ID: 1139794781

View in Genome Browser
Species Human (GRCh38)
Location 16:69473667-69473689
Sequence TGACATGGCACAAGTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139794781_1139794786 24 Left 1139794781 16:69473667-69473689 CCTGTCACACTTGTGCCATGTCA No data
Right 1139794786 16:69473714-69473736 GTTAGTCTTCCCAAATAGACTGG No data
1139794781_1139794784 -4 Left 1139794781 16:69473667-69473689 CCTGTCACACTTGTGCCATGTCA No data
Right 1139794784 16:69473686-69473708 GTCATTTTTTGGCACCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139794781 Original CRISPR TGACATGGCACAAGTGTGAC AGG (reversed) Intergenic
No off target data available for this crispr