ID: 1139790690

View in Genome Browser
Species Human (GRCh38)
Location 16:69431924-69431946
Sequence TAATTTAATAAGAGTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139790690 Original CRISPR TAATTTAATAAGAGTGATCT GGG Intronic
902413009 1:16222723-16222745 TAATTTAAAAAGAGCGGGCTGGG - Intergenic
906356171 1:45107336-45107358 TACTTTAAAAATAGTGATTTAGG + Intronic
907068319 1:51509437-51509459 TAAAATAATGAGAGAGATCTTGG - Intronic
908858747 1:68459102-68459124 TAATTTAACAAGTCTGATTTAGG - Intergenic
910358675 1:86393111-86393133 TAATTTACTTAGTCTGATCTAGG - Intronic
910387696 1:86703432-86703454 TACTTTAAAAACAGTGCTCTGGG + Intergenic
911622109 1:100076675-100076697 TAAATTAATAAGCTTGATTTGGG - Intronic
911879633 1:103219758-103219780 TAATTTAATTAGTGTCATTTTGG - Intergenic
912114396 1:106387219-106387241 TATTATAAAAAAAGTGATCTAGG - Intergenic
915189362 1:154135719-154135741 TAATTTATTAAGAATGATTATGG - Intronic
917208207 1:172600755-172600777 TGCTTTAGTTAGAGTGATCTTGG + Intronic
917434646 1:175008167-175008189 TAATATAATAAGAGGGGTCGGGG - Intronic
918705185 1:187651744-187651766 TAATCTTATAAGAATTATCTGGG - Intergenic
918884371 1:190172200-190172222 TAAGTTAATATCAGTGATTTGGG + Intronic
918912086 1:190587840-190587862 TAATTTAAGTTGAGTGATTTGGG + Intergenic
920384442 1:205559155-205559177 TAGTTGAATAAGAGTGATGAGGG - Intergenic
921750464 1:218786609-218786631 TAATTTAAAATGAGAGATCCAGG - Intergenic
922241510 1:223758290-223758312 TACTTTAATAATCGTGACCTTGG - Intronic
923761056 1:236844528-236844550 TAAGCTAATGAGAATGATCTGGG + Intronic
1064658424 10:17580078-17580100 TGAGTTAATAAAAGTGGTCTGGG + Intergenic
1064861925 10:19835757-19835779 GAATTCAATAAGAGTGGTTTTGG + Intronic
1065431245 10:25659146-25659168 TAAATTAATAAGAGGAATTTTGG - Intergenic
1065663387 10:28030536-28030558 TAATCAAATTAGAGTAATCTGGG - Intergenic
1066007380 10:31158016-31158038 CAATGTAATAAGGGAGATCTGGG - Intergenic
1066277484 10:33882905-33882927 TAAATGAATAAGAGTGAAATGGG + Intergenic
1071058713 10:81543939-81543961 TAACCTAATAAGTGTGATGTTGG + Intergenic
1071720358 10:88137747-88137769 TAATTATATAAAAGTGCTCTGGG - Intergenic
1074836227 10:117297983-117298005 TAATTTAATAAAAGACAACTTGG + Intronic
1075529174 10:123212952-123212974 TAATTTAGGAAGATTGGTCTGGG + Intergenic
1076030621 10:127154768-127154790 AAAATTAATAATAATGATCTTGG + Intronic
1076324564 10:129611226-129611248 TAATTAACTCAGAGTTATCTGGG + Intronic
1078781878 11:14446735-14446757 TAATTTATTAACTGTGATCTTGG - Intronic
1079302654 11:19292308-19292330 TAAATAAATAAGTGTCATCTTGG - Intergenic
1080131791 11:28804220-28804242 TAATTATATAAAAGTTATCTAGG - Intergenic
1080761617 11:35255545-35255567 AAATTTCAAAAGAGTGATCAAGG + Exonic
1080793754 11:35544170-35544192 TAATGTAATAAAAGTTATGTGGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1085029668 11:73263312-73263334 TAATTTAAACTGAGAGATCTGGG - Intergenic
