ID: 1139800963

View in Genome Browser
Species Human (GRCh38)
Location 16:69522291-69522313
Sequence ATACGGGGCCAGATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139800951_1139800963 23 Left 1139800951 16:69522245-69522267 CCACAGTGGAGGGTGTGGAGTAA No data
Right 1139800963 16:69522291-69522313 ATACGGGGCCAGATGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139800963 Original CRISPR ATACGGGGCCAGATGGGGGA AGG Intergenic
No off target data available for this crispr