergenic
1011929422 6:92691574-92691596 CCATTGGCAGAGAAGCCCCAAGG - Intergenic
1012024713 6:93973812-93973834 CCATTACCAGAGGAGTGCCTTGG - Intergenic
1013473731 6:110488440-110488462 CCATTGGCAGAGCAGCCCCAAGG - Intergenic
1013864648 6:114680382-114680404 CCATTTCCAGATAAGATCCATGG - Intergenic
1016323324 6:142872034-142872056 CCATTACCCGAGAAAACCCCAGG + Intronic
1016515061 6:144884091-144884113 CCATGTGCAGAGATGGCCCAAGG + Intergenic
1018792717 6:167161786-167161808 CCATAGGCAGAGCAGGCCCAAGG + Intronic
1022879372 7:34570040-34570062 CCATAAGCAGAGCAGCCCCAAGG + Intergenic
1023141802 7:37109524-37109546 CCCTCCCCAGATAAGGCCCAGGG + Intronic
1024656281 7:51453809-51453831 CCATTACCAGAGCTTGCACAGGG + Intergenic
1026166490 7:67914664-67914686 CCATAAACAGAGCAGCCCCAAGG - Intergenic
1026416312 7:70184385-70184407 CCATTTCCAGAGAAGGTGGAGGG - Intronic
1029233763 7:99094951-99094973 CCACTATCACAGGAGGCCCAGGG + Intronic
1030097712 7:105915624-105915646 CCATAATCAGAGAAGGACCCTGG - Intronic
1030470007 7:109951897-109951919 CCATAAACAGAGCAGCCCCAAGG - Intergenic
1030578409 7:111319811-111319833 CCATTTCCAGGTAATGCCCAAGG + Intronic
1032780303 7:135160420-135160442 CAAAAACCAGGGAAGGCCCATGG + Intronic
1034276139 7:149824657-149824679 CCATTACCAGGGCAGGCTCCAGG - Intergenic
1035729979 8:1847070-1847092 ACATTTCTAGAGAAGGCACAGGG - Intronic
1037961552 8:23102151-23102173 CCATGGACAGAGGAGGCCCAGGG - Intronic
1038125841 8:24671837-24671859 CCATAAGCAGAGCAGCCCCAAGG - Intergenic
1038228055 8:25674808-25674830 CCAATATCAGAGAGGGCTCATGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1044517533 8:93156632-93156654 ACATGCCCAGAGAAGGCCCTGGG - Intronic
1044736571 8:95285133-95285155 CCCTCACAAGAGAAGGGCCAAGG - Intergenic
1046313016 8:112463796-112463818 CCTTTTCTAGAGAAGACCCAGGG + Intronic
1047832917 8:128655838-128655860 CCTTTAACAGAGCAGACCCAAGG - Intergenic
1059455389 9:114397321-114397343 CCAATTCCAGAGAAGGCGCCTGG + Intergenic
1185673467 X:1830018-1830040 GCATTCCCAGTGAAGGGCCAAGG - Intergenic
1186008664 X:5104570-5104592 TCATGCCCAGAGAAGGCTCAGGG + Intergenic
1187039742 X:15580963-15580985 CCATTACCATACAACGCCAATGG + Intronic
1187096782 X:16157226-16157248 CCATTACATTAAAAGGCCCATGG + Intergenic
1187623623 X:21086206-21086228 CCATCACCACAACAGGCCCATGG - Intergenic
1187666523 X:21617293-21617315 CCCTTGCCAGAGAAGGCCGAAGG + Intronic
1189255120 X:39632016-39632038 CAATGACCAGAGAAGGCCCCAGG + Intergenic
1190167168 X:48082843-48082865 TAATTCCCAGAGAAGCCCCAGGG - Intergenic
1190920270 X:54844950-54844972 CCATAAACAGAGAAGCCCCGAGG + Intergenic
1190947646 X:55111277-55111299 CCATAAACAGAGCAGCCCCAAGG - Intronic
1191640833 X:63428723-63428745 CCATAAGCAGAGAAGGCAAAAGG + Intergenic
1192539296 X:71954753-71954775 AGATTTCCAGAGAAGGCACATGG - Intergenic
1195883503 X:109617167-109617189 CCAATACCAGATAAGTCCAATGG - Intergenic
1198851664 X:140970686-140970708 CCATTCCCAGAGAAGGGTCAAGG + Intergenic
1199601802 X:149545443-149545465 CCAGCACCACAGCAGGCCCAAGG - Exonic