1086197568 11:84159354-84159376 TAATTTAATTACAGTGAACAGGG + Intronic
1086291374 11:85314294-85314316 TATTTTATTAGGAGTGAGCTTGG - Intronic
1087259260 11:95992708-95992730 TACTTTGATCAGAATGATCTGGG + Intronic
1087478501 11:98668516-98668538 TAATTCAATAAGGGCAATCTAGG - Intergenic
1088177049 11:107065555-107065577 TTATTTAATAAGAGTGATCATGG - Intergenic
1088559927 11:111103978-111104000 TGATTTAAAAAGAAAGATCTTGG - Intergenic
1089367115 11:117927670-117927692 TGATTAAATAGGAGTGGTCTGGG - Intronic
1089932235 11:122324780-122324802 TCATTCAATAAGGGTGTTCTTGG - Intergenic
1092688694 12:11082219-11082241 TTATTTAATAAATGTGATTTTGG + Intronic
1093967541 12:25343094-25343116 TAATTTAATAAGGTTGAATTAGG + Intergenic
1094278167 12:28703212-28703234 TAATTGATTTAGAGTGATTTTGG - Intergenic
1094478961 12:30864915-30864937 TTATTTAATAAGAGTGATATTGG + Intergenic
1096292679 12:50354443-50354465 CAATTTAATACAAATGATCTTGG - Exonic
1097135485 12:56850080-56850102 GAAAATAATAAGAGTCATCTAGG - Intergenic
1098717256 12:73845959-73845981 TGATGTAAAAAGAGTGATCAAGG + Intergenic
1099972606 12:89515510-89515532 TAATTTAGATAGAGTGATCAGGG + Intronic
1101714916 12:107302241-107302263 TAATTTAAATAGAGTGACCAGGG - Intergenic
1101923043 12:108948263-108948285 TGATTTATTGAGAGTGCTCTTGG - Intronic
1102609470 12:114098957-114098979 TACTTCAATAACTGTGATCTAGG - Intergenic
1109020083 13:57079431-57079453 TAATTTAATAATAAACATCTGGG - Intergenic
1109236339 13:59826031-59826053 CAAAATAATAAGAGTTATCTAGG + Intronic
1109274140 13:60285704-60285726 TGATTTAGTAAGACTGACCTGGG - Intergenic
1109909238 13:68888894-68888916 TAATTTAAAAAGAGTGACTGGGG + Intergenic
1111409084 13:87851045-87851067 TTATTTAATGAGGGTGACCTTGG + Intergenic
1111415732 13:87941255-87941277 GAATTTAATTAGAGTGTGCTGGG - Intergenic
1111675531 13:91383477-91383499 TAATTTAGGAACAATGATCTGGG + Intergenic
1112657831 13:101471349-101471371 TAATTTAATCATAGTGACATGGG - Intronic
1114752010 14:25215408-25215430 TAATTTAAATAGGGTGGTCTGGG + Intergenic
1114864206 14:26568091-26568113 TAAGATAATAAGAGAGATTTAGG + Intronic
1115293921 14:31804414-31804436 TGATTAAATAAGAATCATCTGGG - Intronic
1115982259 14:39066334-39066356 TAATTTAATAAGAATCAATTAGG + Intronic
1116548415 14:46201851-46201873 TAATTTAATAAGAGTAAAGAAGG + Intergenic
1116567943 14:46474786-46474808 TAGTTTAATATGAGTCATCACGG - Intergenic
1117288151 14:54307399-54307421 TAGTTTGATAAGAGAGTTCTAGG + Intergenic
1117669298 14:58090318-58090340 TAATTTAACAAGATTGATCATGG + Intronic
1117982570 14:61356608-61356630 TAATTTATTAAGTGTTGTCTTGG + Intronic
1118093151 14:62505150-62505172 TATTTTAATAAGAGTTTTCTGGG - Intergenic
1118814247 14:69298700-69298722 CAATTTAATAAGCCAGATCTGGG + Intronic
1120000127 14:79293465-79293487 TAATTTGAAAAGTGTGATTTGGG - Intronic
1120382539 14:83799264-83799286 TAATTTAATTAAAGTGATTATGG + Intergenic
1121692940 14:95890835-95890857 TAAATTAATCAGAGTATTCTTGG + Intergenic
