ID: 1139797464

View in Genome Browser
Species Human (GRCh38)
Location 16:69495307-69495329
Sequence GTCCTTCCAACCACCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139797464_1139797471 23 Left 1139797464 16:69495307-69495329 CCCCCAAAGGTGGTTGGAAGGAC No data
Right 1139797471 16:69495353-69495375 CCCAGCATAATGTGTATGCATGG No data
1139797464_1139797473 24 Left 1139797464 16:69495307-69495329 CCCCCAAAGGTGGTTGGAAGGAC No data
Right 1139797473 16:69495354-69495376 CCAGCATAATGTGTATGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139797464 Original CRISPR GTCCTTCCAACCACCTTTGG GGG (reversed) Intergenic
No off target data available for this crispr