ID: 1139785011

View in Genome Browser
Species Human (GRCh38)
Location 16:69385746-69385768
Sequence CCGGCGGGGGCGCCACGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139785011_1139785018 -5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1139785011 16:69385746-69385768 CCGGCTCGTGGCGCCCCCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1139785018 16:69385764-69385786 GCCGGGCCCGCCCGCTACTGCGG 0: 1
1: 0
2: 0
3: 9
4: 86
1139785011_1139785020 -4 Complete closest: 406
total_pairs: 2
max_distance: 1000
Left 1139785011 16:69385746-69385768 CCGGCTCGTGGCGCCCCCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1139785020 16:69385765-69385787 CCGGGCCCGCCCGCTACTGCGGG 0: 1
1: 0
2: 1
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139785011 Original CRISPR CCGGCGGGGGCGCCACGAGC CGG (reversed) Exonic
900299759 1:1970672-1970694 CCAGCGCCGGCGCCAGGAGCTGG - Exonic
900506664 1:3032740-3032762 CAGGCTGGGGCCCCACGAGCAGG + Intergenic
901061171 1:6472592-6472614 CCGGCGGCAGTGCCACCAGCAGG - Exonic
905862568 1:41361282-41361304 GCGGCGGGGTCGCCCCGAGCTGG + Intergenic
905912072 1:41662096-41662118 GCGGCGGGGGCGCGGCGCGCGGG + Intronic
906518933 1:46456110-46456132 TCGGCGCCGGCGCCACGAGCTGG - Intergenic
908131847 1:61082378-61082400 CCCGCGGCGGCGGCGCGAGCGGG + Intronic
908703873 1:66930192-66930214 CCAGCCGGGGCGCCGCGAGGGGG + Intronic
909914752 1:81303101-81303123 CAGGAGAGAGCGCCACGAGCCGG - Intergenic
910678973 1:89843476-89843498 GCGGCGGGGTCGCCACGGCCAGG + Intronic
912381448 1:109250005-109250027 GCGGCGGGGCCGGCAGGAGCCGG + Exonic
919103543 1:193122158-193122180 GCAGCGGCGGCGCCCCGAGCCGG + Exonic
920331535 1:205211628-205211650 CAGGCGGGGGCGTCAGGAGGCGG - Intergenic
922250642 1:223846006-223846028 CCGCCGGGCGCGCCGCGGGCGGG - Intergenic
1062874091 10:931490-931512 CCGGCGGCCGCGCCACACGCGGG + Exonic
1063130295 10:3172460-3172482 CCGCCGGGAGCGCCGCGGGCAGG + Intronic
1066180467 10:32957547-32957569 CGGGCGGGGGCGGCGGGAGCCGG - Intronic
1067040521 10:42951090-42951112 CCGGACGGGGTGCCATGAGCAGG + Intergenic
1067227562 10:44385616-44385638 CCGGCGGCTGCGCCGCAAGCCGG - Intronic
1067686066 10:48466581-48466603 GCGGCGGGCGCGCAACAAGCGGG + Intronic
1072679834 10:97498781-97498803 GCGGCGCGGGCACCGCGAGCCGG + Intronic
1075885468 10:125896150-125896172 GGGGCGGGCGCGCCCCGAGCCGG - Intronic
1076052472 10:127346723-127346745 CCTGAGGGGGCGACACCAGCTGG - Intronic
1076374007 10:129971740-129971762 CCGGCGGGGGCGCGGCGCTCGGG - Intergenic
1077213313 11:1383357-1383379 CGGGCCGGGGCGCCAGGAGCGGG + Intergenic
1077214597 11:1390164-1390186 CCCGCGGGGGCGCCCCGGCCGGG + Intronic
1077419791 11:2444872-2444894 CCGGCGGGGGCGGGGCGTGCAGG + Intronic
1083894869 11:65614818-65614840 CCGGCCGTGGTGCCACGCGCCGG - Intronic
1084070079 11:66728184-66728206 CGGGCGGGGGCGCGGCGGGCGGG + Intronic
1084265613 11:68003870-68003892 CCGGCGGGGGCGGGGCGGGCCGG - Intronic
1085011081 11:73142158-73142180 GGGGCGGGGGCCCCAGGAGCAGG + Exonic
1088480968 11:110296352-110296374 CTGGCGGCGGCGCCACGGCCGGG + Intronic
1091718262 12:2795058-2795080 CGGGCGGGGGCGCTACCTGCGGG - Exonic
1091888070 12:4031257-4031279 CGGGCGGGGGCGCGGCGGGCGGG - Intergenic
