ID: 1139805939

View in Genome Browser
Species Human (GRCh38)
Location 16:69565780-69565802
Sequence GGGAAAGGGCCCCGCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139805939_1139805948 2 Left 1139805939 16:69565780-69565802 CCCTGGCAGCGGGGCCCTTTCCC 0: 1
1: 0
2: 2
3: 9
4: 156
Right 1139805948 16:69565805-69565827 CTCAGGAACAGCAGCAGCCCGGG 0: 1
1: 0
2: 3
3: 69
4: 433
1139805939_1139805947 1 Left 1139805939 16:69565780-69565802 CCCTGGCAGCGGGGCCCTTTCCC 0: 1
1: 0
2: 2
3: 9
4: 156
Right 1139805947 16:69565804-69565826 GCTCAGGAACAGCAGCAGCCCGG 0: 1
1: 0
2: 4
3: 58
4: 406
1139805939_1139805949 11 Left 1139805939 16:69565780-69565802 CCCTGGCAGCGGGGCCCTTTCCC 0: 1
1: 0
2: 2
3: 9
4: 156
Right 1139805949 16:69565814-69565836 AGCAGCAGCCCGGGCCGCGCCGG 0: 1
1: 0
2: 5
3: 37
4: 306
1139805939_1139805953 23 Left 1139805939 16:69565780-69565802 CCCTGGCAGCGGGGCCCTTTCCC 0: 1
1: 0
2: 2
3: 9
4: 156
Right 1139805953 16:69565826-69565848 GGCCGCGCCGGCAGGAAGCGAGG 0: 1
1: 0
2: 3
3: 17
4: 188
1139805939_1139805950 15 Left 1139805939 16:69565780-69565802 CCCTGGCAGCGGGGCCCTTTCCC 0: 1
1: 0
2: 2
3: 9
4: 156
Right 1139805950 16:69565818-69565840 GCAGCCCGGGCCGCGCCGGCAGG 0: 1
1: 0
2: 4
3: 42
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139805939 Original CRISPR GGGAAAGGGCCCCGCTGCCA GGG (reversed) Intronic