ID: 1139808402

View in Genome Browser
Species Human (GRCh38)
Location 16:69589988-69590010
Sequence TTGTAGAGACAGTTGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139808402_1139808408 5 Left 1139808402 16:69589988-69590010 CCCCTCCCCAACTGTCTCTACAA 0: 1
1: 0
2: 4
3: 39
4: 429
Right 1139808408 16:69590016-69590038 TTAAAAAAACTAGCCAAGTCTGG 0: 1
1: 0
2: 26
3: 541
4: 6399
1139808402_1139808409 8 Left 1139808402 16:69589988-69590010 CCCCTCCCCAACTGTCTCTACAA 0: 1
1: 0
2: 4
3: 39
4: 429
Right 1139808409 16:69590019-69590041 AAAAAACTAGCCAAGTCTGGTGG 0: 1
1: 31
2: 1276
3: 19136
4: 92450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139808402 Original CRISPR TTGTAGAGACAGTTGGGGAG GGG (reversed) Intronic
900721998 1:4182744-4182766 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
900819155 1:4872924-4872946 TTAGAGAGAAAGTTGGGGGGTGG - Intergenic
901142892 1:7046637-7046659 TGGGAGAGACAGTGGGAGAGAGG + Intronic
901938006 1:12640669-12640691 TTGTAAAGAAAGGAGGGGAGTGG + Intergenic
903395444 1:22998551-22998573 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
904636416 1:31884954-31884976 TTGTAGAGACTGGTGGCGGGGGG - Intergenic
905429718 1:37912810-37912832 TGGTGGAGATAGCTGGGGAGAGG - Intronic
905710165 1:40095443-40095465 TTGTAGAGGCATTTGGAGTGTGG - Intronic
906298705 1:44665259-44665281 GTGGAGAGACAGATAGGGAGGGG + Intronic
907504686 1:54909417-54909439 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
908392909 1:63699489-63699511 TTGTAGAGACACAGGGGGTGAGG + Intergenic
909015201 1:70372929-70372951 TGGTGGAGATAGTTGGGGAGAGG - Intronic
911759456 1:101599397-101599419 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
911967489 1:104386373-104386395 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
911984334 1:104601725-104601747 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
913095223 1:115510182-115510204 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
913143867 1:115969843-115969865 TTGTAGCCAGACTTGGGGAGTGG - Intergenic
916170105 1:161995574-161995596 CTGGGGAGGCAGTTGGGGAGAGG + Intronic
916942110 1:169687182-169687204 TGGTGGAGATAGCTGGGGAGAGG - Intronic
918309372 1:183274876-183274898 TTGTAGGGAAAGTTGGTGGGAGG - Intronic
918491021 1:185081573-185081595 TAGTAGAGACGGGTGGGGTGGGG + Intronic
919091807 1:192986575-192986597 ATGTAGATACAGCTGGGAAGAGG + Intergenic
919382637 1:196877788-196877810 TTTTGGAGGCAGGTGGGGAGAGG + Intronic
920426891 1:205885624-205885646 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
920578609 1:207083359-207083381 TTGTAGAGATGGGTGGGGGGGGG - Intronic
921205564 1:212845727-212845749 TGGTGGAGATAGCTGGGGAGAGG - Intronic
921520530 1:216150402-216150424 TGGTGGAGATAGCTGGGGAGAGG - Intronic
922250023 1:223840493-223840515 TTGTGGAGAAAGCTGGTGAGAGG + Intronic
922798685 1:228353981-228354003 TGGGAGAGACAGTTGAGGTGGGG - Intronic
923075693 1:230606859-230606881 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
923181083 1:231520430-231520452 TTGTAGAAAGAGGAGGGGAGAGG + Intergenic
924612747 1:245587474-245587496 TTCTAGACTCATTTGGGGAGTGG + Intronic
1062931109 10:1353271-1353293 TGGTGGAGATAGCTGGGGAGAGG - Intronic
1064135543 10:12747486-12747508 TTGAAGAGACAGGAGCGGAGGGG + Intronic
1066103041 10:32134726-32134748 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1066436709 10:35402648-35402670 TGGTAGAGATAGCTGGGGAGAGG + Intronic
1068361350 10:55977787-55977809 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1069030700 10:63593011-63593033 TTTTAGAAACAGGTAGGGAGGGG + Intronic
1071550435 10:86562312-86562334 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1071822169 10:89289849-89289871 TGGTGGAGATAGCTGGGGAGAGG - Intronic
1072303832 10:94087613-94087635 TTGTAGAGGTGGTGGGGGAGGGG + Intronic
1072656856 10:97335381-97335403 TTGTAGAGACGGTGGTGGGGGGG + Intergenic
1072884847 10:99264015-99264037 TGGTTGAGATAGCTGGGGAGAGG - Intergenic
1073014488 10:100387079-100387101 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1073130376 10:101184918-101184940 TTGTGGAGATAGCTGGGGAGAGG + Intergenic
1073709165 10:106018982-106019004 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1073980330 10:109146728-109146750 TTAGAGAGACTGTTGGGGTGAGG + Intergenic
1074552125 10:114454107-114454129 TTGAAGTGAAAGATGGGGAGAGG - Intronic