1092365386 12:7872863-7872885 CCGGCGGGGGCGCAGCGGCCCGG - Intronic
1095559765 12:43551594-43551616 ACGGCGGGGGCGCAAGGGGCAGG - Intronic
1096983762 12:55743472-55743494 CCGGCTCGGGCGCCACGGACGGG - Exonic
1097246755 12:57611402-57611424 GCCGCGGGGCCGCCACGAGGCGG - Intronic
1098288467 12:68933071-68933093 ACGGCGGAGGCGCCAGGAGGAGG - Intronic
1100978112 12:100142901-100142923 CAGGCGGGGCCGGCACGAGGCGG + Intergenic
1104490787 12:129191013-129191035 CCGGAGGGGGCGTCTGGAGCCGG - Intronic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1108747333 13:53409009-53409031 CCGGCTGGAGGGCCACGGGCGGG - Intergenic
1112091669 13:96090364-96090386 CCGGCCGGGGCGGCGGGAGCGGG + Intergenic
1114485504 14:23059144-23059166 CCGGGGTGGGCGCCGCTAGCTGG - Exonic
1115474539 14:33800554-33800576 CCCGCGGGGACGCCGAGAGCGGG - Exonic
1116821711 14:49633877-49633899 CCGGCGGAGGCGCCACCTCCGGG + Exonic
1116961573 14:50973137-50973159 CTGGAGGGGGCACCAGGAGCAGG - Intergenic
1118849343 14:69572476-69572498 GCGGCGGGAGCGCGAGGAGCGGG - Exonic
1122130915 14:99604237-99604259 GCGGCGGGGGCTCCGGGAGCTGG - Intergenic
1122602936 14:102930283-102930305 GCAGCGGCGGCGCCACCAGCAGG - Exonic
1122905793 14:104800876-104800898 GCGTCGGGGACGCCGCGAGCGGG + Intronic
1122961147 14:105094048-105094070 CTGGAGGGTGCGCCAGGAGCCGG + Intergenic
1202872590 14_GL000225v1_random:177767-177789 GGGGCGGGCGCGCCCCGAGCCGG + Intergenic
1125534599 15:40436094-40436116 CGGGCGGGGGCGCGACGAGGGGG + Intergenic
1128280156 15:66387460-66387482 CCGGCTGGGGAGGCCCGAGCCGG + Intronic
1128335266 15:66781528-66781550 CCGCCGGGGCCGCCACTATCTGG - Exonic
1131517405 15:93088585-93088607 CCGTCCGGGGCTCCGCGAGCCGG + Intronic
1132498599 16:275122-275144 CGGGCGAGGGCGGGACGAGCCGG + Intronic
1132837129 16:1959765-1959787 CCGGCGAGGGAGCCCCGGGCTGG - Intronic
1134134234 16:11668826-11668848 CGGGCGGGGGCTGCACGGGCGGG - Intronic
1134644738 16:15857162-15857184 CCGGCGGGAGCGCAAGGAGCTGG + Intergenic
1134849871 16:17470899-17470921 GCGGCGGCGGCGGCCCGAGCGGG - Intergenic
1136568043 16:31081559-31081581 CCGGCTGGAGGGCCACGGGCGGG + Exonic
1138178781 16:54929023-54929045 CCGGCGAGGCCGCCACTGGCCGG + Intergenic
1139511654 16:67431392-67431414 CCGGCGGGGGCAGCAGGCGCTGG - Exonic
1139570103 16:67806459-67806481 CCGGCGGGGGCGCTGGGGGCGGG - Exonic
1139785011 16:69385746-69385768 CCGGCGGGGGCGCCACGAGCCGG - Exonic
1142344862 16:89547478-89547500 CAGGCGCCGGCGCCAGGAGCAGG - Intronic
1143023719 17:3929327-3929349 CAGGCAGGGGCGGCACGAGCAGG + Exonic
1143108166 17:4539683-4539705 CGGGTGGGGGCGCCAGGGGCTGG + Exonic
1147189465 17:38730313-38730335 CCGGCGGGGGCGGAGCCAGCGGG + Exonic
1147285686 17:39401407-39401429 CCGGCGGGTGCGGCCCGGGCCGG + Exonic
1148209317 17:45798749-45798771 CGGGCGGGGGCACCCTGAGCCGG + Intronic
1148561017 17:48606151-48606173 CCGGCGGCGGCGCAGAGAGCGGG + Intergenic
1148785221 17:50142936-50142958 CAGGCAGTGGCGCCATGAGCAGG - Intronic
1152069804 17:78128840-78128862 AGGGCGGGGGCGCCGCGGGCCGG - Intronic
1155928849 18:31685238-31685260 CCGGCGGGGGCGCCTCACCCCGG - Intronic
1157384300 18:47248322-47248344 GCGGCGGGGGCGCACCCAGCAGG + Intronic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1161364121 19:3868615-3868637 CTGATGGGGGCGCCACGAGGAGG - Intronic
