ID: 1139798306

View in Genome Browser
Species Human (GRCh38)
Location 16:69500477-69500499
Sequence CGGCCTAGCCTGAGACCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139798300_1139798306 27 Left 1139798300 16:69500427-69500449 CCACAGAAGGATGTACTCAATCT No data
Right 1139798306 16:69500477-69500499 CGGCCTAGCCTGAGACCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139798306 Original CRISPR CGGCCTAGCCTGAGACCTCA CGG Intergenic
No off target data available for this crispr