1074886122 10:117695161-117695183 TTGTAGAGATCGGTGGGGGGCGG + Intergenic
1075016157 10:118911289-118911311 TTGTAGAGAGAGGTGGGATGAGG - Intergenic
1078507669 11:11964790-11964812 TTGAAGAGACAGGAGAGGAGGGG - Intronic
1079302268 11:19288456-19288478 GGGTAGAGCCAGATGGGGAGTGG + Intergenic
1079835461 11:25327921-25327943 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1081791190 11:45787199-45787221 TTCCACAGACCGTTGGGGAGAGG + Intergenic
1082070370 11:47934836-47934858 TTGCAAATACAGTTGGGGTGGGG + Intergenic
1082197279 11:49321585-49321607 TGGTGGAGATAGTTGGGGAGAGG + Intergenic
1084099517 11:66936794-66936816 TTGTAGAAAAACTTGGGGAAGGG + Intronic
1084354765 11:68630587-68630609 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1084619169 11:70256915-70256937 TGGTAGAGAGAGATTGGGAGTGG - Intergenic
1084863909 11:72040633-72040655 CTGTAGAGACAGCTCAGGAGAGG - Intronic
1086005336 11:82029573-82029595 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1086330190 11:85746264-85746286 TTGTAGAGACTGTGGGGAGGAGG - Intronic
1086445008 11:86862122-86862144 TTGTAGTATCTGTTGGGGAGAGG + Intronic
1086569130 11:88262912-88262934 CTGTAGAGACAGTGGCAGAGAGG + Intergenic
1086658536 11:89386539-89386561 TGGTGGGGATAGTTGGGGAGAGG - Intronic
1087159899 11:94938527-94938549 TTATAGAGACAGTTGGGAGTCGG + Intergenic
1087197459 11:95315527-95315549 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1087634481 11:100687301-100687323 CTGTCAAGAGAGTTGGGGAGTGG + Intergenic
1087896571 11:103593044-103593066 TTAAAAAGTCAGTTGGGGAGAGG - Intergenic
1088076125 11:105850696-105850718 TACCAGAGACATTTGGGGAGGGG + Intronic
1089953905 11:122553347-122553369 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1090358612 11:126157511-126157533 TTCTAGAAACAGTTGTGTAGTGG - Intergenic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090778071 11:129982776-129982798 TTGTAGAGATGGTTGGGGGGAGG - Intronic
1090885163 11:130869463-130869485 TTGTAGAGGGATTTGGGGAGAGG + Intergenic
1091334870 11:134758774-134758796 TAGAAGAGACAGTTGCAGAGGGG + Intergenic
1091427659 12:405246-405268 CTGTAGAGACAGTAGGTTAGTGG + Intronic
1092580547 12:9836133-9836155 TGGTGGAGATAGCTGGGGAGAGG + Intronic
1092592431 12:9964427-9964449 TGGTGGAGATAGCTGGGGAGAGG + Intronic
1093077665 12:14774376-14774398 TTGTAGAGGCAGTTCGGGTGCGG + Exonic
1093210075 12:16297553-16297575 TTGCACAGAAAGGTGGGGAGGGG - Intergenic
1093359037 12:18201418-18201440 TGGTGGAGATAGCTGGGGAGAGG - Intronic
1093951401 12:25167496-25167518 TGGTGGAGATAGCTGGGGAGAGG - Intronic
1094471790 12:30808552-30808574 TTGAAGAGAGAGTTGAGGAAGGG + Intergenic
1094682345 12:32677869-32677891 TAGTAGAGACGGGTGGGGGGCGG - Intergenic
1094826324 12:34271952-34271974 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1095414671 12:41963224-41963246 TTGTAGAGAGAGGTGGAGTGGGG - Intergenic
1095558909 12:43542190-43542212 TTTTGGAGACAGTTTGGGAGAGG - Intronic
1095778647 12:46035480-46035502 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1096213832 12:49787684-49787706 TTGCAGAGCCAGTGGAGGAGAGG - Intergenic
1096277771 12:50225195-50225217 TTAAAGAGACAGTTGGGGCCAGG - Intronic
1096490229 12:52008998-52009020 CTGTAGAGAAAGTTGAGGAGTGG + Intronic
1096906780 12:54943554-54943576 TGGTAGAGATAGCTGGGGAGAGG + Intergenic
1097201244 12:57280649-57280671 TTCAAAAGACAGTGGGGGAGGGG - Intronic
1097251379 12:57634085-57634107 TTGTAGAGACGGGGGGGGGGGGG - Intergenic
1097742627 12:63262018-63262040 AAGTAGAGACACTTGAGGAGGGG - Intergenic
1098406524 12:70132323-70132345 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1099111266 12:78564526-78564548 ATATAGAGACATTTAGGGAGTGG + Intergenic
1099212284 12:79806541-79806563 TTGTTGAGAAAGTTGGGAGGAGG - Intronic
1099347778 12:81524351-81524373 TTGTGGACACAGTGGGGTAGAGG - Intronic
1100528220 12:95440002-95440024 TTGTAGAGACAGGTGGTGAGAGG - Intergenic
1101435375 12:104659796-104659818 TTGTAGAGATGGTGGGGGCGGGG - Intronic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1102928731 12:116846448-116846470 TTGTAGAGACATATGGGGCATGG + Intronic
1103075988 12:117983113-117983135 TTGTAGAGACAGGGGTGGGGAGG - Intergenic
1103236296 12:119375564-119375586 ATAGAGAGACAGTTGGGGGGAGG - Intronic
1103305527 12:119961023-119961045 TAGTAGAGACACTTGGAAAGGGG + Intergenic
1103797400 12:123513830-123513852 TTTAAGAGACACTTGGGCAGGGG + Intronic
1104972513 12:132538370-132538392 GTGAAGAGACAGCTGGGGATGGG - Intronic
