ID: 1139793059

View in Genome Browser
Species Human (GRCh38)
Location 16:69456259-69456281
Sequence GGTGAATCCCAACACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139793059_1139793062 -8 Left 1139793059 16:69456259-69456281 CCTTCCCAGTGTTGGGATTCACC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1139793062 16:69456274-69456296 GATTCACCAGATGTGAACCAAGG 0: 1
1: 0
2: 0
3: 10
4: 139
1139793059_1139793067 21 Left 1139793059 16:69456259-69456281 CCTTCCCAGTGTTGGGATTCACC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1139793067 16:69456303-69456325 GCCCTACTTATTTATTTTAGTGG 0: 1
1: 0
2: 2
3: 18
4: 207
1139793059_1139793069 22 Left 1139793059 16:69456259-69456281 CCTTCCCAGTGTTGGGATTCACC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1139793069 16:69456304-69456326 CCCTACTTATTTATTTTAGTGGG 0: 1
1: 0
2: 0
3: 31
4: 292
1139793059_1139793071 23 Left 1139793059 16:69456259-69456281 CCTTCCCAGTGTTGGGATTCACC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1139793071 16:69456305-69456327 CCTACTTATTTATTTTAGTGGGG 0: 1
1: 0
2: 3
3: 50
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139793059 Original CRISPR GGTGAATCCCAACACTGGGA AGG (reversed) Intronic
901005895 1:6171354-6171376 GGTGAAACCCACCTCTGAGAAGG + Intronic
901136797 1:7002499-7002521 CGTGAATAACAACACTGAGAAGG - Intronic
902187762 1:14738205-14738227 AGAGAATCCCAAGACTGTGATGG + Intronic
905490288 1:38338041-38338063 GGTGGATCCCAAATCTGAGAAGG + Intergenic
909944942 1:81653524-81653546 GCTGCTTCCCAACACTGGAAAGG + Intronic
913165620 1:116182006-116182028 TGTAAATCCCAAAACAGGGAGGG - Intergenic
914438233 1:147679791-147679813 GATAAAACCCAGCACTGGGAAGG + Intergenic
922763404 1:228145896-228145918 AGTGAAGCACACCACTGGGAAGG - Intronic
1064378125 10:14815390-14815412 AGTGAAACCCACCACTAGGATGG + Intergenic
1066436349 10:35399583-35399605 TGTTAATCCCAACACTTGGGAGG + Intronic
1071693210 10:87844378-87844400 GGGGAATCCCAGCAGAGGGAAGG + Intergenic
1073305950 10:102503816-102503838 GGACACTCCCAACACAGGGAGGG + Intergenic
1073609543 10:104929557-104929579 GGTGCATCCCAACACTGAGTTGG + Intronic
1078740704 11:14063785-14063807 GCTGATTCCCAACATTGTGAAGG + Intronic
1084167060 11:67379934-67379956 GGGACATCCCATCACTGGGATGG - Intronic
1085056242 11:73405753-73405775 GGTGAGTCCTGGCACTGGGAAGG + Intronic
1085401788 11:76239927-76239949 GGAGAAACCTACCACTGGGATGG - Intergenic
1088070936 11:105784165-105784187 GGTCACTACCAACACTGTGAAGG + Intronic
1090534505 11:127625869-127625891 AGTGAAGCCCAACACTAGCAGGG - Intergenic
1092537526 12:9403339-9403361 GGTGCCTCCCCACACTGCGACGG - Intergenic
1092538036 12:9404846-9404868 GGTGCATCCCTCCACTGCGATGG - Intergenic
1092538819 12:9407119-9407141 GGTGCATCCCCCCACTGCGATGG - Intergenic
1092557018 12:9569685-9569707 GGTGCATCCCCCCACTGCGATGG + Intergenic
1095168657 12:39006519-39006541 GGTGCTTCCCAACTCTGAGAGGG - Intergenic
1095253928 12:40011420-40011442 TGTGAGTCCCAACAAAGGGAAGG - Intronic
1096465005 12:51843602-51843624 GATTAATCACAACACTGGGCTGG + Intergenic
1097172738 12:57126815-57126837 CTTGGATCCCAATACTGGGAGGG + Intronic
1097461686 12:59871248-59871270 AGTAAAACCCAGCACTGGGAAGG + Intergenic
1097525973 12:60736829-60736851 AATGAATCCGAACACTGAGAAGG - Intergenic
1100713859 12:97285381-97285403 AGTGAACACCAACAATGGGATGG - Intergenic
1101917285 12:108905541-108905563 CTCTAATCCCAACACTGGGAGGG + Intergenic
1108251582 13:48573107-48573129 GGTGAACCCCTAAGCTGGGATGG - Intergenic