1121881642 14:97506312-97506334 TAATTTAATACAAGTGATGAGGG - Intergenic
1123135545 14:106024646-106024668 TAAATTAATAAGAGGAATCTTGG - Intergenic
1124052555 15:26211220-26211242 TGATTTAATCAGAGTCAACTGGG - Intergenic
1125935403 15:43631187-43631209 TGATTTAATATGTGTTATCTGGG - Intronic
1125948181 15:43727666-43727688 CAATTTAATATGTGTTATCTGGG - Intergenic
1126895209 15:53250096-53250118 TAATTTAAGAAGAGCCAGCTGGG + Intergenic
1127050486 15:55078281-55078303 TAATGTAATAAAAGCCATCTAGG + Intergenic
1127225658 15:56925745-56925767 TCATTTAATAAGACTGCTTTTGG + Intronic
1128687265 15:69696033-69696055 TAATTTAATTAGAGTGGTCCAGG - Intergenic
1128905018 15:71459662-71459684 TATTTTAATATGAGGGTTCTGGG - Intronic
1130106359 15:80931667-80931689 TAATTAATTAATAATGATCTGGG + Intronic
1131427413 15:92357634-92357656 TTATTTAATAGGAGATATCTGGG - Intergenic
1135163721 16:20120404-20120426 TAATTTTGTAAGAGTGATAATGG - Intergenic
1135614154 16:23896307-23896329 TAATTCAATAAGAGGGAAATGGG - Intronic
1135853946 16:25989368-25989390 TCTATTAATATGAGTGATCTGGG + Intronic
1138174903 16:54888293-54888315 AAATACAATAAGAATGATCTTGG + Intergenic
1138398129 16:56723090-56723112 TAATTTAAAAAGGATGATCTTGG - Intronic
1138767457 16:59621868-59621890 TAATATAATAAGCTTGACCTTGG - Intergenic
1139668086 16:68472316-68472338 TAATTTAAAAAGTGGGATCATGG + Intergenic
1139790690 16:69431924-69431946 TAATTTAATAAGAGTGATCTGGG + Intronic
1140247399 16:73263770-73263792 TAATTTAATAATAGTGTAGTTGG - Intergenic
1141745297 16:85921405-85921427 TAATTTAATAAGGGCATTCTCGG + Exonic
1142798788 17:2330762-2330784 TAAATGAAAAAGTGTGATCTGGG - Intronic
1151611740 17:75180754-75180776 TAAGAAAATAAGAGTGAACTTGG - Intergenic
1153536899 18:6111368-6111390 TATTTTAATAAAAGTGACTTAGG + Intronic
1153560309 18:6365824-6365846 TTATTTAACAAGAGTGACTTAGG - Intronic
1153907175 18:9672386-9672408 TAAGTTAATAAGTGAGATTTTGG - Intergenic
1153987633 18:10367676-10367698 TAATTTTATAAATGTGCTCTGGG - Intergenic
1154264216 18:12865646-12865668 TAAAATAAAAAGAGTGAGCTGGG + Intronic
1154487159 18:14881225-14881247 TAATGTAATAAAAGCCATCTAGG - Intergenic
1154498774 18:14983173-14983195 TAATGTAATAAAAGCCATCTAGG + Intergenic
1159029558 18:63217320-63217342 TAATTTATTGAGAGTTATCCTGG + Intronic
1159226885 18:65550661-65550683 TAATTTACTATGAATAATCTGGG + Intergenic
1159733164 18:72057611-72057633 TAATGTAATAATAGAAATCTAGG + Intergenic
1160273172 18:77406427-77406449 TAATTTCAAAAGAGTGATAGTGG - Intergenic
1161369813 19:3904679-3904701 TATTTTAATCAGAGTGCTCCAGG - Intronic
1163730794 19:18948180-18948202 TAATTTAAAAAGGGTGCTTTAGG + Intergenic
1164267310 19:23632054-23632076 TAAATTAAAAAGAGTAAACTGGG - Intronic
926266349 2:11325467-11325489 TATTTTAAGCAGAGGGATCTAGG + Intronic
926816296 2:16801059-16801081 TAATTTAATGATAGTGAACTGGG - Intergenic
927611624 2:24547266-24547288 TAATTTAATAGAAGAGATTTTGG + Intronic
927966001 2:27268874-27268896 TGCTTTAAGAACAGTGATCTGGG + Intronic