1105999634 13:25709138-25709160 TTGATGGGACGGTTGGGGAGGGG - Intronic
1106529453 13:30576107-30576129 TTGTATATGCATTTGGGGAGAGG - Intronic
1107996186 13:45863428-45863450 TTGCAAAGAGAGATGGGGAGGGG + Intergenic
1108483596 13:50901488-50901510 TTGTAGAGCCAGATGGGAATGGG - Intergenic
1108702850 13:52958469-52958491 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1111549597 13:89789580-89789602 TTGGAGAGAAAGTGAGGGAGGGG - Intergenic
1111876499 13:93903783-93903805 TTTTAAAAACAGTTGGGGCGGGG - Intronic
1113504976 13:110810102-110810124 TTGTAAAGATGGTTGGGGCGGGG + Intergenic
1114494064 14:23120497-23120519 TTGTAGGTCCAGTTGGGGGGGGG + Intergenic
1114618194 14:24079624-24079646 GAGAAGAGACAGCTGGGGAGGGG + Intergenic
1115685203 14:35789653-35789675 TTCTACAGACAGTGGGGGTGAGG - Intronic
1117480469 14:56139040-56139062 TTGTGGAGACAGCTGGGTTGAGG + Intronic
1118730882 14:68665496-68665518 TTATAGACACAGTTTGGGATGGG - Intronic
1118860619 14:69660118-69660140 TGGTGGGGACAGTAGGGGAGTGG + Intronic
1118874668 14:69773571-69773593 TCTTAGAAACAGCTGGGGAGTGG - Intergenic
1118936742 14:70295666-70295688 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1119334280 14:73819457-73819479 AAGTAGAGACAGGTTGGGAGCGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119690446 14:76667578-76667600 AGGTAGAGTCAGTAGGGGAGAGG + Intergenic
1121192714 14:92044259-92044281 TGGTGGAGATAGCTGGGGAGAGG + Exonic
1121389429 14:93561608-93561630 TGGTGGAGATAGCTGGGGAGAGG + Intronic
1121525453 14:94616194-94616216 TGTTAGAGGCAGGTGGGGAGGGG - Intronic
1122041464 14:98990657-98990679 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1122112952 14:99514561-99514583 TTGCAGAGACTGGGGGGGAGGGG + Exonic
1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG + Intergenic
1122366476 14:101197653-101197675 GAGTAGAGACAGTTGGGTGGGGG + Intergenic
1123427724 15:20185615-20185637 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123536961 15:21192165-21192187 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123630290 15:22256396-22256418 TTGGAGAGACTGGGGGGGAGGGG + Intergenic
1124048729 15:26175629-26175651 TGGTGGAGACCGTTGCGGAGGGG + Intergenic
1126157434 15:45578301-45578323 TTGTAGAGATGGTGGGGGGGGGG - Intergenic
1126217005 15:46167000-46167022 TTGTAGAGAAAGTGAGAGAGAGG - Intergenic
1127034602 15:54901578-54901600 TAGTAGAGATAGTTAGGCAGGGG - Intergenic
1127623624 15:60758543-60758565 TTTCAAATACAGTTGGGGAGTGG + Intronic
1128429031 15:67573381-67573403 CAGGAGAGACAGTTGGGTAGAGG + Intronic
1128689814 15:69715179-69715201 TTGCAGAGACAGGAGGGAAGGGG - Intergenic
1130884796 15:88083858-88083880 CGGTAGGGAAAGTTGGGGAGGGG + Intronic
1131165201 15:90137238-90137260 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1132047765 15:98579135-98579157 TTGGCGAGGGAGTTGGGGAGAGG + Intergenic
1132258187 15:100396655-100396677 TTGTAGAGACGGTGGGGGGCAGG + Intergenic
1132614798 16:835214-835236 TTGTGGAGGGAGGTGGGGAGTGG + Intergenic
1133026269 16:2990183-2990205 TTGGAGAGATTGTTGGGGGGAGG + Intergenic
1133766266 16:8840176-8840198 TGGTGGAGATAGCTGGGGAGAGG + Intronic
1134346119 16:13393366-13393388 TTGGTGAGACATTTGGGGAAAGG - Intergenic
1135025050 16:18993124-18993146 TGGTGGAGATAGCTGGGGAGAGG + Intronic
1135538344 16:23311743-23311765 TTTTAGAGATTGGTGGGGAGGGG + Intronic
1135709629 16:24704271-24704293 TGGTAGAGACTGGTGGGGGGCGG + Intergenic
1136856574 16:33664194-33664216 ATGGAGTGACAGATGGGGAGGGG + Intergenic
1137024669 16:35460687-35460709 TTGTAGAAAAGGTTGGGGGGCGG - Intergenic
1137964270 16:52915292-52915314 TAGTAGGGACAGCTTGGGAGTGG - Intergenic
1138758536 16:59517200-59517222 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1139465715 16:67153020-67153042 ATGAATAGACAGGTGGGGAGTGG - Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1141124722 16:81392907-81392929 TTGTAGAGACTGCTGGGGGTCGG - Intergenic
1141856364 16:86683787-86683809 AGGTGGAGACAGGTGGGGAGAGG - Intergenic
1142259244 16:89034893-89034915 TTGTAGAGGCAGGTGGAGAGGGG + Intergenic
1203118152 16_KI270728v1_random:1512669-1512691 ATGGAGTGACAGATGGGGAGGGG + Intergenic
1142880183 17:2877883-2877905 TGGGGGAGACAGTTTGGGAGTGG + Intronic
1142955821 17:3521127-3521149 GTGAAGAGACAGTTAGGGTGGGG - Intronic
1144130596 17:12243018-12243040 TTCTACAGACAGTTGGACAGTGG - Intergenic
1144980240 17:19163600-19163622 TTGTAGAGACGGGGGGGGGGGGG - Intergenic