1161412419 19:4123893-4123915 GCGGCGGCGGCGCCTCTAGCCGG + Exonic
1161543617 19:4867113-4867135 CAGTTGGGGGCGCCAGGAGCTGG + Intronic
1161802632 19:6424546-6424568 CCGGCGGCGGCGGCCCGGGCGGG - Exonic
1161959554 19:7516207-7516229 CCGGCGCGGGCGCGGCGGGCCGG + Exonic
1162019570 19:7862557-7862579 CCGGGGGCGGTGCCACGGGCAGG - Intronic
1162435375 19:10654783-10654805 CCGGCGGCGGCGCCACGCGCGGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162532369 19:11243335-11243357 CCGTCGGGGGCCCCAGGACCGGG - Exonic
1164952169 19:32345811-32345833 CCGGCGGCGGCGCTAACAGCGGG - Intronic
1165204565 19:34172629-34172651 GCGGCGGCGGCGCCATGAGCGGG + Exonic
1167293262 19:48635850-48635872 CCCGCGGGGGCGCCCGGGGCCGG - Exonic
1168153387 19:54460697-54460719 CAGGGGAGGGCCCCACGAGCGGG - Intronic
1168694478 19:58396791-58396813 CTGGAGCGAGCGCCACGAGCTGG - Exonic
926268002 2:11344128-11344150 CCAGCGGTGGCGGCATGAGCCGG - Exonic
926397015 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG + Intergenic
926397029 2:12453944-12453966 CCGGCGGGGGGGCCTCGGGGAGG + Intergenic
929218104 2:39437072-39437094 CCGCCGGGGGAGCCGGGAGCCGG - Exonic
929539584 2:42809989-42810011 CTGGCGGGGGCGCCCCGGCCGGG - Intergenic
932718376 2:74120197-74120219 CGGGCGGGGGAGCCGGGAGCCGG - Intergenic
934545047 2:95207540-95207562 CCGGCGGGGACGCCTAGCGCCGG - Exonic
945033521 2:205685687-205685709 CTGGCGGGGGCGCCCGGGGCAGG - Intronic
946322237 2:218960821-218960843 GCGGCGGGGGCCCACCGAGCGGG + Exonic
946430993 2:219627460-219627482 CCGGCGCGGCCCCCACGCGCGGG - Intronic
1170878861 20:20277251-20277273 CGGGCGGGGGCTGCACGAGGTGG - Exonic
1172517036 20:35542168-35542190 CCTGCGGGGGCGCCACCGGTAGG + Exonic
1173672921 20:44810437-44810459 CCGGCGGGCGGGCCAGGAGCTGG + Intergenic
1175953631 20:62596797-62596819 CCGGCGGCGGCTCCACCATCTGG - Intergenic
1177011047 21:15730333-15730355 CCGGCGGAGGCGCGAGGAGCCGG + Exonic
1179828522 21:43981803-43981825 CTGGCAGGGGCGGCAGGAGCAGG - Intronic
1180614906 22:17120696-17120718 TCGGCGGGGGCGCCGCGGCCGGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180949773 22:19715731-19715753 CGGGCAGGGGGGCCAGGAGCTGG + Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1183411742 22:37658965-37658987 CCGGCGCGCGCGGCCCGAGCTGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
953289763 3:41649517-41649539 CCGGAGGAGGTGCCAGGAGCAGG - Intronic
955318644 3:57959020-57959042 CCTGTGGGGGCGCCATGAGAAGG + Intergenic
961182407 3:124887124-124887146 CCAGCGCGGGCGCCGTGAGCCGG - Exonic
961574456 3:127823230-127823252 GCGGCGGGGGCGGCCCGAGGTGG + Intronic
967511896 3:190322329-190322351 CCAGCGGCGGCGCAGCGAGCAGG - Exonic
968505097 4:967845-967867 CCGGCCGGGGCGCCCTGGGCTGG - Intronic
968820066 4:2843697-2843719 CCGGCGGGGTCGCCCCGAGGCGG + Intergenic
972982836 4:44726433-44726455 GCGGCGGGGGCGCCAAGAAGGGG - Intronic
978822364 4:112980251-112980273 CCGGAGGGGGCGCCGAGAGTGGG + Intronic
983077493 4:163343908-163343930 CCGGCGGTGGCGGCAGCAGCGGG - Intronic
983792244 4:171813066-171813088 CCGGCGGGAGCGCGGCGAGCCGG - Intronic
984462884 4:180058723-180058745 CCGGCGGGGGCGCAACGGGTGGG - Intergenic
984928363 4:184826023-184826045 GTGGCGGGGGCGCAACCAGCGGG - Intronic