928708771 2:33981070-33981092 GAATTTAAGAAGATTGATTTAGG - Intergenic
929446234 2:42003562-42003584 TTATTTAAGCAGAGTGGTCTGGG - Intergenic
929674531 2:43912479-43912501 TAATTTAATGAGATTGCTGTAGG + Exonic
930105690 2:47637606-47637628 TCATTTTAGAAAAGTGATCTGGG - Intergenic
930366093 2:50441348-50441370 TTATTTAAAAAGAAGGATCTGGG + Intronic
930385756 2:50692919-50692941 TAATTTAAAAAGAGCAATGTGGG + Intronic
930549448 2:52814021-52814043 CAAAATAATAAGAGCGATCTAGG - Intergenic
930749158 2:54915780-54915802 AAATTCAAAAAGAGAGATCTGGG + Intronic
932075417 2:68657852-68657874 CAATTTAATCAGAATGCTCTTGG + Intergenic
932747171 2:74343596-74343618 TAATCTAATCAGTGTGTTCTAGG + Intronic
933020127 2:77180138-77180160 TAATGTAAAAAGAGTTTTCTGGG + Intronic
933411611 2:81932676-81932698 TATTCTAATAAGAGTTATGTAGG - Intergenic
933489355 2:82965977-82965999 CAATTTAAAAAGTGTAATCTGGG - Intergenic
933563735 2:83923160-83923182 AAATAAAATAAGAGTGATCCAGG - Intergenic
935042447 2:99446316-99446338 TAAATAATTAAGAGTGATTTTGG - Intronic
935494186 2:103758196-103758218 TAATTTAATAATATTAATTTAGG - Intergenic
936954506 2:118011094-118011116 TTATTTAATAAGTGTGTCCTTGG - Intronic
937567883 2:123318177-123318199 TCATTTAATAAAAGTAATCTAGG - Intergenic
938497730 2:131811294-131811316 TAATGTAATAAAAGCCATCTAGG + Intergenic
939343342 2:140929342-140929364 AAAATTAATCAGAGTGTTCTGGG + Intronic
940237658 2:151528239-151528261 TAATTTAATTTGAGTGTCCTTGG + Intronic
940539791 2:154997856-154997878 TATTTTAAAAAGAGTGTGCTGGG + Intergenic
940723399 2:157306834-157306856 TAATTAAAAAAGAGTGGCCTTGG - Intronic
941483065 2:166042098-166042120 TATTTTAAAATGAGTGATATTGG - Intronic
941790526 2:169547593-169547615 TAATTTAAGAAGAGTTAGATAGG + Intronic
942242458 2:173975434-173975456 TAATTTAAAAAGAGTCAGCATGG - Intergenic
943517205 2:188903958-188903980 TCATTTAGTAGCAGTGATCTTGG - Intergenic
944139088 2:196435604-196435626 TAATTTAAAAACAGTAATGTGGG - Intronic
944489100 2:200238950-200238972 TAATTTTATAAGATTGTTATAGG + Intergenic
944504568 2:200397347-200397369 TAATTTAATACGAAGGATCATGG - Intronic
944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG + Intronic
945263933 2:207871476-207871498 TAATTTGATAGGAGTGATGGTGG - Intronic
1171769560 20:29311929-29311951 TAAATAAATAAAAATGATCTGGG + Intergenic
1171906993 20:30907434-30907456 TAAATAAATAAAAATGATCTGGG - Intergenic
1173264626 20:41468064-41468086 TGATTTAGAAAGAGTGGTCTAGG - Intronic
1174170187 20:48612724-48612746 TCATTTAATAAGAGTGGGATAGG - Intergenic
1176794123 21:13358088-13358110 TAATGTAATAAAAGCCATCTAGG + Intergenic
1176978780 21:15354895-15354917 TATTTTAATAAAAATGAACTAGG - Intergenic
1177280125 21:18971221-18971243 TAATTTTATAAGAGGCATGTTGG - Intergenic
1177698950 21:24611846-24611868 TAATTTATTAAGAATTATTTGGG - Intergenic
1178366524 21:31993049-31993071 AAGTTTAATAAGGGTGGTCTTGG + Intronic