1144987982 17:19214632-19214654 TTGTAGAGACGGGGGGGGGGGGG + Intergenic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1149043796 17:52220943-52220965 AAGTAGAGACAGCTGGGGAGTGG - Intergenic
1149520050 17:57311862-57311884 TTGTAGAGACTGTGGGGATGGGG + Intronic
1149682413 17:58515292-58515314 GAGTAGAGAGAGTTGGGTAGAGG + Intronic
1151043543 17:70893382-70893404 TTTTAGTGAGAGTTCGGGAGAGG - Intergenic
1151470871 17:74316979-74317001 TTGAAGAGGCATTTGAGGAGTGG + Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152073954 17:78147416-78147438 TTATAGAGGCAGGTGGGGAGTGG + Intronic
1152107550 17:78339926-78339948 TTGTAGAGACGGTGGGGGTGGGG - Intergenic
1153239852 18:3021183-3021205 TAGTAGAGACAGGCGGGGCGCGG - Intergenic
1153637727 18:7127628-7127650 TTTTAGACACCGTGGGGGAGTGG - Intergenic
1155471315 18:26195337-26195359 TAGTAGAGACAGTAGAGAAGGGG - Intergenic
1155962352 18:32005261-32005283 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1155979148 18:32162786-32162808 TGGTAGAAGCATTTGGGGAGGGG + Intronic
1156237718 18:35220340-35220362 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1156294799 18:35779639-35779661 TTTTAGAGGACGTTGGGGAGAGG + Intergenic
1157392003 18:47310776-47310798 TTGTACAGAAAGTGGGTGAGAGG - Intergenic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1158394181 18:57066880-57066902 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1158669740 18:59464086-59464108 TGGTGGAGACAGTGGGGGAGGGG - Intronic
1158850757 18:61493903-61493925 GTGTAGACAAAGTTGGTGAGTGG - Intronic
1159975369 18:74704787-74704809 TTTTAGAGACAGTGAGGGAAAGG + Intronic
1160293909 18:77620541-77620563 TTGCACAAACAATTGGGGAGAGG - Intergenic
1161595031 19:5146756-5146778 TTGTAGAGATTGTGGGGGGGGGG - Intronic
1161868116 19:6849471-6849493 TAGTAGAGACAGTGGGGTGGGGG + Intronic
1163717210 19:18879500-18879522 TAGTAGAAACAGGTGGGCAGAGG - Intronic
1163899607 19:20089921-20089943 TGGTGGAGATAGCTGGGGAGAGG + Intronic
1166397062 19:42449174-42449196 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1166658164 19:44627323-44627345 TTGAAGAGACACTTGGGAGGGGG + Intronic
1167043012 19:47033794-47033816 TTGTAGAGATGGTGGGGGTGGGG - Intronic
1167128643 19:47569694-47569716 TTGTAGAGATGGGTGGGGGGCGG - Intergenic
1167367738 19:49063888-49063910 TTATAGAGGCAGGTGGGGAAGGG + Intronic
1167928790 19:52846570-52846592 TTGTACAGATATTTGGGCAGAGG - Intronic
1168248742 19:55128501-55128523 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1168530085 19:57120237-57120259 TTGTAGAGATGGGTGGGGGGAGG - Intronic
925352652 2:3212421-3212443 TGGTATAGACACTTGGGCAGAGG - Intronic
925812134 2:7711173-7711195 TGGGAGAGACAGTTGGGTGGGGG + Intergenic
926314770 2:11701171-11701193 TCCTAGAGAAAGGTGGGGAGGGG - Intronic
926622332 2:15058257-15058279 TGGTAGTCACAGCTGGGGAGAGG + Intergenic
926965187 2:18402054-18402076 TAGAAGAGACAGATGGGAAGGGG - Intergenic
928923290 2:36548962-36548984 CTGTAGAGATATTTGGGGTGGGG + Exonic
929163930 2:38861723-38861745 TTTCAGAGACATTTGGAGAGAGG - Exonic
929384143 2:41384316-41384338 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
929551893 2:42898910-42898932 TTGTAGAGACTGGTGGGGGCAGG - Intergenic
929684069 2:44019363-44019385 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
930193104 2:48480670-48480692 TTTTAGAGACTGTTGGGGTAGGG + Intronic
930706263 2:54507930-54507952 TGATAGAGATAGCTGGGGAGAGG + Intronic
930958717 2:57233235-57233257 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
931465017 2:62478160-62478182 TTGTAGACAGAGTTGGGAAAAGG + Intergenic
932246325 2:70199711-70199733 TTCTAGAGACAGTTGCAGGGTGG - Intronic
932398798 2:71465913-71465935 GTGTAGAGATTGTTGGGGATGGG + Intronic
934141876 2:89054725-89054747 TAGTGGAGATAGTTGGGGAGAGG - Intergenic
934227362 2:90145821-90145843 TAGTGGAGATAGTTGGGGAGAGG + Intergenic
934969462 2:98751204-98751226 TGGGAGAGACAGTGGGGGTGGGG - Intergenic
935029856 2:99311467-99311489 TTGTAGAGATGGTGGGGGAGGGG + Intronic
935552035 2:104467884-104467906 TTTAAGAGCCAGTTGAGGAGAGG + Intergenic
936658816 2:114519300-114519322 CTGTAGTGACAGATGGGGTGAGG - Intronic
937225121 2:120364270-120364292 TTGGGGGGACATTTGGGGAGTGG - Intergenic
937476173 2:122217430-122217452 TTATAGATACAGTTGGTTAGAGG + Intergenic
938006474 2:127791005-127791027 CTGTTGAGAGAGATGGGGAGAGG - Intronic