985727573 5:1524048-1524070 CCGGCAGGGGCGGCACCAGCCGG + Intergenic
985876980 5:2607289-2607311 CGGGCGGGGGCCGCTCGAGCTGG + Intergenic
992105734 5:73448061-73448083 CCGGCGGCGGGGGCAGGAGCCGG - Exonic
997899994 5:137754943-137754965 CGGTCTGGGGCGCCACGCGCGGG + Intergenic
1002091832 5:176810648-176810670 GCCCCGGGGGCGCCCCGAGCTGG + Exonic
1002784630 6:392056-392078 GCGACGGGGTCGCCACAAGCTGG + Intronic
1002784970 6:393386-393408 CCGGCGGGGGCGCGCCGGGGAGG + Intronic
1002898001 6:1390183-1390205 GCGGCGCGGGCGCCGGGAGCGGG + Exonic
1003175858 6:3751856-3751878 GCGGCGGGGGCGCGGCCAGCCGG - Exonic
1006014904 6:31072688-31072710 CCAGTGGGGGGGCCACGAGTGGG - Intergenic
1006472694 6:34237437-34237459 CAGGCCGGGGCGGCGCGAGCCGG + Intronic
1013836552 6:114342203-114342225 CCGGCGGTGGCGGCGCGGGCGGG + Exonic
1019536300 7:1531268-1531290 GCGGGGCGGGCGCCACGTGCGGG + Intronic
1020279279 7:6642284-6642306 CTGGCGGGGGCGCAGGGAGCAGG - Intronic
1021827944 7:24573369-24573391 GCGGCGGGGGCGACCGGAGCTGG + Exonic
1023810294 7:43906431-43906453 CGGGCGGGGGCGCCCCTGGCCGG + Intronic
1024520890 7:50303857-50303879 GCGGCGCGGGCGACACGTGCGGG - Intergenic
1028585511 7:92447702-92447724 CCCGCGGGGGCCGCCCGAGCCGG + Exonic
1028987712 7:97021263-97021285 TGGGCCGGGGCGCCCCGAGCCGG - Intronic
1029535407 7:101154751-101154773 GCGGCGGGGCCGTCCCGAGCCGG + Intronic
1030093425 7:105877026-105877048 CCAGCGGGGGCGCCTCGCGTTGG - Intronic
1032068799 7:128791513-128791535 CCGGCGCGGGAGCCGCGGGCTGG + Intronic
1033199914 7:139359844-139359866 CCCGCGGGGGCTCCACCAACTGG - Intronic
1033216721 7:139498800-139498822 CAGGCGGGAGCTCCACCAGCTGG + Intergenic
1034347652 7:150397210-150397232 GCCGCGGGGGCGCCCCGAGTGGG + Exonic
1037390515 8:18387248-18387270 GCGGCGGCGGCGCCGCCAGCGGG - Intergenic
1038278087 8:26138702-26138724 ACGGCTGAGGCCCCACGAGCAGG + Intergenic
1042155687 8:65841955-65841977 GCGGCGGCGGCGGCCCGAGCTGG - Intronic
1044229428 8:89757663-89757685 CAGGCGGGAGGGCCGCGAGCGGG + Intergenic
1049109708 8:140635398-140635420 CCGGCGCGGGCGGCAGGGGCCGG - Intronic
1049944586 9:581260-581282 CCAGAGGGGGCGCCGAGAGCAGG + Intronic
1051079628 9:13279400-13279422 CCTGGGCGGGCGCCGCGAGCCGG - Exonic
1053603132 9:39630964-39630986 CAGGCGGGGGCGCTACCTGCAGG - Intergenic
1053860775 9:42384723-42384745 CAGGCGGGGGCGCTACCTGCAGG - Intergenic
1054250407 9:62711461-62711483 CAGGCGGGGGCGCTACCTGCAGG + Intergenic
1054564514 9:66745989-66746011 CAGGCGGGGGCGCTACCTGCAGG + Intergenic
1059414346 9:114154115-114154137 CCGGCGCGGGCTCCGAGAGCTGG - Intergenic
1060849199 9:126860691-126860713 GCGGAGGGGGCGCCGCGGGCGGG + Intronic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1203731865 Un_GL000216v2:98775-98797 GGGGCGGGCGCGCCTCGAGCCGG - Intergenic
1203616589 Un_KI270749v1:72522-72544 GCGGCGGGGGCGCAAAAAGCCGG - Intergenic
1185629778 X:1507627-1507649 CCGGCGGAGTCCCCACGTGCCGG + Intronic
1186496546 X:10015887-10015909 CCGGCGCGGGCGCTACGACCCGG + Intronic
1195156063 X:102125738-102125760 GCGGCGGGGGAGCAGCGAGCGGG + Exonic
1195158053 X:102142399-102142421 GCGGCGGGGGAGCAGCGAGCGGG - Exonic
1200148870 X:153941845-153941867 CTGGCGGGGGCGCCTTGAGGAGG - Intronic