1179018823 21:37618831-37618853 TAATTCAATAAGAGAGTCCTAGG - Exonic
1179197084 21:39174302-39174324 TAAGTAAGGAAGAGTGATCTTGG - Intergenic
1180340404 22:11613432-11613454 TAAATAAATAAAAATGATCTGGG - Intergenic
949823932 3:8144511-8144533 TATTCTAAACAGAGTGATCTAGG + Intergenic
950343226 3:12267131-12267153 TAACTCAATAATAGTGATCAAGG + Intergenic
951144668 3:19213256-19213278 TTTTTTAATAGGAGTGTTCTAGG + Intronic
952915094 3:38231809-38231831 TAATTTAAGAAGAGTAAGTTGGG + Intronic
954526639 3:51277744-51277766 TTAGTTACTAACAGTGATCTCGG - Exonic
956140834 3:66145318-66145340 CAAGTTATTCAGAGTGATCTAGG - Intronic
957193913 3:77042992-77043014 TAATTTAGTAAGAGTGTCCAGGG - Intronic
957625610 3:82649581-82649603 TAATTAAATCAGAGTTTTCTCGG - Intergenic
960040240 3:113143189-113143211 TAATTTAGTAAGGGAGATGTTGG - Intergenic
960436146 3:117629069-117629091 CCATTTAATAAGAGTAATTTAGG - Intergenic
961347038 3:126269967-126269989 TAATTTATTAAGAGTGAAAAGGG + Intergenic
962032402 3:131614979-131615001 AAGTTTAAGAATAGTGATCTAGG - Intronic
963795863 3:149630284-149630306 TAATTTTATATGAGTTATTTTGG - Intronic
964335202 3:155647371-155647393 TAATTTAATAAGAATGTTTCTGG + Intronic
965052403 3:163667789-163667811 TAATGTAATAAAAGCCATCTGGG - Intergenic
965104013 3:164336796-164336818 TAATTTTGTAAGAGTGTTTTAGG + Intergenic
965975698 3:174618789-174618811 TAATTTTATAAGTGTTATTTTGG + Intronic
966030288 3:175338175-175338197 TATTTTAAAAAGAGAGAGCTGGG + Intronic
966300091 3:178469226-178469248 TAATATAATAAAAGAAATCTAGG - Intronic
969067094 4:4494600-4494622 ATAGTTAATAAGAGAGATCTAGG - Intronic
969383228 4:6822044-6822066 TAATTTTATTATAGTGTTCTAGG + Intronic
969885323 4:10210161-10210183 TCATTTGATAAGAGTGCACTTGG + Intergenic
970093086 4:12431354-12431376 TAATTTAAAGAGAGTGATGGGGG + Intergenic
970399315 4:15702657-15702679 AAATTAAAAAAGAGTGAGCTTGG - Intronic
970682292 4:18524005-18524027 TACTATAATTAAAGTGATCTGGG - Intergenic
973016250 4:45142385-45142407 TGATTTAAAAAGATAGATCTGGG + Intergenic
973043642 4:45507441-45507463 TAATTTAATAAAAATGTTATTGG + Intergenic
974353616 4:60783221-60783243 TAGTTTATAAAGAGTGAGCTGGG - Intergenic
975483480 4:74908066-74908088 TAATTAAATAAGAGTAGGCTTGG - Intergenic
976699369 4:87952446-87952468 AAATTTAATAATAGTCATCATGG - Intergenic
976880568 4:89919094-89919116 TAATATAATAATTCTGATCTAGG - Intronic
977063974 4:92289816-92289838 TAATTTAATAAGATTGCATTGGG + Intergenic
977192642 4:94019790-94019812 TCATTTGATAATAGTGACCTGGG - Intergenic
977446969 4:97143038-97143060 TAATATAATAAGAGTCCTCAGGG + Intergenic
977545913 4:98376696-98376718 TATTACAATAATAGTGATCTGGG - Intronic
977787389 4:101053522-101053544 GAATTTATTAAGAGTGAAATAGG - Intronic
978688091 4:111472735-111472757 TAAATTAATAAGAATGACCCAGG + Intergenic
979848987 4:125553456-125553478 TAATTTAGTAAGGGTGATAGAGG + Intergenic
982660174 4:158197182-158197204 GGATTTCAGAAGAGTGATCTGGG + Intergenic