1110745963 13:79053701-79053723 TTTGAATTCCAACACTGGGCAGG + Intergenic
1113840571 13:113357766-113357788 GGTGAGTCCCAGCACAGGCAAGG + Intronic
1114404002 14:22436949-22436971 GGTGGATGACTACACTGGGAAGG + Intergenic
1119355598 14:74003838-74003860 TGTAAATCCCAACACTTGGGAGG + Intronic
1121669448 14:95696633-95696655 AGTGTTTCCAAACACTGGGAAGG + Intergenic
1122250593 14:100436732-100436754 GGTGAAACCCAACCCCAGGAAGG - Intronic
1122698371 14:103569693-103569715 GGTGAGTCCCACCAAAGGGACGG - Intronic
1123029093 14:105442409-105442431 GGTGGACCCCAGCTCTGGGAGGG + Intronic
1129884350 15:79028183-79028205 GGTGCAGCTCAGCACTGGGAAGG + Intronic
1130137076 15:81190311-81190333 GGTTAAACGCCACACTGGGAGGG - Intronic
1134054915 16:11164026-11164048 GGCAAATCCAAACACTGGGCAGG - Intronic
1134399075 16:13892384-13892406 TGTGGATCCAAGCACTGGGATGG - Intergenic
1139793059 16:69456259-69456281 GGTGAATCCCAACACTGGGAAGG - Intronic
1141446546 16:84062441-84062463 TGTAAATCCCTAGACTGGGATGG - Intronic
1141771042 16:86089779-86089801 CCTGAATCCCCTCACTGGGAAGG - Intergenic
1142759852 17:2035895-2035917 GGAGAGACCCAACCCTGGGAGGG - Intronic
1146050311 17:29545815-29545837 AGTGAACACCAACACTGGGAAGG - Exonic
1146239500 17:31205034-31205056 GAGGAATCCCAAAACTGGGAGGG - Intronic
1147782997 17:42957083-42957105 GGCCCATCCCAGCACTGGGAGGG - Intronic
1148380037 17:47189525-47189547 GGCGTAGCCCAACCCTGGGACGG - Intergenic
1154140936 18:11823593-11823615 GGTGGATCCAAGCACTGTGAGGG - Intronic
1160496299 18:79377745-79377767 GGTGAAGCCTCACACTGAGAGGG - Exonic
1162454575 19:10775694-10775716 GGTCAAGTTCAACACTGGGAGGG - Exonic
1162958701 19:14113816-14113838 GCTGGACCCCAACACTGGGATGG + Intronic
1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG + Intronic
1164724610 19:30457751-30457773 TGTGAGGCCCCACACTGGGAAGG + Intronic
1165979441 19:39707196-39707218 GGTGAATTTCTACACTGGGATGG + Exonic
925505562 2:4559486-4559508 GGTGGCTCCCAGCACTTGGAAGG + Intergenic
927649142 2:24900705-24900727 GCTGAATTCAAACACTGGAAGGG + Intronic
929608518 2:43252180-43252202 GGTGAAAGCAAATACTGGGAGGG - Intronic
932593753 2:73081695-73081717 GGTTAATGCCAAGACTGGAAAGG + Intronic
935120342 2:100178589-100178611 GGTGAGTCCCAAAGTTGGGAAGG - Intergenic
935585506 2:104796769-104796791 GCTGATTCCCAACACTGGGGAGG + Intergenic
936449251 2:112621147-112621169 TGTGTGTCCCTACACTGGGAAGG + Intergenic
940101342 2:150042718-150042740 TCTGAATCCCAACTCTGGTAAGG + Intergenic
1178741502 21:35206332-35206354 GGTGGAGCCCAAGAGTGGGAGGG + Intronic
1180578987 22:16811382-16811404 GGTGAATCCAAACACTTTGGTGG - Intronic
1182064185 22:27418724-27418746 TCTGAATCCCAGCACTGGGTTGG - Intergenic
949616569 3:5760111-5760133 TGTGAATCTTCACACTGGGAAGG + Intergenic
951089114 3:18551734-18551756 TGTGAATCGCAACTCTGGCATGG + Intergenic
951208606 3:19949456-19949478 GGTAAATCCCAACACTTTGGGGG - Intronic
954593328 3:51802810-51802832 GGTCTGTCCCACCACTGGGAGGG - Intergenic
956063868 3:65376306-65376328 TGTGAAACCCAAGGCTGGGATGG + Intronic
956271059 3:67447276-67447298 GTTGAACCCCAACAATGAGAGGG + Intronic
957238384 3:77624918-77624940 GTTCAATAACAACACTGGGATGG + Intronic
958908488 3:99967555-99967577 GGTGAGTCCCTACACCTGGATGG + Intronic
964421887 3:156511897-156511919 AGTGAGTCCCAGCAATGGGAGGG - Intronic
969726689 4:8922361-8922383 AGTGGAGCCCAAGACTGGGAGGG + Intergenic
970003576 4:11388444-11388466 GGTGAAGACCAACATAGGGATGG + Intergenic
983089358 4:163485911-163485933 AGTGCTTCACAACACTGGGAGGG - Intergenic