939475296 2:142678991-142679013 CTGTAGAGGGAGTTGGGGTGGGG + Intergenic
940074575 2:149726842-149726864 TTTGAGAGATAGTTGGTGAGCGG + Intergenic
940150799 2:150598436-150598458 GGGTAGAGACAGGTGGAGAGTGG - Intergenic
940183495 2:150959073-150959095 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
940217276 2:151314161-151314183 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
940530588 2:154872328-154872350 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
940776711 2:157892298-157892320 TTATAGAGAGAGTTGGAGAAGGG + Intronic
941455597 2:165709814-165709836 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
943260701 2:185658333-185658355 CTGAAGGGACAGTGGGGGAGTGG - Intergenic
943412391 2:187560172-187560194 TGGTGGAGATAGCTGGGGAGAGG + Intronic
943865692 2:192922625-192922647 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
944251717 2:197585568-197585590 TGGTGGAGATAGCTGGGGAGAGG - Intronic
946334373 2:219027681-219027703 GTGTAAAGGCAGTTGGGGTGAGG + Exonic
946637375 2:221744454-221744476 TGGTAGAGAGGGGTGGGGAGAGG + Intergenic
946697183 2:222371619-222371641 ATTAAGAGACACTTGGGGAGAGG + Intergenic
947064888 2:226212810-226212832 GAGTAGAGAGAGTTTGGGAGAGG + Intergenic
947234538 2:227926063-227926085 TTGTTGGGACTGTTGGGAAGAGG + Intergenic
947677103 2:231992205-231992227 TAGGTGAGACAGTAGGGGAGAGG + Intronic
947826188 2:233107519-233107541 GTGCAGAGACTGCTGGGGAGTGG + Intronic
1168739619 20:176593-176615 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1168900343 20:1358472-1358494 CTGCAGAGCCTGTTGGGGAGAGG + Intronic
1168942862 20:1728291-1728313 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1169277425 20:4243311-4243333 TTGTAGAGTGAGTGTGGGAGGGG - Intronic
1169710049 20:8550882-8550904 TTATTCAGACACTTGGGGAGAGG - Intronic
1172024610 20:31939269-31939291 ATGTAGGGCCAGGTGGGGAGTGG + Intronic
1172584740 20:36074934-36074956 TTGTGGAGATATTTGGGAAGAGG - Intergenic
1173153610 20:40588864-40588886 TGGAAGAGAGAGTTGGCGAGGGG - Intergenic
1175100067 20:56572977-56572999 TTGTTGAGATGGTTGGGGGGAGG - Intergenic
1175967242 20:62665808-62665830 TTGGGGGGACAGGTGGGGAGGGG - Intronic
1178108764 21:29349977-29349999 TTGGAGAGGCTGGTGGGGAGGGG - Intronic
1179509787 21:41864976-41864998 TTGCAGAGAGGGCTGGGGAGAGG - Intronic
1181081292 22:20417567-20417589 TCGTAGAGACAGGCGGGGCGAGG - Intergenic
1182885757 22:33772640-33772662 TGATAGACAAAGTTGGGGAGGGG - Intronic
1183540407 22:38426521-38426543 TTGAAGAGTCAGTGGGGGAAGGG + Exonic
1183635174 22:39057631-39057653 TGGTGGAGATAGCTGGGGAGAGG + Intronic
949146092 3:701523-701545 TGGTACAGGCAGGTGGGGAGAGG - Intergenic
951332012 3:21379927-21379949 TGGTAGAGATAGCTGGGGAGAGG + Intergenic
951430920 3:22606086-22606108 TTGAACAGACAGCTGTGGAGAGG - Intergenic
951762227 3:26159859-26159881 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
952792210 3:37208856-37208878 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
952798022 3:37260451-37260473 TAGTAGAGACAGCGGGGGTGGGG - Intronic
953358597 3:42275587-42275609 TTGTGGAGTCAGATGGGGATAGG + Intergenic
953599011 3:44345657-44345679 TGGTGGAGATAGCTGGGGAGAGG + Intronic
954535158 3:51354408-51354430 TGGTAGAAGCAGTTGGGCAGAGG - Intronic
954553677 3:51502372-51502394 TTGTAGAGACAGTGGAGCAAGGG - Intergenic
955980030 3:64515515-64515537 TTCTAGAGACAGATGGGGATGGG - Intergenic
955992579 3:64643633-64643655 TTATAGAGACAGTTAGGGGTGGG + Intronic
956233049 3:67038935-67038957 TGGTGGAGACAGCTGGGGAGAGG + Intergenic
956977952 3:74603380-74603402 TTGAAGAGACAGTTTTGTAGTGG - Intergenic
957451919 3:80390409-80390431 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
957904336 3:86538136-86538158 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
958069405 3:88590586-88590608 TAATAGAGACAGCTGGGGATGGG - Intergenic
959077068 3:101760473-101760495 TTGTAGAGAGAGCAGGGGAAGGG + Intronic
959459328 3:106605012-106605034 TTGGAGAGACAGTTTGTCAGAGG + Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962021860 3:131510296-131510318 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
963058975 3:141209513-141209535 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
964940506 3:162154463-162154485 TGGTAGAGATAGCTGGGGAGAGG + Intergenic
965286350 3:166824795-166824817 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
965335682 3:167428973-167428995 TGGTAGAGATAGCTGGGGAGAGG - Intergenic