982708246 4:158734078-158734100 CAATTTAAAAAAAGTGACCTTGG + Intergenic
982970790 4:161983042-161983064 TAATTTAATCAGAGAAATCGAGG + Intronic
986673223 5:10161693-10161715 CAATTTAATAAGAGTATTTTTGG - Intergenic
987555365 5:19439889-19439911 TAAATTAATAATAGTATTCTAGG + Intergenic
987914537 5:24194637-24194659 TAATGGAATATTAGTGATCTGGG + Intergenic
989540260 5:42610035-42610057 CAATTTTATAAGTGTGATATAGG + Intronic
989712037 5:44410808-44410830 AAGTGTAATAAAAGTGATCTGGG - Intergenic
990696671 5:58425873-58425895 TCATTTTCAAAGAGTGATCTAGG + Intergenic
991136007 5:63182825-63182847 TAATTTACTAAGTGTTTTCTGGG - Intergenic
991675286 5:69084638-69084660 TGATTTAACAGGAGTGTTCTAGG + Intergenic
993123211 5:83800662-83800684 TCATTGAATAACTGTGATCTTGG - Intergenic
993831238 5:92761151-92761173 TAATTTAATCAGCATCATCTTGG + Intergenic
994439481 5:99784264-99784286 TTATTAAATAAGAGTGAAATGGG + Intergenic
994784503 5:104139679-104139701 TCATTCAATAAGAGGGAGCTGGG + Intergenic
995290684 5:110448590-110448612 TAATTTAATAATATTAATATGGG + Intronic
995600659 5:113791772-113791794 CAATTGAAAAAGACTGATCTGGG + Intergenic
995676324 5:114666354-114666376 AAATTTAATAAGAATTATTTAGG + Intergenic
996453285 5:123652025-123652047 TATTTTGATAAGAGTGAGATGGG + Intergenic
996491037 5:124097068-124097090 TAATTAAAACAGTGTGATCTTGG - Intergenic
997135143 5:131317546-131317568 TGATGTAGTAAGAGGGATCTTGG + Intronic
997916712 5:137934049-137934071 TAATTTAAAAAGAGGGAGTTTGG + Intronic
998198931 5:140102479-140102501 TATTTTAAATAGAGTGATCAAGG - Intergenic
999044387 5:148451448-148451470 ACATTTAATATGAGTAATCTGGG - Intronic
999624570 5:153506812-153506834 TAAAGTATTCAGAGTGATCTTGG - Intronic
1001151987 5:169238251-169238273 AAATTTAATAAGAGAAATGTAGG - Intronic
1003966794 6:11259526-11259548 TAATTTAATCTGAGTGCTCTAGG + Intronic
1004951884 6:20682257-20682279 TATTTTAATAAATGTCATCTAGG - Intronic
1007854326 6:44839202-44839224 TAGTGTGATAAGGGTGATCTGGG - Intronic
1008164653 6:48121432-48121454 TAATATAATAGTAGTGATGTCGG + Intergenic
1008260795 6:49364681-49364703 TCATTGAAAAAGAGTCATCTAGG - Intergenic
1008843821 6:55937395-55937417 TAATTTAAAAAGAGACATATAGG - Intergenic
1009555478 6:65159337-65159359 TAATGTAGAAAGAGTGCTCTAGG + Intronic
1009925090 6:70111187-70111209 TCATTTAATAAGAATATTCTAGG + Intronic
1010329155 6:74601748-74601770 TATCTTAATAAGAATGATGTTGG + Intergenic
1010622664 6:78095897-78095919 TGATTTAATAAATGTGATTTTGG - Intergenic
1011164151 6:84427087-84427109 TAATTTAAGAAAAGGGGTCTAGG + Intergenic
1011328564 6:86178042-86178064 TAATTTCAGAAGATAGATCTGGG - Intergenic
1012586174 6:100925504-100925526 AAATTTAAAAAGACTGATTTTGG + Intergenic
1012803433 6:103865262-103865284 TAATTTAAAAAGTGTGATAATGG + Intergenic
1014143776 6:117972836-117972858 TAATTTTATAATGGGGATCTAGG - Intronic
1014522597 6:122463074-122463096 TAATTAAAACAGAGTGATATAGG + Intronic
1014609896 6:123529123-123529145 TAATTTAATAACAGTGCTGCTGG - Exonic