984418966 4:179495251-179495273 GGTGAATATCCACACTGGAAGGG + Intergenic
984452775 4:179924597-179924619 GGAGAATACCAATACTGAGAAGG - Intergenic
985630230 5:1010034-1010056 GGTGCCTCCCATCTCTGGGAGGG + Intronic
987029191 5:13960299-13960321 AGTGAACCCCAACACTGGAGGGG + Intergenic
989376378 5:40766739-40766761 CTGTAATCCCAACACTGGGAGGG + Intronic
990950211 5:61291231-61291253 AGTGAACCCCAGCACTTGGATGG - Intergenic
992070743 5:73146390-73146412 GCTGAATTCCAACACAGAGAGGG + Intergenic
993466780 5:88257176-88257198 CGAGAATCGCAAGACTGGGAGGG + Intronic
993617367 5:90130116-90130138 GGTGAATCCTAAGATTTGGAAGG - Intergenic
994039513 5:95243020-95243042 GATGAATCCCAGCACTAGGAGGG + Intronic
997884021 5:137614871-137614893 AAAGACTCCCAACACTGGGAAGG + Intergenic
998211542 5:140202823-140202845 GGAGAAACCCAACACTGGTTTGG - Intronic
1000602610 5:163293092-163293114 TGTGAAGCCCAGCAGTGGGAGGG + Intergenic
1000987705 5:167879034-167879056 GGTGAAGCCCATCATTAGGAGGG + Intronic
1002112941 5:176932577-176932599 GCCGAATCCTAATACTGGGAGGG + Intronic
1003104799 6:3207173-3207195 CTGTAATCCCAACACTGGGAGGG + Intergenic
1004857018 6:19761516-19761538 GGTGAATCCCAATACTGTAATGG + Intergenic
1005646123 6:27839899-27839921 GGCCAATCCCGACACTGCGAGGG + Intronic
1016952899 6:149598465-149598487 CTGTAATCCCAACACTGGGAGGG + Intronic
1017040503 6:150304793-150304815 GGTGATGCCCACTACTGGGAGGG + Intergenic
1017194911 6:151689606-151689628 GGTGCATCTCAAAACTGGCATGG - Intronic
1018871552 6:167787580-167787602 GGTTTATTTCAACACTGGGAAGG - Exonic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1023250178 7:38250670-38250692 GCTGCATCCCAAAACTTGGAGGG - Intergenic
1023251487 7:38266771-38266793 GCTGCATCCCAAAACTTGGAGGG - Intergenic
1024412419 7:49060502-49060524 AGGGTATCCCAACAGTGGGAAGG + Intergenic
1028268464 7:88758582-88758604 GGTGTCTCCAAACCCTGGGAGGG + Intergenic
1029005174 7:97201799-97201821 TCTGAATCCCAACCTTGGGAAGG - Intergenic
1029314202 7:99696671-99696693 GGTGAATACCACCAGTTGGAAGG - Intronic
1029521267 7:101064179-101064201 GGTGAACCGCATAACTGGGAAGG - Intergenic
1035603730 8:915249-915271 TGTGAAACCCATCACTGGGCTGG + Intergenic
1036222660 8:6933801-6933823 TTTGTCTCCCAACACTGGGAGGG - Intergenic
1036773298 8:11593239-11593261 CCTGAATCCCAACACTGACAGGG + Intergenic
1037873409 8:22521484-22521506 GGTGGAGCCCAAGACTAGGAAGG - Intronic
1044987604 8:97769027-97769049 CTATAATCCCAACACTGGGAGGG - Intergenic
1046362277 8:113176730-113176752 GGGGAACAACAACACTGGGAGGG + Intronic
1052745347 9:32434895-32434917 TGTGAATCCTAACAAGGGGAAGG + Intronic
1052761541 9:32597192-32597214 GGTGATTCCAATCACTAGGATGG + Intergenic
1053252341 9:36585239-36585261 GGTGACTTCAAACACTGGAATGG - Intronic
1053736661 9:41106989-41107011 GGTGCATCCCCCCACTGCGATGG - Intergenic
1054691711 9:68324412-68324434 GGTGCATCCCCCCACTGCGATGG + Intergenic
1060502591 9:124173300-124173322 GCTGAATCCCAACAGAGGGAGGG - Intergenic
1061040519 9:128138701-128138723 GGTGAATCCCCCCACTGCGATGG + Intergenic
1061885366 9:133588505-133588527 GTTGGATCCCAACTCTGGGGTGG + Intergenic
1185771713 X:2769950-2769972 GGTGAAGCACAACAATGTGAGGG - Intronic
1190423617 X:50310812-50310834 GGAGAAGCCCAGCACTGAGAAGG + Exonic
1190423635 X:50310971-50310993 TGAGAAACCCACCACTGGGAAGG + Exonic
1190423673 X:50311217-50311239 TGAGAAACCCACCACTGGGAAGG + Exonic
1195559329 X:106265755-106265777 GGTGAAACCCAGCACTGTGCTGG - Intergenic
1201550021 Y:15209807-15209829 AGTGAAGCAAAACACTGGGACGG - Intergenic