965625925 3:170684028-170684050 TGGTGGAGATAGCTGGGGAGAGG + Intronic
966067397 3:175833965-175833987 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
966279710 3:178212636-178212658 TGGTAGAGATAGCTGGGGAGAGG - Intergenic
967236254 3:187386287-187386309 ATGGAGAAACTGTTGGGGAGTGG - Intergenic
969590080 4:8116962-8116984 TGGTATAGACAGTAGGAGAGGGG + Intronic
969649571 4:8457021-8457043 TTGTAGAGATAGTTGGGGGGGGG - Intronic
971619455 4:28836564-28836586 TTGGAGAGGAAGGTGGGGAGAGG - Intergenic
973058593 4:45691180-45691202 GTGTGGAGATAGCTGGGGAGAGG - Intergenic
973087630 4:46087287-46087309 TTATTGAGACAATTGGGAAGTGG + Intronic
973751476 4:54024451-54024473 TGATAGAGATAGCTGGGGAGAGG - Intronic
974173000 4:58291782-58291804 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
975134883 4:70865200-70865222 TTGTAGAGACAGGGGAGCAGGGG - Intergenic
975152479 4:71036171-71036193 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
975355705 4:73400958-73400980 TTGGAGAGAAAATTGGGGACAGG - Intronic
976180548 4:82394889-82394911 ATGAAGAGACACATGGGGAGAGG + Intergenic
976624770 4:87167937-87167959 TTGTAGAGACATTTGGCCAAAGG - Intronic
976739288 4:88342134-88342156 TGGTAGAGATAGCTGGGGAGAGG - Intergenic
977042145 4:92028885-92028907 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
980959842 4:139464098-139464120 TTGTAGAGACAGTGGGGGGGTGG - Intronic
982319393 4:154062711-154062733 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
983056147 4:163101013-163101035 GTGTGGAGATAGCTGGGGAGAGG + Intergenic
983831645 4:172335456-172335478 TTGTAGAATGAGTTAGGGAGAGG + Intronic
983884803 4:172968499-172968521 TTGTAGAGGGAGGAGGGGAGAGG - Intronic
984165027 4:176296194-176296216 TAGTGGAGATAGCTGGGGAGAGG + Intergenic
985526482 5:405459-405481 TTGTTGTGACAGCTGGGCAGGGG + Intronic
985781375 5:1873670-1873692 TAGAAGGGACAGATGGGGAGAGG - Intergenic
985912930 5:2897237-2897259 TCGTAGAGGCAGCTGGGGATTGG + Intergenic
986036482 5:3945208-3945230 TTGTAGAGACAGGCCGGGCGCGG + Intergenic
986139998 5:5020533-5020555 ATGTAGAAAGTGTTGGGGAGAGG + Intergenic
986368393 5:7057636-7057658 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
986622171 5:9687507-9687529 TGGGAGAGACAGTGGGGGTGGGG - Intronic
986702745 5:10427539-10427561 ATGTGGAGACAGTTATGGAGAGG - Intronic
987847639 5:23306967-23306989 CTGAAGAGACACTTAGGGAGAGG + Intergenic
988128493 5:27073656-27073678 TTGCAGAGACTGTTGCAGAGAGG - Intronic
988199570 5:28051146-28051168 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
988867106 5:35347540-35347562 TTGTAGAAAAAGTTGGTGACTGG - Intergenic
989430301 5:41346687-41346709 TTATAGAGATAGTTGGAGAGTGG - Intronic
989445443 5:41522984-41523006 TTGGGTAGAAAGTTGGGGAGAGG + Intergenic
990217023 5:53545586-53545608 TTATAGATACAGCTGTGGAGGGG - Intergenic
990229401 5:53695361-53695383 CAAGAGAGACAGTTGGGGAGAGG - Intergenic
990524455 5:56610879-56610901 TTGAAGAGGCAGTTTGGGAAAGG + Intergenic
990564701 5:57017519-57017541 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
991086831 5:62655604-62655626 TTTTAGAGGAAGTTGGGGGGTGG + Intergenic
992041282 5:72835978-72836000 TTCCAGATACAGTTGGGTAGGGG + Intronic
992451588 5:76880997-76881019 TGGTGGAGATAGCTGGGGAGAGG + Intronic
992794945 5:80247467-80247489 TTGTAGGCACGGTTGAGGAGAGG - Intronic
994375349 5:99011899-99011921 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
995124849 5:108569844-108569866 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
995447392 5:112260516-112260538 TTCTAGAGAGAGTTGGGGTGGGG - Intronic
995650304 5:114361889-114361911 TGGCAGAGAAAGATGGGGAGGGG - Intronic
996358159 5:122619134-122619156 TGGTGGAGAGAGCTGGGGAGAGG + Intergenic
996725231 5:126668478-126668500 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
996826395 5:127686536-127686558 TTGGAGTTACAGCTGGGGAGAGG + Intergenic
996918123 5:128734895-128734917 TGGTGGAGATAGCTGGGGAGAGG - Intronic
997549275 5:134738180-134738202 TAGTAGAGACGGGTGGGGGGAGG + Intergenic
998546291 5:143030701-143030723 TGGTAGAGAGAGTTGCCGAGGGG - Intronic
1000734722 5:164884909-164884931 GTGCAGAGACATTTGGGGATTGG - Intergenic
1000759810 5:165208127-165208149 GGGAAGAGACAGCTGGGGAGGGG + Intergenic
1002383471 5:178847984-178848006 TTGTACAGATGGTTTGGGAGTGG + Intergenic
1003458296 6:6305284-6305306 TTGTAGAGAGAGGTGGGTACAGG - Intronic