1014702357 6:124706326-124706348 TCATTTATTAGGAGTAATCTTGG - Intronic
1014949128 6:127534807-127534829 TGATTGAATAAGAGTGTTGTGGG + Intronic
1015480835 6:133706901-133706923 TGTTTGAATAAGTGTGATCTTGG + Intergenic
1015743646 6:136486190-136486212 TATTTAAATAAAAGTGATGTGGG + Intronic
1015812585 6:137175760-137175782 TAAATTAATCTGAGTGACCTAGG + Intergenic
1015909785 6:138159168-138159190 TAATTTAAAAAGAATAATGTGGG - Intergenic
1016124866 6:140387462-140387484 TAACTTAATAAAAGAGATGTTGG - Intergenic
1017182724 6:151569131-151569153 TTATTTTATAAAATTGATCTAGG + Intronic
1017220026 6:151955228-151955250 TAGTTTATTAAGAGTAATCAAGG - Intronic
1019375183 7:687043-687065 TAATTGGATAAGGGTGATCCAGG + Intronic
1020699222 7:11457333-11457355 TAATTTAAGAATAGTTATATTGG - Intronic
1020837394 7:13170304-13170326 TAAGTTGATAAGAGTGAACAGGG - Intergenic
1022029065 7:26475616-26475638 AAATTTCATCAGAGTGATTTTGG + Intergenic
1027916485 7:84329973-84329995 TAATTCAATAATAGTGATTTTGG + Intronic
1028076520 7:86523356-86523378 AAATGTAATTAGAGTGATTTTGG - Intergenic
1028257413 7:88616671-88616693 AAATTTAATAACAGCGTTCTGGG - Intergenic
1028274998 7:88844634-88844656 ACTTTTACTAAGAGTGATCTGGG + Intronic
1028710141 7:93897700-93897722 AAGTTTAATTGGAGTGATCTGGG - Intronic
1028839528 7:95412963-95412985 TAATTTAAAAAGTGTTATATTGG - Intronic
1029056943 7:97755498-97755520 TCATTTCAAAAGAGTGACCTTGG + Intergenic
1031192800 7:118576247-118576269 TGATTTAGTAGGAGAGATCTTGG + Intergenic
1031467183 7:122126879-122126901 TAGTTCAAGAAGAGTGGTCTTGG - Intronic
1032046340 7:128612050-128612072 TAATTTAATAATAATAATATAGG - Intergenic
1032681861 7:134193228-134193250 TAATTGATTAAGAGTACTCTGGG + Intronic
1032942830 7:136814822-136814844 CAATATAATAAGAGTTATTTAGG - Intergenic
1032950391 7:136902529-136902551 TGAGTTCATAAGAGTCATCTAGG - Intronic
1033275398 7:139967729-139967751 ACTTTTAATAAGAGTGATTTGGG - Intronic
1033384391 7:140857702-140857724 TTATTCAAGAAGAGAGATCTAGG + Intronic
1033853880 7:145533441-145533463 TAATTTAATCAGAGTCTTCAAGG - Intergenic
1034025876 7:147703205-147703227 TGTTCTAATTAGAGTGATCTGGG - Intronic
1034829007 7:154292938-154292960 TAATTTCATAATAGAAATCTTGG + Intronic
1034877316 7:154736873-154736895 AATTCTAATAAGAGTGATCATGG - Intronic
1035609836 8:953867-953889 AGATTTAATAAAACTGATCTTGG + Intergenic
1036525794 8:9533295-9533317 TAATATAATAAGAACGATATTGG - Intergenic
1037267418 8:17080209-17080231 TAATTTAATAAAAATGGTCAAGG - Intronic
1038078544 8:24105501-24105523 CAATTTTATGAGACTGATCTTGG - Intergenic
1038526665 8:28280244-28280266 TAATTTAATCAAAGTCATATTGG + Intergenic
1039459079 8:37728300-37728322 TGGTTTAATAAGAGTAAACTAGG - Intergenic
1040859615 8:51985437-51985459 TAGCTTAATAAAAGTGATTTAGG - Intergenic
1043221995 8:77677919-77677941 AAATTTAATAACATTGGTCTGGG + Intergenic
1043653075 8:82623694-82623716 TAATTTATGAAAAGTGTTCTAGG - Intergenic