1005008552 6:21313899-21313921 TTCTAGAGACAGTTGGAGTGCGG + Intergenic
1005757255 6:28936101-28936123 TTGTAGAGATGGTGGGGCAGGGG + Intergenic
1005829629 6:29660187-29660209 TTTTAGAGACGGGTAGGGAGTGG - Intronic
1006443930 6:34068527-34068549 TTTTTGAGACAGGTGGGGTGGGG - Intronic
1006805801 6:36788213-36788235 TTGTAGAGATGGTCGGGGGGGGG + Intronic
1007021213 6:38523321-38523343 TGGTGGAGACGGTTGGTGAGTGG - Intronic
1007082984 6:39121888-39121910 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1007300390 6:40863591-40863613 TTGTGGAGATAGCTGGGGAGAGG + Intergenic
1007462443 6:42028256-42028278 TGGAAGAGAGAGCTGGGGAGAGG + Intronic
1007926865 6:45656564-45656586 TTCTAGAGATAGTTGGGATGTGG - Intronic
1008511919 6:52284255-52284277 TTGAGGAGACTGTGGGGGAGGGG - Intronic
1008849893 6:56012177-56012199 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1008956796 6:57224393-57224415 TCATAGAGACAGTTGGGGGGTGG + Intergenic
1009366332 6:62860698-62860720 TCGTAGAGCCAGGTGGGGATGGG + Intergenic
1009464799 6:63955499-63955521 TAGTGGAGATAGCTGGGGAGAGG - Intronic
1009749791 6:67868819-67868841 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1009895836 6:69747253-69747275 TTGCAGAGAGAGAAGGGGAGGGG - Intronic
1011550623 6:88528337-88528359 TAGGAGAGGCAGGTGGGGAGAGG - Intergenic
1012535191 6:100287570-100287592 TTGGAGAGGCAGCTGGGGAAGGG + Intergenic
1013489261 6:110629397-110629419 GTGGAGTGACAGTTGGGGAGGGG - Intronic
1014114869 6:117659873-117659895 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1016205020 6:141458488-141458510 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1018811334 6:167300403-167300425 TTGTAGAATCAGCTGGGGAGGGG + Intronic
1019661922 7:2229300-2229322 TTGTAGGGAGTGGTGGGGAGTGG - Intronic
1020202575 7:6091755-6091777 TTTTGGAGACAGTGGGGGATGGG + Intergenic
1021173186 7:17419646-17419668 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1021256727 7:18401363-18401385 TTGAAGATGCAGTTGGGAAGAGG + Intronic
1021661012 7:22917906-22917928 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1022373330 7:29790282-29790304 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1022481015 7:30743185-30743207 TTGGAAAGACAGTTGGTGACGGG - Intronic
1023025857 7:36049130-36049152 TCCTAGAGACAGATGGGGACAGG + Intergenic
1024045978 7:45585982-45586004 GTGTTGAGACACGTGGGGAGCGG + Intronic
1026110179 7:67453354-67453376 TTGAAGAGACAGTGGGGGTTGGG + Intergenic
1027354827 7:77344797-77344819 TGGTGGAGATAGCTGGGGAGAGG - Intronic
1028235310 7:88354193-88354215 TTGGAGAGACAGTGGAGGTGGGG - Intergenic
1028404287 7:90459476-90459498 TTTAAGAGACAGTTGGGGCCAGG + Intronic
1028697941 7:93738376-93738398 TTTTATAGCCAGTTGTGGAGTGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1029478951 7:100801585-100801607 TTGTAGAGACGGGTTGGGGGGGG - Intergenic
1029618969 7:101678113-101678135 TTGTAGAGATGGTTGGAGCGGGG - Intergenic
1030194110 7:106836286-106836308 TCGTGGAGATAGCTGGGGAGAGG - Intergenic
1030211777 7:107003941-107003963 TTTTAGAAAGGGTTGGGGAGTGG - Intergenic
1032259729 7:130325562-130325584 TTATAGAGACATTGGGGGCGGGG - Intergenic
1033064307 7:138139053-138139075 ATATAGAGAATGTTGGGGAGGGG - Intergenic
1033211972 7:139466599-139466621 TGGTGGAGATAGCTGGGGAGAGG - Intronic
1033625914 7:143109463-143109485 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1033815496 7:145067865-145067887 TTGTAGATTGAGTTGGGGAGTGG + Intergenic
1033994491 7:147329025-147329047 AGGTAGAGACAGATGAGGAGAGG - Intronic
1034084502 7:148311407-148311429 TGGTGGAGATAGCTGGGGAGAGG + Intronic
1034203622 7:149297584-149297606 TTGTTGAGACAGGAGTGGAGTGG + Intergenic
1035895423 8:3394617-3394639 GTGTAGAAAAAGTTGGGGGGAGG + Intronic
1036550123 8:9808277-9808299 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1036679924 8:10864491-10864513 CTGTTGAGGCAGTAGGGGAGTGG + Intergenic
1039409041 8:37336579-37336601 TTGTAAAGCCAGTTGGCTAGAGG + Intergenic
1039419152 8:37421186-37421208 CTGCAGAGCCAGATGGGGAGGGG - Intergenic
1039725950 8:40216785-40216807 TAGAAGTGACAGTTGGAGAGAGG - Intergenic
1039987754 8:42462155-42462177 TTCCAGAGACAGGAGGGGAGGGG + Intronic
1040399288 8:47032287-47032309 TTGTAGTGACAGCTTGGTAGTGG + Intergenic
1040480670 8:47823343-47823365 AAAGAGAGACAGTTGGGGAGGGG - Intronic
1040648500 8:49425306-49425328 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1041274790 8:56145794-56145816 TTGTATAAAAAGTAGGGGAGGGG + Intergenic