1043858738 8:85291073-85291095 TATTTGAATAAATGTGATCTGGG + Intergenic
1044040431 8:87361011-87361033 TAATTTAACAAGGATAATCTTGG - Intronic
1044134356 8:88566734-88566756 TAATTTAATAAGATTGACTTGGG + Intergenic
1044455783 8:92391628-92391650 TAATTAAATAATAAAGATCTTGG - Intergenic
1045923510 8:107560995-107561017 TAAATTAATAAGTGTATTCTAGG - Intergenic
1045947524 8:107813197-107813219 TAATTAAATAAGAGTTAGGTTGG + Intergenic
1046533983 8:115485001-115485023 TTATTCAATAACACTGATCTAGG + Intronic
1046560418 8:115830221-115830243 TACTTTGAGAAAAGTGATCTAGG - Intergenic
1047433906 8:124818409-124818431 TCATTTGATAAGACTGATCTGGG + Intergenic
1048972524 8:139653210-139653232 TCATTTAAAAAGAGGGCTCTCGG - Intronic
1049226650 8:141455001-141455023 AAATTTAATAAAAGAGCTCTTGG - Intergenic
1050159601 9:2703572-2703594 TAAATAAATAAGTGTGAACTTGG + Intergenic
1051099184 9:13501555-13501577 TTATTTCATAAGATTGATTTTGG - Intergenic
1051652766 9:19345859-19345881 TATTTTAATAAAAGTTAACTTGG + Intronic
1052636175 9:31107576-31107598 ATATTTAATAATAGTGATATAGG - Intergenic
1053888091 9:42659972-42659994 TAATGTAATAAAAGCTATCTAGG - Intergenic
1054227111 9:62467422-62467444 TAATGTAATAAAAGCTATCTAGG - Intergenic
1054519666 9:66065432-66065454 GAATTTAAAAAGAATGATTTTGG - Intergenic
1054986674 9:71269874-71269896 TAATAGAATAAAAGTGATCCAGG - Intronic
1056079980 9:83082112-83082134 TACTTTAATTAGTATGATCTTGG + Intergenic
1058391967 9:104505777-104505799 TAATGAAATATGAGTGATTTTGG + Intergenic
1203363269 Un_KI270442v1:236212-236234 TAAATAAATAAAAATGATCTGGG + Intergenic
1188079560 X:25819844-25819866 TCCTTTAATAACAGTGATATTGG - Intergenic
1192422564 X:71046701-71046723 TAATATAAAAAGTGTGATTTTGG + Intergenic
1192913283 X:75628197-75628219 TAATATAATAAAAGCCATCTAGG - Intergenic
1193743916 X:85252128-85252150 AAATTTAATAAGAGATATCTTGG + Intronic
1194406764 X:93505865-93505887 TAATAGGATAAGAATGATCTTGG + Intergenic
1195027128 X:100888682-100888704 TATTTTAAATAGAGTGATCAGGG + Intergenic
1195172518 X:102282517-102282539 CAAAATAATAAGAGTCATCTAGG - Intergenic
1195186348 X:102404578-102404600 CAAAATAATAAGAGTCATCTAGG + Intronic
1195390078 X:104352608-104352630 TAATTTTATGAGATTGATGTGGG + Intergenic
1196047700 X:111273571-111273593 TATTTTAATAAGAGTAGTCGAGG + Intergenic
1196888605 X:120270937-120270959 TTATTTTAATAGAGTGATCTAGG + Intronic
1197109899 X:122759803-122759825 AAATTTAATAAGATTGAACCAGG - Intergenic
1198581378 X:138068514-138068536 TATTTTCTTAAGAGTTATCTTGG + Intergenic
1198947716 X:142032946-142032968 TACTTTTATAAGAATTATCTTGG - Intergenic
1200968861 Y:9128414-9128436 TACTATAATAATAGTGATCCTGG - Intergenic
1201075038 Y:10180510-10180532 TAAATAAATAAAAATGATCTGGG - Intergenic
1201709027 Y:16969081-16969103 TTATTTAATAAGATTGACTTTGG - Intergenic
1201796148 Y:17898635-17898657 CAAATTAATAAGAGCTATCTAGG + Intergenic
1201805407 Y:18007350-18007372 CAAATTAATAAGAGCTATCTAGG - Intergenic