1041651347 8:60306428-60306450 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1041917078 8:63148689-63148711 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1042342869 8:67698677-67698699 TTATAAATCCAGTTGGGGAGAGG - Intronic
1042548805 8:69974982-69975004 TAGTAGAGACAGGTGGCGGGGGG + Intergenic
1042918018 8:73894219-73894241 TTGTAGATAGAGATGGGGAGAGG - Intergenic
1043502145 8:80868941-80868963 TTGTAGAGAAAGTGGAGGACTGG - Intronic
1043597034 8:81899026-81899048 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1043707674 8:83372978-83373000 TTCTGGAGACAGTTTGGGATGGG + Intergenic
1044946080 8:97391360-97391382 TTGCAGAGCCATTTTGGGAGAGG - Intergenic
1044985433 8:97752719-97752741 TTCTAGAGCCAGTTGGGAGGAGG + Intergenic
1046075400 8:109306348-109306370 TGGCAGAGATAGCTGGGGAGAGG - Intronic
1047078902 8:121437327-121437349 TGGGAGAGAAAGTTGGGGATAGG - Intergenic
1047434922 8:124828274-124828296 TTGTAGAGATGGGTGGGGGGGGG + Intergenic
1047766482 8:127994128-127994150 AAGGAGAGACAGTTGGAGAGGGG - Intergenic
1047909991 8:129517690-129517712 GTTTAGATACACTTGGGGAGGGG + Intergenic
1048113670 8:131496111-131496133 TTGTAGAGAAAGTTGAGCATTGG - Intergenic
1049290455 8:141798849-141798871 TTGTAGGGACAGTGGGGTTGTGG - Intergenic
1050788470 9:9435340-9435362 TTGTAGAGATGGGTGGGGTGGGG - Intronic
1051028757 9:12647780-12647802 TGGTGGAGAAAGGTGGGGAGAGG + Intergenic
1051099941 9:13509457-13509479 TTTTACAGATAGCTGGGGAGGGG + Intergenic
1051600038 9:18863396-18863418 GTGAAGAGACATTTGGGGAATGG + Intronic
1052048407 9:23821195-23821217 TTGGAGGGAAAGTGGGGGAGGGG - Intronic
1052653878 9:31332409-31332431 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1052785747 9:32826658-32826680 TTATAGAGACTGGAGGGGAGAGG + Intergenic
1053003966 9:34592287-34592309 TTGGAGATGGAGTTGGGGAGAGG - Intergenic
1053078116 9:35152244-35152266 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1053312223 9:37027142-37027164 TCGGAGAGCCAGTTGGAGAGAGG - Intronic
1054885028 9:70187173-70187195 TAGGAGAGACAGTTAGGCAGGGG - Intronic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056324432 9:85464661-85464683 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1057027563 9:91746543-91746565 GTGTAGACACACTTGGCGAGCGG + Intronic
1057792307 9:98132326-98132348 TTGGAGAGACAGTAGAGGATCGG + Intronic
1057900826 9:98946657-98946679 TTTTATAGCCAGTTGGGCAGTGG - Intronic
1058690248 9:107514305-107514327 TTGTAGAGACAGCAGGGGGAGGG - Intergenic
1059993771 9:119889849-119889871 TTTTACATAGAGTTGGGGAGGGG + Intergenic
1060519829 9:124287954-124287976 TTATGGAGACAGTGGGGGAGGGG + Intronic
1061349777 9:130054906-130054928 TTGTAGAGACAGGTTTGGGGAGG - Intronic
1186520053 X:10197851-10197873 TTGTCAAGACAGATGGGGAGGGG + Intronic
1186898559 X:14029835-14029857 TTGGAGAGACAGAGGGGGAGTGG + Exonic
1188214872 X:27463568-27463590 TTTAAGAGACAGTAGGGGATGGG - Intergenic
1191013841 X:55789386-55789408 TTGTGGAGATAGCTGTGGAGAGG + Intergenic
1191662567 X:63666132-63666154 TGGTAGAGACAGAGGGAGAGAGG + Intronic
1191761883 X:64655355-64655377 TCGTGGAGATAGCTGGGGAGAGG - Intergenic
1192730986 X:73802457-73802479 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1194909919 X:99629746-99629768 CTGTATATACAGTTGGGAAGAGG - Intergenic
1195016586 X:100787416-100787438 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1196226888 X:113178147-113178169 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1196547809 X:116984468-116984490 TTCTAGGGACAGTTGGGGAGGGG + Intergenic
1197702301 X:129608491-129608513 TTGTAGATACTGCTGGGGACAGG - Intergenic
1198103869 X:133444383-133444405 TTGTGGGGACAGTTAGGGGGAGG + Intergenic
1198890997 X:141395988-141396010 TGGTGGAGATAGTTGGGGAGAGG + Intergenic
1200813279 Y:7506058-7506080 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1201233722 Y:11890623-11890645 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1201307077 Y:12560234-12560256 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1201860572 Y:18593240-18593262 TTTTAGACACAGTTATGGAGGGG + Intergenic
1201872751 Y:18727141-18727163 TTTTAGACACAGTTATGGAGGGG - Intergenic
1201891232 Y:18946066-18946088 TGGTGGAGATAGCTGGGGAGAGG + Intergenic
1201891582 Y:18948661-18948683 TGGTGGAGATAGCTGGGGAGAGG - Intergenic
1202075981 Y:21038350-21038372 TGGTGGAGATAGCTGGGGAGAGG + Intergenic